ID: 1088154798

View in Genome Browser
Species Human (GRCh38)
Location 11:106790258-106790280
Sequence CTATGGTGGTGGTGGCCACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 947
Summary {0: 1, 1: 10, 2: 64, 3: 230, 4: 642}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088154798_1088154813 30 Left 1088154798 11:106790258-106790280 CCCTGTGGCCACCACCACCATAG 0: 1
1: 10
2: 64
3: 230
4: 642
Right 1088154813 11:106790311-106790333 GATGTTCACTTAAGGCCCAAGGG 0: 17
1: 129
2: 292
3: 508
4: 701
1088154798_1088154810 22 Left 1088154798 11:106790258-106790280 CCCTGTGGCCACCACCACCATAG 0: 1
1: 10
2: 64
3: 230
4: 642
Right 1088154810 11:106790303-106790325 CTACCGCTGATGTTCACTTAAGG 0: 1
1: 13
2: 133
3: 300
4: 666
1088154798_1088154812 29 Left 1088154798 11:106790258-106790280 CCCTGTGGCCACCACCACCATAG 0: 1
1: 10
2: 64
3: 230
4: 642
Right 1088154812 11:106790310-106790332 TGATGTTCACTTAAGGCCCAAGG 0: 14
1: 113
2: 272
3: 487
4: 801
1088154798_1088154807 -1 Left 1088154798 11:106790258-106790280 CCCTGTGGCCACCACCACCATAG 0: 1
1: 10
2: 64
3: 230
4: 642
Right 1088154807 11:106790280-106790302 GGCCCACAGGGACATCAAACAGG 0: 1
1: 0
2: 0
3: 11
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088154798 Original CRISPR CTATGGTGGTGGTGGCCACA GGG (reversed) Intronic
900388094 1:2419723-2419745 CTCTGGTGGAGGTGGTGACATGG + Intergenic
900940217 1:5793614-5793636 CAGTGGTGGTGGTGGCCAGATGG + Intergenic
900987417 1:6081209-6081231 CTGTGGTGGTGGCTGCCTCATGG - Intronic
902375030 1:16026580-16026602 CGATGGTCGTGGTGCGCACACGG - Exonic
902380001 1:16048387-16048409 CGATGGTCGTGGTGCGCACACGG - Exonic
904415812 1:30360448-30360470 CCTTGGAGGTGGTGGCAACATGG + Intergenic
904939699 1:34157089-34157111 GTTTCCTGGTGGTGGCCACATGG + Intronic
905244331 1:36602315-36602337 CTGTGGTGGGGGTGGGGACAGGG - Intergenic
906352792 1:45078583-45078605 TCCTGGTGGTGGTGGCCACAAGG - Intronic
906639128 1:47431078-47431100 CCAAGGTGGTGGTGGGCAAATGG - Intergenic
906734836 1:48115539-48115561 TGCTGCTGGTGGTGGCCACAGGG + Intergenic
907004205 1:50893959-50893981 CTGTGGTGGTGGTTACCACAGGG - Intronic
908175527 1:61552117-61552139 CTGGGGTGGTGGTGGCCATGGGG - Intergenic
908908098 1:69038928-69038950 TCATAGTAGTGGTGGCCACAAGG + Intergenic
909128628 1:71707377-71707399 CAAGGTTGGTGGTGGCTACAGGG + Intronic
909128689 1:71707735-71707757 TCATAGTGGTGGTGGCCACAGGG + Intronic
909309500 1:74129016-74129038 TTCCAGTGGTGGTGGCCACAGGG - Intronic
909316358 1:74224079-74224101 CCCCAGTGGTGGTGGCCACAGGG + Intronic
909384014 1:75035362-75035384 CAGGGGTAGTGGTGGCCACAGGG + Intergenic
909615744 1:77606219-77606241 CTGTGGTGATGGTGGCCATGGGG + Intronic
909781969 1:79558854-79558876 CTGTGGTGGTGGTGGTCACATGG + Intergenic
910289827 1:85589056-85589078 CCGTGGTGGTGGTGGCTACAGGG + Intergenic
910330702 1:86069334-86069356 GACTAGTGGTGGTGGCCACAGGG + Intronic
910379164 1:86608200-86608222 TCATAGTGGTGGTGGCCACAGGG - Intergenic
910716345 1:90235727-90235749 CAGTGGTGGTGGTGGCCACAGGG - Intergenic
911496603 1:98638450-98638472 TCATAGTGGTGGTGGTCACAGGG + Intergenic
911669691 1:100593697-100593719 CAGTGGTGATGGTGGCCACAGGG - Intergenic
911692576 1:100850955-100850977 CTATGGTGCAGGTGGGAACAGGG + Intergenic
911754785 1:101540942-101540964 CTATGTTGGTGAAGGACACAAGG - Intergenic
911811290 1:102285030-102285052 TCATAGTGGTGGTGGTCACAGGG + Intergenic
