ID: 1088151030

View in Genome Browser
Species Human (GRCh38)
Location 11:106745611-106745633
Sequence AGATGGGTTGGTAGTTAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 147}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088151030 Original CRISPR AGATGGGTTGGTAGTTAAGA AGG (reversed) Intronic
900812916 1:4821574-4821596 AGATGGGTTGGTAGGGTGGAGGG - Intergenic
903359975 1:22770894-22770916 AGATGGGTGGGTGGGTAAGTGGG + Intronic
904129952 1:28268217-28268239 AGAGGGGGTGGTAGTTAATGAGG + Intronic
905149096 1:35912997-35913019 AGATGGGTGAGTTGTTGAGACGG - Intronic
907756457 1:57315429-57315451 AGATGGGTGGATAGTTAGGTGGG + Intronic
909168728 1:72265209-72265231 AGATAGGTTGGTGGTTAAACAGG - Intronic
911692310 1:100848305-100848327 AGATGGGTTGCAAGGAAAGAGGG + Intergenic
912252396 1:108024993-108025015 AGATAGGTTGGTAGATTTGATGG + Intergenic
912723445 1:112039199-112039221 AGATGAGTTGGTGGTTCAGGAGG - Intergenic
914864080 1:151411175-151411197 AGAGGGGTTGGAAGTTAGGCAGG - Intronic
916003282 1:160636514-160636536 AGAGGGACTGGTAGTTAAAAAGG + Intronic
917475473 1:175365693-175365715 GGAAGGGTTGGAAGTAAAGAGGG - Intronic
921668652 1:217902532-217902554 AAATTAGTTGGCAGTTAAGAAGG + Intergenic
1067267883 10:44762791-44762813 AGATGGGGTGGATGTTAAGATGG - Intergenic
1070440072 10:76434540-76434562 TGATGGGTGGGTAGGTAAGTGGG - Intronic
1070485332 10:76924989-76925011 AGCTGGGTTGGGAGGGAAGAGGG - Intronic
1071004265 10:80864281-80864303 AGATGGCTTTGTAATTAATACGG + Intergenic
1080438469 11:32268383-32268405 AGATGGGTTGGTGGAAAAGAAGG + Intergenic
1081543759 11:44054997-44055019 AGATGGGGTGGTACATCAGAAGG - Intronic
1083376149 11:62223441-62223463 AGATGGTTTGGTAAATAAAAAGG + Intergenic
1084037695 11:66522890-66522912 AGATGGCTTGAAAGTTAAAAAGG + Intronic
1084716040 11:70874092-70874114 AGATGGATTGATAGATAAGATGG - Intronic
1085277601 11:75310016-75310038 AGATAGGTTGGTGGCTAAGAGGG - Intronic
1085555762 11:77420140-77420162 ATTTGGGTTGGTATTGAAGAAGG + Intronic
1088151030 11:106745611-106745633 AGATGGGTTGGTAGTTAAGAAGG - Intronic
1089103565 11:115983768-115983790 AGATGGGTTTGTAATTCAGCTGG + Intergenic
1089124836 11:116169565-116169587 AGCTGGGTTGGGAGATAAGAGGG - Intergenic
1089418303 11:118312213-118312235 AGATTGGTGGGTAGATGAGAAGG + Intronic
1091327170 11:134700087-134700109 AGCTGGGGTGTCAGTTAAGAAGG + Intergenic
1092097190 12:5852601-5852623 AGATCTGTTGGTAGTGAAAATGG + Intronic
1093221179 12:16422208-16422230 AGATGGGCTGGTTGATCAGAGGG - Intronic
1096428024 12:51520759-51520781 AGATGGGAGGGTGGTGAAGAAGG + Intergenic
1096720283 12:53516301-53516323 AGATTGCTTGGTAGTGAAAAGGG - Exonic
1097665325 12:62471550-62471572 TGATGGTTTGGCACTTAAGAGGG + Intronic
1097964081 12:65560452-65560474 GGATGGGTTGGGGGTGAAGATGG + Intergenic
1100451416 12:94710630-94710652 AGATGGGTTAGTGGTCAAGGAGG + Intergenic
1103256198 12:119543527-119543549 AGATGGGTAGGCAGATAAGGAGG + Intergenic
1106567060 13:30895441-30895463 AGCTGGGTTGGTGCTTAGGACGG - Intergenic