911853109 1:102843009-102843031 TTCTAGTGCTGGTGGCCACATGG + Intergenic
911942708 1:104068469-104068491 TGGTGGTGGTGGTAGCCACAGGG - Intergenic
912099772 1:106190802-106190824 TCATAGTGGTGGTGGCCACAGGG + Intergenic
912135956 1:106660188-106660210 TCATAGTGGTAGTGGCCACAGGG + Intergenic
912382729 1:109255937-109255959 CGATGGCGGTGGGGGACACAGGG + Intronic
912598594 1:110904006-110904028 TTGTGGTGGTAGTGGCTACAGGG + Intergenic
913099629 1:115551134-115551156 TAAAGATGGTGGTGGCCACACGG - Intergenic
913416759 1:118617988-118618010 TCCTAGTGGTGGTGGCCACAGGG - Intergenic
915479228 1:156173730-156173752 CTATGTAGGTGGAGGACACAAGG + Intronic
915557432 1:156668433-156668455 CAAGGGTGGGGGTGGCCCCAAGG + Intergenic
916053707 1:161053136-161053158 GGATGTTGGTAGTGGCCACATGG - Intronic
916193563 1:162202000-162202022 CTATGGGGGTGGTGGAGAAACGG + Intronic
916341777 1:163744986-163745008 CAGTGGTTGTGGTGGCCACTGGG - Intergenic
916360624 1:163963151-163963173 CTGGGGTGGTGGTGGCCATAGGG + Intergenic
916369360 1:164073324-164073346 TAATAGTGGTGGTGGCCACAGGG - Intergenic
917061594 1:171048066-171048088 TCAGAGTGGTGGTGGCCACAGGG - Intronic
917306371 1:173628868-173628890 TCCTAGTGGTGGTGGCCACAGGG + Intronic
918124665 1:181572487-181572509 CTGTGCTGGTGGTGGTCAGAGGG + Intronic
918416133 1:184310541-184310563 TCATAGTGGTGGTGGCCACAGGG - Intergenic
918756411 1:188344008-188344030 TCATAGTGTTGGTGGCCACAGGG - Intergenic
919003236 1:191861058-191861080 TCATAGTGGTGGTAGCCACAGGG + Intergenic
919336672 1:196244578-196244600 CTGGAGTGGTGGTGGCCACAGGG + Intronic
919754085 1:201055820-201055842 CTTTGGTGGTGGAGGCCAGGAGG - Intronic
920110343 1:203582986-203583008 CTGTGGTGGAGGCGGCTACATGG + Intergenic
920744963 1:208617531-208617553 CTGGGGTGGTGGTGGCTACAGGG + Intergenic
920957192 1:210630375-210630397 CTATGGTAGTGGTGTCACCAAGG - Intronic
921042648 1:211448500-211448522 CCAGGGTGGTGGTGGCTACAGGG + Intergenic
921042708 1:211448866-211448888 TCATGGTGTTGGTGGCCACAGGG + Intergenic
921238651 1:213154163-213154185 TCATAGTGGTGGTGGCCCCAGGG - Intronic
921456862 1:215381114-215381136 ACATAGTGGTGGTGGCCACAGGG + Intergenic
921994111 1:221397876-221397898 TCATAGTGGTGGGGGCCACAGGG + Intergenic
922045810 1:221945514-221945536 TCACAGTGGTGGTGGCCACAGGG - Intergenic
922108143 1:222530325-222530347 CTGGGGTGGTGCTGGACACAGGG + Intronic
922358053 1:224795444-224795466 CTGTGGTGGTGGTGGACATGGGG - Intergenic
922377194 1:224980362-224980384 CTGTGGTGGTGGTGGCCACGGGG + Intronic
922388707 1:225115216-225115238 CTCCAGTGATGGTGGCCACAGGG - Intronic
923925502 1:238622353-238622375 CAATGGTGGCTGTAGCCACAAGG + Intergenic
924056824 1:240132411-240132433 CATTGGTGGTTGTGGCCAGAGGG + Intronic
924185629 1:241486570-241486592 CTATTGTGGTGGTTGCCTAATGG - Intergenic
924490767 1:244535525-244535547 CTGTGGTGGTGGTGGCCACAGGG - Intronic
924516138 1:244767984-244768006 CCACGGTGGTGGTGGCCATGAGG - Intergenic
924833764 1:247627989-247628011 CTCTGATGCTTGTGGCCACAGGG - Intergenic
1063118898 10:3090684-3090706 CTATGGGGTAGGTGGACACAGGG - Intronic
1063759132 10:9052424-9052446 CTATTGTGGTGATGGCTTCATGG - Intergenic
1064137537 10:12763940-12763962 CTGTGGGGGTGGGGGCCACAGGG - Intronic
1065381480 10:25095786-25095808 CTGTGGTGGTGGTGGCCATCAGG - Intergenic
1065467713 10:26043582-26043604 CTGTGGTGGTGGTGACCATGGGG - Intronic
1066142925 10:32526177-32526199 CATTTGTGGTGGTGGCCACAGGG - Intronic
1067518452 10:46975161-46975183 TTATTGTGGTGGTGGTCTCATGG + Intronic
1067643798 10:48076667-48076689 TTATTGTGGTGGTGGTCTCATGG - Intergenic
1067977286 10:51041088-51041110 GTGGGGTGGTGGTGGCCACAGGG - Intronic
1068103896 10:52590722-52590744 CTGTGGTGGTGGTGGCCAAGGGG - Intergenic
1068134196 10:52935569-52935591 CCAGGGTGGAGGTGGGCACAGGG - Intergenic
1068422049 10:56807539-56807561 TTATAGTGGTGGTGGACATAAGG - Intergenic
1069933524 10:71899836-71899858 CTGTGGTGGTGGTGGCCACGGGG - Intergenic
1070388935 10:75951931-75951953 CCACGGTGGTGGCGGCCACTTGG + Intronic
1070477585 10:76845439-76845461 CTGTGGTTGTGGTGGCCATGTGG + Intergenic
1070915148 10:80148687-80148709 TCCTAGTGGTGGTGGCCACAGGG + Intergenic
1071418533 10:85464293-85464315 CTGTGGTGGTGGTGGCCATGGGG + Intergenic
1071767864 10:88689357-88689379 CTGGGGTGGTGGTGGCCATGGGG + Intergenic
1071869631 10:89780395-89780417 TCATAGTGGTGGTAGCCACACGG - Intergenic
1072083714 10:92057686-92057708 TCAGAGTGGTGGTGGCCACAGGG + Intronic
1072270697 10:93773744-93773766 TTTTGGTGGAGGTGGACACAGGG - Intronic
1072399811 10:95086517-95086539 TCATAGTGGTGGAGGCCACAGGG - Intergenic
1072877725 10:99191004-99191026 CTAGGGTGGTCGTGGCCACAGGG + Intronic
1073708156 10:106010470-106010492 CTGTGATGGTGGTGACCATAGGG - Intergenic
1074038090 10:109761348-109761370 TCATAGTGGTGGTGGCCATAGGG - Intergenic
1074151037 10:110759994-110760016 CAGTGGTGGTGGGGGGCACAGGG + Intronic
1075194989 10:120348523-120348545 CTGTGGTGGTGGTGGCCATGAGG + Intergenic
1075822035 10:125322831-125322853 CGATGGTGGAGGTGGTCAGATGG + Intergenic
1076094728 10:127721575-127721597 TAGTAGTGGTGGTGGCCACAGGG + Intergenic
1076171220 10:128321709-128321731 GTATGGAGCTGGTGCCCACAGGG - Intergenic
1077175583 11:1188606-1188628 CTGTGCTGGTGGTGGTAACAGGG - Intronic
1077388644 11:2288605-2288627 CAAGGCTGGAGGTGGCCACACGG - Intergenic
1077427481 11:2490149-2490171 CTGTAGTGGTGGTGGCCACAGGG + Intronic
1077740527 11:4840412-4840434 ACATACTGGTGGTGGCCACAGGG + Intronic
1079037978 11:17037165-17037187 CTGCAGTGGTGGTGGCTACAGGG + Intergenic
1079183555 11:18215380-18215402 CTGTGGTGGTAGTGGCCACGGGG + Intronic
1079248128 11:18768354-18768376 CTGAGTTGGTGGTGGCCACAGGG + Intronic
1079272174 11:18999219-18999241 TCATAGTAGTGGTGGCCACAGGG - Intergenic
1080128630 11:28766965-28766987 CTGTGGTGGTGGTGGCCATGGGG + Intergenic
1080489784 11:32750607-32750629 CTGTGGTGGTGGTGGCCATGGGG - Intronic
1081112106 11:39149115-39149137 CTAGGGTGGCAGTGGCTACAGGG + Intergenic
1081112161 11:39149473-39149495 TCATAGTTGTGGTGGCCACAGGG + Intergenic
1081245750 11:40764342-40764364 CTAGGGTAGTGGTGTCCACAGGG + Intronic
1083045294 11:59729123-59729145 GGATGGTGATGGTGGCCACACGG - Intronic
1083088090 11:60170697-60170719 CTGTGGTGGTGGTGAAGACATGG + Intergenic
1083265146 11:61543166-61543188 CTAAGGCTGTGCTGGCCACAGGG - Intronic
1084553568 11:69863205-69863227 TGGTGGTGGTGGTGGCTACAGGG + Intergenic
1085178495 11:74511499-74511521 ATGTGGTGGTGGTGGCCACAGGG + Intronic
1085194683 11:74661952-74661974 CTGTGGTGGTGGTGGCCATTGGG - Intronic
1085980570 11:81718912-81718934 CTATGGTGGTGGTAGACACAAGG + Intergenic
1086468142 11:87076300-87076322 TGGTGGTGGTGGTGCCCACATGG - Intronic
1086721398 11:90125887-90125909 CTATGGTGGTGGTGATCATGGGG + Intergenic
1087031968 11:93715250-93715272 CTGTGGTGGTGGTGGACAAGGGG - Intronic