1107864504 13:44690607-44690629 AGATGGGTGGGAAGTCAAGGAGG + Intergenic
1108517794 13:51219472-51219494 AGATGGATTAGTAATTAAGAAGG - Intergenic
1110203776 13:72885864-72885886 AGATGGTCTGGTAGTAAAGATGG - Intronic
1111901331 13:94202779-94202801 GGATGGGATGGTATTTACGAAGG + Intronic
1119142728 14:72282466-72282488 AGAGGGGTTGGAAGACAAGATGG + Intronic
1120510743 14:85411046-85411068 AGATGGTTTGTTAGATAAGTTGG + Intergenic
1120539654 14:85737063-85737085 AGATGGGTCTGTAGAAAAGAAGG + Intergenic
1121840746 14:97131805-97131827 AGATGGGTGGGAAGATTAGATGG + Intergenic
1124621579 15:31277014-31277036 AGCTGGGTAGGCAGTTAACAAGG - Intergenic
1125022965 15:35003140-35003162 AGATGGCTGGCTATTTAAGAAGG + Intergenic
1127464649 15:59232169-59232191 AGATGGGTTGGTAGAGTAGTTGG - Intronic
1130535499 15:84782584-84782606 TGATGGGTGTGTAGTGAAGATGG + Intronic
1135505163 16:23030054-23030076 AGATGGGCTGCCTGTTAAGAAGG + Intergenic
1135893027 16:26374288-26374310 GGATGGGTGGATAGATAAGATGG + Intergenic
1137891390 16:52166363-52166385 AGATGGGCTGCTAGATGAGAAGG - Intergenic
1139054371 16:63164138-63164160 AGATGGGTTGGAAGTGAATATGG - Intergenic
1139755260 16:69137795-69137817 AAATAGGTTGGTTGTGAAGATGG + Exonic
1143889383 17:10091002-10091024 AGAAGGGTTGGGAGTCAGGATGG - Intronic
1144241392 17:13315889-13315911 AGAGGGCTTGTTATTTAAGAAGG - Intergenic
1144532802 17:16056138-16056160 TGATGGGTTGGTAGGTAGGCTGG + Intronic
1144545791 17:16194021-16194043 GGAAGGGATGGTAGTTAGGAAGG - Intronic
1145261410 17:21356926-21356948 GGATGGGTGGGTGGGTAAGATGG - Intergenic
1147409672 17:40240395-40240417 AGATGGGGTGATAGTGTAGAAGG - Intronic
1149781579 17:59400982-59401004 AGATGTGTTGTTTGTGAAGATGG + Exonic
1150953996 17:69835362-69835384 AGATTGGTTGATGGTCAAGAAGG - Intergenic
1151153213 17:72105599-72105621 AGCTGCCTTGGGAGTTAAGATGG - Intergenic
1152060638 17:78071954-78071976 AGATTGGATGGCAGTTCAGATGG + Intronic
1153704042 18:7726574-7726596 AGTTTGGTTAGTAGTTGAGAAGG - Intronic
1159277917 18:66245095-66245117 AGATGGATAGATAGATAAGAGGG + Intergenic
1159875206 18:73803318-73803340 AGGTGCGTTGGAAGTTGAGAAGG + Intergenic
1160347257 18:78143692-78143714 AGATTGGTTGGTATTTAATGTGG - Intergenic
1161711933 19:5853707-5853729 AGATGGGTTCGTAGAAAAGGAGG - Intergenic
1164239620 19:23373072-23373094 ATCTGGGTTTGTAGTGAAGAAGG - Intronic
1164709991 19:30349092-30349114 AGCTAGGTTGATTGTTAAGATGG + Intronic
1168009266 19:53517456-53517478 AGGATGGTTGGCAGTTAAGATGG - Intergenic
925418309 2:3689445-3689467 AAATGGGTCAGTAATTAAGAAGG - Intronic
927219872 2:20696873-20696895 AGATGGGAGGGGAGGTAAGAAGG - Intronic
927698807 2:25254504-25254526 AGATGGGTTGGAACAGAAGAGGG - Intronic
927827551 2:26319121-26319143 AGATGGGATGGGAGGGAAGAGGG + Intronic
927951774 2:27175146-27175168 AAATGTGGTGGTAGTTAAGGTGG - Intergenic
930047151 2:47182775-47182797 AGATGGGTAGGTAGTTTATTTGG - Intergenic
930952943 2:57166038-57166060 AGATGATTTGGCTGTTAAGATGG + Intergenic
936810047 2:116387595-116387617 ATATGGGTAGAAAGTTAAGAGGG - Intergenic