1087083794 11:94196938-94196960 CTATAGTGGGGGTGTCCTCAGGG - Intergenic
1087313331 11:96576912-96576934 TGGTGGTGGTGGTGGACACAGGG - Intergenic
1087370750 11:97280283-97280305 CAGTGGTGGTGGTGGCCAGAGGG + Intergenic
1087380350 11:97398056-97398078 TCATAGTGGTGGTGGTCACAGGG - Intergenic
1087887627 11:103498187-103498209 CAGTAGTGGCGGTGGCCACAGGG + Intergenic
1087917954 11:103831823-103831845 CAATGGTGGTGGTGTCATCATGG - Intergenic
1088009865 11:104986697-104986719 CTGTGGTGCTGGTGGCCACAGGG + Intergenic
1088154798 11:106790258-106790280 CTATGGTGGTGGTGGCCACAGGG - Intronic
1088913273 11:114208123-114208145 CTATGGTGCTGGAGACCAGAAGG - Intronic
1088947658 11:114530716-114530738 CACTGGTGGTGGTGTTCACATGG + Exonic
1088985243 11:114899853-114899875 CTGTGGGGGTGGTAACCACAGGG + Intergenic
1088985301 11:114900206-114900228 TCTCGGTGGTGGTGGCCACAGGG + Intergenic
1089083340 11:115796115-115796137 CTGTGGTGGTGGCTGCCACAGGG - Intergenic
1089214151 11:116825510-116825532 CAATGGTGGTGGTGCCCAGGAGG + Intergenic
1089828560 11:121302857-121302879 CTATGGTTGTGGTGGCAGCATGG + Intronic
1090065254 11:123498003-123498025 GGCCGGTGGTGGTGGCCACAGGG - Intergenic
1090668304 11:128929763-128929785 GTGTGGTGGTGCTGGGCACAGGG - Intergenic
1091107049 11:132932380-132932402 CTAGTGAGGTGGTGGCTACATGG + Intronic
1091222511 11:133937579-133937601 CTAAGGTGGAGATGACCACAGGG + Intronic
1091764097 12:3107086-3107108 CAGTGGTGGTGGTGGCGGCAAGG - Intronic
1093538241 12:20248295-20248317 CTACAGTGGTGGTGCCCACAGGG + Intergenic
1093588564 12:20872152-20872174 CTGTGGTGGTGGTGGACACAGGG - Intronic
1093991161 12:25591384-25591406 CTGTGGTGGTGGTGGCCACAGGG + Intronic
1093991230 12:25591747-25591769 TTGTAGTGGTGGTGGCCACAGGG + Intronic
1094658089 12:32440579-32440601 TCATAGTGGTAGTGGCCACAGGG - Intronic
1095639786 12:44475013-44475035 TCATAGTGCTGGTGGCCACAGGG - Intergenic
1095860300 12:46908783-46908805 CTGAGGTGGTGGTGCACACAGGG + Intergenic
1096343899 12:50828530-50828552 CAGTGGTGGTGGTGGCCACAGGG - Intergenic
1098142803 12:67468634-67468656 TCATAGTGGTTGTGGCCACAGGG - Intergenic
1098333929 12:69382463-69382485 CTGTGGTAGTGGTGGACACAGGG - Intronic
1098395352 12:70011200-70011222 CTGTGGTGGTGGTAGCCATGGGG + Intergenic
1098405740 12:70123952-70123974 TGGTGATGGTGGTGGCCACAGGG + Intergenic
1098491980 12:71092787-71092809 CTGTGGTGGTAGTGGCCATTGGG - Intronic
1099016022 12:77345249-77345271 CTCTGGATGTGGAGGCCACATGG + Intergenic
1100875760 12:98959860-98959882 CTAGGGTAGTGGTGATCACAGGG + Intronic
1100946449 12:99788842-99788864 CAGAAGTGGTGGTGGCCACAGGG + Intronic
1101026152 12:100608934-100608956 CAGTGGTGGTAGTAGCCACAGGG - Intronic
1101607536 12:106258909-106258931 CTGTGGTGGTGGTGGACATGGGG + Intronic
1101845925 12:108362993-108363015 CCATGTTGGGGGTGGCTACATGG - Intergenic
1102318001 12:111905358-111905380 CCATGGTGGCGGTGGCCACAGGG + Intergenic
1102983260 12:117259055-117259077 CAAAGGTGCTGGTGACCACAAGG + Exonic
1104103101 12:125634195-125634217 CTGTGGTGGTGGTGGCCCCAGGG - Intronic
1105951094 13:25230082-25230104 AGAAGGTGGTGGTGGCCAGACGG - Intergenic
1106273494 13:28178839-28178861 CTGTGGTGGTGTTGGCTTCACGG + Intronic
1107083849 13:36405033-36405055 TCATAGTGGGGGTGGCCACAGGG - Intergenic
1107287733 13:38814832-38814854 CAGTGGTGGTGGTGGTCCCAGGG - Intronic
1107524099 13:41213445-41213467 TTACACTGGTGGTGGCCACATGG - Intergenic
1107807768 13:44171323-44171345 TCATCGTGCTGGTGGCCACAGGG - Intergenic