937303490 2:120857364-120857386 AGATGGGTAGGTAGGTGAGTGGG - Intronic
938928019 2:136062066-136062088 AGGTGGGTGGGTAATTAAGGTGG - Intergenic
939444009 2:142285799-142285821 AGATGGGTTAGAGTTTAAGATGG - Intergenic
940726534 2:157342218-157342240 AGATGGGTTTGTAGAAAAGGAGG + Intergenic
941562567 2:167066592-167066614 AGTGGGGTTGCTAGTTAATATGG - Intronic
942389686 2:175479113-175479135 AGAGTGGTTGGTATTTAAAATGG + Intergenic
942472773 2:176278983-176279005 TGATTGGTTGGTAATAAAGAAGG + Intronic
942545468 2:177058764-177058786 AAGTGGATTGGTAGTGAAGATGG + Intergenic
945811507 2:214555101-214555123 AGAAATGTTTGTAGTTAAGATGG - Intronic
947564101 2:231182916-231182938 AGATAGGTAGGTAGTTAGGTAGG - Intergenic
948967100 2:241391347-241391369 AGATGGGGTTGTAGTGAAGCGGG + Intronic
1168740813 20:189899-189921 AAATGGGTTGGAAGCTCAGACGG - Intergenic
1169442491 20:5644338-5644360 AGATGGGGTGGTAATGGAGAGGG - Intergenic
1169934532 20:10869357-10869379 AGATAGAGTGGTAGATAAGATGG + Intergenic
1174239790 20:49124310-49124332 AGATGGGTGGGGGGTTTAGAAGG - Intronic
1175558237 20:59890564-59890586 AGATAGGTAGGTAGGTAAGTAGG + Intronic
1177478524 21:21655250-21655272 AGATGATTAGGTAATTAAGAGGG - Intergenic
1179730099 21:43362932-43362954 AGATGGGTCGGTAGATTATACGG - Intergenic
1182006810 22:26967139-26967161 AGAGGGGTTGGCAGTTAGCAAGG + Intergenic
1182072117 22:27470923-27470945 AGATGGGTGGGTAGGTAAGCAGG + Intergenic
1182708896 22:32308068-32308090 AGGTAGGTAGGTAGGTAAGAAGG - Intergenic
949736458 3:7177611-7177633 AGATGGGGTGGGAGAAAAGAAGG + Intronic
950497475 3:13342612-13342634 AGAAGGGCTGGTAATTAAAAGGG - Intronic
953834564 3:46331514-46331536 AGATGGGTTCGTAGAAAAGAAGG + Intergenic
955653344 3:61218069-61218091 AGATGGGACTGTAGCTAAGAGGG + Intronic
956152421 3:66257740-66257762 AGATGGATTCAGAGTTAAGAGGG - Intronic
956613122 3:71144508-71144530 AGATGGGTTGGCAGAAAAGTGGG + Intronic
958750906 3:98192581-98192603 AGATGGGTTGGTAGAAAAGGAGG - Intronic
961250047 3:125494295-125494317 ATATGGGATGGTAATTAAGGAGG + Intronic
961403159 3:126661281-126661303 AGAAGGGCTGGTAATTAAAAGGG + Intergenic
963298716 3:143575839-143575861 AAATGGGTAGGTGGTTAGGAAGG + Intronic
965781009 3:172285927-172285949 ATATGAGTTGGAAGTAAAGAGGG + Exonic
965862074 3:173160020-173160042 AGATGGGTTTGTAGAAAAGGAGG + Intergenic
967380927 3:188857013-188857035 AGATGTGTTGGTATTCAAAAAGG + Intronic
969871416 4:10107294-10107316 AGATGGGTTGGGAGTTGGCAAGG - Intronic
973699471 4:53522175-53522197 AGATGGGTTTGATGTGAAGAGGG - Intronic
976507875 4:85870579-85870601 AGATGAGTTAGTAGAAAAGAAGG - Intronic
976602579 4:86951465-86951487 AAATGGGTTGCAAGTTAAGAGGG - Intronic
981203130 4:142006897-142006919 AGATGGATTGGAACTTAAGATGG - Intergenic
985149817 4:186935331-186935353 AGATGGGTTTGAAGTTCACACGG - Intergenic
985829647 5:2219091-2219113 AGATGGGTTGGTGGATGAGTGGG - Intergenic
988716553 5:33834659-33834681 GTATGGGATGGTGGTTAAGAGGG - Intronic
989182601 5:38593583-38593605 AGACGGGTGGGTAGATGAGAGGG + Intronic
992112080 5:73504486-73504508 AGAGGGGTGGTAAGTTAAGATGG + Intronic
992470369 5:77046320-77046342 AGAAGGGTGGGTAGATACGAGGG - Intronic
995001097 5:107131076-107131098 AGATGGGTAGGTAGGTAGGTAGG + Intergenic
996985379 5:129556153-129556175 AGATGGTTTGGTAGGTCAGTAGG + Intronic
999955319 5:156695014-156695036 TGATTGGTTTGCAGTTAAGAAGG - Intronic
1001120216 5:168974079-168974101 AGATGGGTAGGTAGATAGGTAGG - Intronic
1001367779 5:171161470-171161492 AGTTGGGTTGCTGGTTATGATGG + Intronic
1003691165 6:8355029-8355051 GGATGGGTTTGGAGTTCAGAAGG + Intergenic
1005884970 6:30090681-30090703 TGATGAGTTGGGAGTAAAGATGG - Intergenic
1007505627 6:42333039-42333061 TGATGGGTTGGAGGTTAATAGGG + Intronic
1007582291 6:42966713-42966735 AGATGGGTGGGTGGTGAGGAAGG - Intronic
1007703933 6:43780048-43780070 GGATGGGGTGGGAGTTAAGGAGG - Intronic
1010084330 6:71898890-71898912 GAATGTGTTGGTAGTTAAAATGG - Intronic
1016902599 6:149117085-149117107 AGATGGGGTGATGGTGAAGAAGG - Intergenic
1018621670 6:165735011-165735033 AGATAGGTAGGTAGTTAGGTAGG + Intronic
1018621728 6:165735344-165735366 AGATGGGTAGGTAGATAGGTGGG + Intronic
1027407782 7:77880387-77880409 GGATGGGATGGCAGCTAAGATGG - Intronic
1028662250 7:93292705-93292727 AAATGTTTTGGTAGTTTAGAAGG + Intronic
1028728503 7:94117327-94117349 AGCTGGACTGGTAGTCAAGAAGG - Intergenic
1031363392 7:120874400-120874422 AGATAGGTAGGTAGGTAAGTAGG - Intergenic
1034159815 7:148984982-148985004 AGATGGATGGATAGTTAGGAGGG - Intergenic
1035042058 7:155936141-155936163 AGATGGAATGGGAGTTGAGATGG + Intergenic
1035531070 8:351207-351229 AGATAGGTTGGTAGCTAGGTAGG + Intergenic
1035531099 8:351414-351436 AGATAGGTAGGTAGATAAGCAGG + Intergenic
1035531103 8:351450-351472 AGATAGGTAGGTAGATAAGCAGG + Intergenic
1036952287 8:13152701-13152723 GGGTGGGTTGGTAGCTAAGATGG + Intronic
1037246949 8:16845971-16845993 AGAAGGGTTGGGAGTGAACATGG - Intergenic
1043597556 8:81902621-81902643 AGATGGGTTTGTAGAAAAGAAGG + Intergenic
1043865735 8:85373186-85373208 AGATGGGTGTTTCGTTAAGACGG + Intronic
1049149961 8:141028397-141028419 GGATGTGTTGGTAGTGAAGAAGG - Intergenic
1051526743 9:18053550-18053572 AGAAAGGTTGGCAATTAAGAAGG - Intergenic
1053060072 9:35023731-35023753 AGATGGGTCTGTAGAAAAGAAGG + Intergenic
1056812325 9:89774461-89774483 ACATGGGTGGGTAGATAAGATGG + Intergenic
1060139502 9:121196607-121196629 GGATGGTGTGGTGGTTAAGAGGG - Intronic
1061932265 9:133839166-133839188 AGATGGGTGGGTGGGTAAGTAGG + Intronic
1062225690 9:135448592-135448614 AGATGGCTTGGTATTGAAGAAGG + Intergenic
1187304100 X:18079424-18079446 AGAGGGGTTGGAAGATTAGAGGG + Intergenic
1188393573 X:29652400-29652422 GGATGGGTTAGGATTTAAGAAGG + Intronic
1195145986 X:102018034-102018056 AGCTGGGATGGTGGTTAAAAAGG - Intergenic
1196109000 X:111926171-111926193 AGGTGGGTTGGGAAATAAGAAGG - Intronic
1197482399 X:127003924-127003946 ACATAGGCTGGTAGTTAAGTCGG + Intergenic
1198642367 X:138770493-138770515 AGAGGGGTTGGAACTTAAGCAGG - Intronic