1108255906 13:48611129-48611151 CTGTGGAGTTGGTGGCCACAAGG - Intergenic
1108922643 13:55694209-55694231 TCATAGTGGTGATGGCCACATGG + Intergenic
1108962252 13:56248252-56248274 CTCCAGTGCTGGTGGCCACAAGG - Intergenic
1109336643 13:61003252-61003274 CTATGGTAGTGGTGGCCACAAGG - Intergenic
1109402832 13:61857654-61857676 CTGGGGTGGTGGTGACCACAGGG - Intergenic
1110076057 13:71244725-71244747 CTCTGGTGGGGGTAGCCACTTGG - Intergenic
1110501352 13:76231719-76231741 CTGTGGTGGTGATGGCCACAAGG + Intergenic
1110974648 13:81814946-81814968 GTATTGTGGTGGTGGCGAGAAGG + Intergenic
1111292043 13:86183305-86183327 TCTCGGTGGTGGTGGCCACAGGG + Intergenic
1112019048 13:95355851-95355873 TTATGGTGGTATTTGCCACAAGG - Intergenic
1112802123 13:103124302-103124324 GCATGGTGGTGGTGGCCACATGG + Intergenic
1112940473 13:104855177-104855199 CTCAGGTGGTAGTAGCCACAGGG + Intergenic
1113795294 13:113053666-113053688 GTTCGGTGGTGGTTGCCACAGGG + Intronic
1114250947 14:20959790-20959812 CTGTGGTGGAGGTAGCCACAGGG + Intergenic
1114761499 14:25321641-25321663 TCTTAGTGGTGGTGGCCACAGGG - Intergenic
1115133956 14:30086707-30086729 TGTTGCTGGTGGTGGCCACAGGG + Intronic
1115381507 14:32745577-32745599 TCATAGTGGTGGTGGCCATAGGG - Intronic
1115620225 14:35133889-35133911 TTCTAGTGGTGGTGGCCACAAGG - Intronic
1115620286 14:35134246-35134268 TGGTGGTGGCGGTGGCCACACGG - Intronic
1115648757 14:35388213-35388235 CCGTGGCGGTAGTGGCCACAGGG + Intergenic
1115821103 14:37212804-37212826 TCATAGTGGTGGTGGCCACAGGG + Intronic
1115861249 14:37688174-37688196 CTGAGATGGCGGTGGCCACAGGG + Intronic
1116021589 14:39468649-39468671 CAGTGATGGTGGTGTCCACAGGG - Intergenic
1116422180 14:44745340-44745362 CTGTGGTGGTGGTGTCCATGAGG + Intergenic
1116422239 14:44745674-44745696 TCCTAGTGGTGGTGGCCACAGGG + Intergenic
1116458401 14:45144605-45144627 CTATGGTAGTGGTGACCATGGGG - Intronic
1116765998 14:49070946-49070968 TGGTGGTGGTAGTGGCCACAGGG + Intergenic
1116889179 14:50250368-50250390 CAAAGGTGGTGGTAGCCACAGGG + Intronic
1116930633 14:50687791-50687813 TCAAAGTGGTGGTGGCCACAGGG - Intergenic
1117065440 14:52009213-52009235 CTAAGGTGGAGGTGGCCAGAGGG + Exonic
1117159329 14:52973437-52973459 CTGTGGTGGTGATGGCCACAGGG - Intergenic
1117321728 14:54630650-54630672 CTTTGGTGGTGGTGGTCATGGGG + Intronic
1117893327 14:60450394-60450416 TGATGGTCGTGGGGGCCACAGGG + Intronic
1118084360 14:62398451-62398473 CTGTGTTGGTGGCAGCCACAGGG - Intergenic
1118097016 14:62547745-62547767 ATCCAGTGGTGGTGGCCACAGGG + Intergenic
1118431163 14:65720231-65720253 TTGTAGTGGTGGTGGCCATAGGG - Intronic
1118543596 14:66858882-66858904 CTGTTGTGGTGGTGGCCATAAGG + Intronic
1118956753 14:70489641-70489663 TCACAGTGGTGGTGGCCACAGGG + Intergenic
1119189296 14:72669535-72669557 ATAGGGAGGTTGTGGCCACAGGG - Intronic
1120100218 14:80435858-80435880 TCCTGGTGTTGGTGGCCACAAGG + Intergenic
1120340634 14:83216961-83216983 TTCTGGTGTTGGTGGCCACAGGG - Intergenic
1120697498 14:87660059-87660081 CTGTGGTGGTGGTGGTCACAAGG + Intergenic
1120808258 14:88775845-88775867 TCATAGTGGTGGTGGCCACAGGG + Intronic
1123508593 15:20972120-20972142 CTGTGATGGTGGTGGCCACAGGG - Intergenic
1123565814 15:21545869-21545891 CTGTGATGGTGGTGGCCACAGGG - Intergenic
1123602076 15:21983156-21983178 CTGTGATGGTGGTGGCCACAGGG - Intergenic
1124081337 15:26501071-26501093 CTATAGTGGTGGTGGCCAGGAGG - Intergenic
1124473747 15:30012213-30012235 CTAGGGTTATGCTGGCCACATGG + Intergenic
1124873788 15:33571150-33571172 CTAAGGTGGGGGTGGGGACAGGG + Intronic
1125010555 15:34868605-34868627 TTATTGTGGTGGTGGTCACATGG - Intronic
1125044445 15:35230287-35230309 CTGAGGTAGTGATGGCCACAAGG - Intronic
1126015730 15:44348439-44348461 CTGTGGTAGTGGTGGACACAGGG + Intronic
1126183884 15:45811676-45811698 TCATAGTGATGGTGGCCACAGGG + Intergenic
1126285750 15:47008980-47009002 CTGGGGTGGTGGTGGCCATGGGG - Intergenic
1126411493 15:48377053-48377075 CTATAGGGGTGGTGTCCTCATGG + Intergenic
1127035297 15:54909038-54909060 TCATAGTGGTGGTGGCCACAGGG + Intergenic
1127173536 15:56328660-56328682 CTGTGGTAGTAGTGGCCACAAGG + Intronic
1127177968 15:56382124-56382146 TGGTGGTGGTGGTGACCACAAGG - Intronic
1127783392 15:62335468-62335490 CTGGGGTGGTGGTGGCCATGGGG - Intergenic
1127945156 15:63744244-63744266 TCATAGTGGTGTTGGCCACAGGG - Intronic
1128901004 15:71422954-71422976 CTGTGGAGGTGGTGGCCACGGGG - Intronic
1128966292 15:72061566-72061588 CTGGGGAGGTGGTAGCCACAGGG + Intronic
1129030503 15:72614608-72614630 CAGTGGTGGTGGTGGCCATAGGG - Intergenic
1129209658 15:74060325-74060347 CACCTGTGGTGGTGGCCACAGGG + Intergenic
1129477410 15:75795488-75795510 CGCCTGTGGTGGTGGCCACAGGG - Intergenic
1129780946 15:78270640-78270662 CTTTGGTGGTGGTGGACGGATGG + Exonic
1129875619 15:78973613-78973635 CTGGGGTGGTGGGGGCAACATGG + Intronic
1129901633 15:79156017-79156039 TGATGGTGGTGGTGGTTACATGG - Intergenic
1130974138 15:88759992-88760014 GCATGGTGGTGGTGGGCACCTGG - Intergenic
1131420772 15:92302861-92302883 TCATGGAGGTGATGGCCACAAGG - Intergenic
1131716303 15:95114194-95114216 CAGTGGTGGTGGTGGCCATAGGG + Intergenic
1131945113 15:97610951-97610973 TCCTGGTGGTGGTGGCCACTGGG + Intergenic
1131959305 15:97772556-97772578 TGGTGGTGGTGGTGGGCACAGGG - Intergenic
1202974183 15_KI270727v1_random:272962-272984 CTGTGATGGTGGTGGCCACAGGG - Intergenic
1132469124 16:92136-92158 CCATGGTTCAGGTGGCCACAGGG - Intronic
1132615875 16:840863-840885 CTAAGGGGGTGGTGGACACTGGG + Intergenic
1133204947 16:4227609-4227631 CGATGGTGGTGGTGGCAAAATGG + Intronic
1134183369 16:12064769-12064791 AAATGGTGGCGGTGGCCACCTGG - Intronic
1134406977 16:13969560-13969582 CTGGGGTGGTGGTGGCCATGGGG - Intergenic
1135007335 16:18838094-18838116 CTATGGTGGAGGTGGCCAGCAGG - Exonic
1135190534 16:20350687-20350709 TGATGGTGGTGGTGGCCTCTTGG - Exonic
1135400590 16:22163840-22163862 TTTTGCTGGTGGTGGTCACAGGG - Intergenic
1135749940 16:25049650-25049672 ATATGGTGGTGGCGGTCCCACGG + Intergenic
1135879654 16:26241408-26241430 TCATAGTGGTGGTGGCCACAGGG + Intergenic
1136389123 16:29951255-29951277 CAGTGGTGGTAGTGGCCACTGGG - Intronic
1136679271 16:31946068-31946090 TGGTGGTGGTGGTGGACACAAGG + Intergenic
1137615907 16:49846833-49846855 CTATGTTGCTGGTGGCTCCAAGG + Intronic
1137623940 16:49895662-49895684 CTATGGTGGGGGTGCCCATCTGG - Intergenic
1137781903 16:51104268-51104290 CTGTGGTGGGGGTGGCCTGAAGG + Intergenic
1138806786 16:60099867-60099889 CTGGGGCAGTGGTGGCCACAGGG - Intergenic
1139719335 16:68840296-68840318 GCATGGTGGAGGTGGCCAGATGG - Intergenic
1140646584 16:77038124-77038146 CTGTGGTGGTGGTGGCTAAGGGG - Intergenic
1141227317 16:82130181-82130203 CTGTGGTGGCGGAGGCCACAGGG - Intergenic
1142000296 16:87660474-87660496 CTCTGGTGGGGGTGGGCAAAAGG - Intronic
1142133072 16:88439644-88439666 CTGTGGTGTCGGTGCCCACAGGG - Exonic
1142919618 17:3172767-3172789 CTGTGGTGGTGGTGGACATGGGG + Intergenic
1143413754 17:6729467-6729489 CTGTGGTGGTGGTGGCCATGGGG + Intergenic
1144640004 17:16931818-16931840 ATCTGAGGGTGGTGGCCACAGGG - Intronic
1144864110 17:18323897-18323919 GCATGGTGGTGATGGCCTCATGG - Intergenic
1144942660 17:18952327-18952349 CTGTGGTGGTGTTGGCCAAGTGG + Intronic
1145064863 17:19755514-19755536 CACTGGTTTTGGTGGCCACAGGG + Intergenic
1145069294 17:19789172-19789194 TTCCAGTGGTGGTGGCCACAGGG + Intronic
1145792670 17:27637709-27637731 ATATGGTGGTGGTGGGGAGAGGG + Intronic
1145807543 17:27745577-27745599 ATATGGTGGTGGTGGGGAGAGGG + Intergenic
1146124641 17:30221748-30221770 CTAGGGTGGTGGTGGTCGCTGGG + Exonic
1146749965 17:35369339-35369361 CCGTGGTTGTGTTGGCCACAGGG + Intronic
1148619719 17:49025496-49025518 CTATGGTGTTGGTGAGCAGAAGG + Intronic
1149108567 17:52997954-52997976 CTGGGGTGGTGGTGGCTACAGGG + Intergenic
1149108613 17:52998303-52998325 TCATAGTGGTGGTGGTCACAGGG + Intergenic
1149980684 17:61308993-61309015 CTCTGCTGGGGGAGGCCACATGG - Intronic
1150287858 17:63963980-63964002 CCATGGTGGTGGGGGTGACAGGG + Intronic
1150299078 17:64033649-64033671 CTATGGTGATGGAAGCCAGAGGG + Intergenic
1150871137 17:68911672-68911694 TCCTAGTGGTGGTGGCCACAGGG + Intronic
1151268943 17:72978302-72978324 CTGTGCTGGTGTTGGCGACACGG + Intronic
1151310825 17:73291554-73291576 CTATGGTTTGGGAGGCCACAGGG + Intronic
1151400477 17:73852700-73852722 CGATGGTGGTGGTGGGTAGAGGG - Intergenic
1151932609 17:77242028-77242050 TTCTGGTGATGGTGGCCAAAGGG - Intergenic
1152660265 17:81538834-81538856 CTAAGGCGGTGCTGGCCACCAGG - Intergenic
1152942572 17:83180736-83180758 CTATGGTGGTCCTGGGCTCAGGG - Intergenic
1153074708 18:1148898-1148920 CTGTGGTAGTGGTGGCCTCAGGG + Intergenic
1153099721 18:1452346-1452368 TCATAGTGGTGATGGCCACAGGG + Intergenic
1153429549 18:5000535-5000557 TGGTGGTGGTGGTGACCACAGGG + Intergenic
1155597405 18:27503241-27503263 TCCTAGTGGTGGTGGCCACAGGG + Intergenic
1156040242 18:32812405-32812427 CCATGGTGTTGATGGCCATATGG + Intergenic
1156469245 18:37367197-37367219 TGATGGTGGTGGTGGCTACCTGG + Intronic
1156516122 18:37682196-37682218 CTAGGGTGGTGCTTGGCACATGG - Intergenic
1157022605 18:43805061-43805083 CTGTTGTGGTGGTGGCCATGGGG - Intergenic
1157065210 18:44341737-44341759 CTCTGGTGGTGGTGGCCACGAGG - Intergenic
1157546601 18:48550781-48550803 CTAGGGTGGTGCCGGCCACAGGG + Intronic
1158024945 18:52885423-52885445 TGGTGGTAGTGGTGGCCACAGGG - Intronic
1158431337 18:57389971-57389993 CTGTGGTGGTGATGGCCATGGGG + Intergenic
1158468650 18:57714162-57714184 CTGTGGTGGTGGTGGACATGGGG + Intronic
1158709552 18:59825147-59825169 CTGTGGTGGCAGTGGCCACAGGG - Intergenic
1158948959 18:62474480-62474502 TAGTGGTGGTGGTGGCCACTGGG - Intergenic
1159080675 18:63731808-63731830 CAGTGGTGGTGGTCACCACAGGG + Intergenic
1159731328 18:72032514-72032536 ATGTTGTGGTGGCGGCCACAGGG - Intergenic
1159802532 18:72919354-72919376 CTAGGGTGGTGGTGGCCACAGGG - Intergenic
1160257470 18:77259518-77259540 TGATGGTGGTGGTGGTCATAGGG + Intronic
1160763404 19:796948-796970 CCATGTTGGTTGTGGGCACATGG - Intergenic
1161003186 19:1921395-1921417 AGATGGTGAGGGTGGCCACATGG + Intronic
1161014661 19:1977823-1977845 CTATGTGGCTGGTGGCCCCAGGG + Intronic
1161088139 19:2344375-2344397 TCATGGTGGAGGTGGCCACTGGG + Exonic
1161700349 19:5791087-5791109 GAATGGTGGTGGTGGCGACTCGG - Exonic
1161795929 19:6386865-6386887 CTAGGGTGGTGGTGGCCCTACGG + Intronic
1162014803 19:7839555-7839577 GTATGGTTCTGGTGGCCCCATGG + Intronic
1162028521 19:7907554-7907576 CAGAGGTGGTGATGGCCACATGG - Intronic
1162480610 19:10924857-10924879 CTGGGGTGGAGGCGGCCACATGG - Intronic
1162524503 19:11199571-11199593 CTATGGAGTTGGGGGCCCCATGG - Intronic
1162666664 19:12219617-12219639 TCACAGTGGTGGTGGCCACAGGG - Intergenic
1162692973 19:12449229-12449251 CTTTGGTGGTGGTGGCCATGGGG - Intronic
1163013683 19:14440917-14440939 CTGTGGTGGTGGGGGTGACAAGG + Intronic
1163288237 19:16362841-16362863 CTCTGGTGTTGGTGGCTCCAAGG + Intronic
1163739163 19:19000062-19000084 CTGTGGTGGATGTGGCCACTAGG - Intronic
1164491185 19:28715411-28715433 TCACAGTGGTGGTGGCCACAGGG + Intergenic
1164725658 19:30464143-30464165 CTTTGCAGGTGCTGGCCACAGGG - Intronic
1165983575 19:39747400-39747422 TTATAGTGGTGGTGGCCACAGGG + Intergenic
1166412865 19:42568285-42568307 CAATGGTAGTGGTGGTTACATGG + Intergenic
1166756035 19:45192186-45192208 CTGGGGCAGTGGTGGCCACAGGG - Intronic
925163312 2:1701792-1701814 CTATGGCGGTGGTGCCCCCAGGG + Intronic
925269487 2:2592098-2592120 AAGTGGTAGTGGTGGCCACAAGG + Intergenic
925269529 2:2592366-2592388 TTCCAGTGGTGGTGGCCACAGGG + Intergenic
925506289 2:4568861-4568883 CTGGGGTGATGTTGGCCACAGGG - Intergenic
925644178 2:6019342-6019364 AAATGGTGGTGGTGGCTAGAAGG - Intergenic
926516318 2:13851020-13851042 CTGGGGTGGTGGTGGCCACAGGG + Intergenic
926834111 2:16998872-16998894 CTGTAGTCGTGGTGGCCACAGGG - Intergenic
927309679 2:21616839-21616861 TAATAGTGGTGGTGCCCACAGGG - Intergenic
927570216 2:24152958-24152980 CAGTGGTGGTGGTGGCCACAGGG - Intronic
927594686 2:24386180-24386202 CTGTGGTAGTAGTGGCCACTGGG - Intergenic
928106954 2:28476704-28476726 CCAGGGAGGTGATGGCCACAGGG + Intronic
928484158 2:31712323-31712345 CTGGGGTGGTGGTAGCCACAGGG + Intergenic
928715486 2:34055662-34055684 CTGGGGTCGTGGTGGCCACAGGG - Intergenic
928783685 2:34855139-34855161 TCATAGTGGTGGTGGTCACAAGG + Intergenic
929920818 2:46170142-46170164 TTATTGTGCTGGTGGTCACATGG - Intronic
930159330 2:48138114-48138136 TCATAGTGGTGGTGGCCACAGGG + Intergenic
930492391 2:52092611-52092633 TTATAGTGGTGGTGGCCACAGGG - Intergenic
930970248 2:57386181-57386203 CTGTGAAGGTAGTGGCCACAGGG + Intergenic
931001788 2:57793477-57793499 TCATAGTGGTGGTGACCACAAGG - Intergenic
931161844 2:59701768-59701790 TCATAGTGGTGGTGGCTACATGG - Intergenic
931600799 2:64001143-64001165 CTTTGGTGGTGGTGGCCACAGGG - Intronic
932858678 2:75266309-75266331 TAATAGTGGTGGTGGCCACAGGG - Intergenic
932858737 2:75266657-75266679 CTGTGGTGGTCATGGCCACAAGG - Intergenic
933006715 2:77004536-77004558 CTACAGTGGTGGTGCCCTCATGG + Intronic
933077800 2:77951497-77951519 TTGTGATGGTGGTGGACACAGGG + Intergenic
933162909 2:79045400-79045422 CAGTGGTGGTGGTGGCCATGGGG + Intergenic
933689979 2:85172306-85172328 GTGTGGGGGTGGTGGCCACAGGG - Intronic
933811713 2:86036742-86036764 TTTTGGTGGAGGTGGCCTCAAGG - Intronic
934870617 2:97861597-97861619 TTGTGGTGGTGGTGGCCATGGGG + Intronic
934870684 2:97861963-97861985 TTCCAGTGGTGGTGGCCACAGGG + Intronic
935751001 2:106233572-106233594 CAGTGGTGGTGGTGGCTACAGGG + Intergenic
935934643 2:108168478-108168500 ATATGGTGATGCTGGACACATGG - Intergenic
935989484 2:108706123-108706145 CTGGGGTTGTGGTGGACACAGGG + Intergenic
936407953 2:112224886-112224908 TGATTGTGGTGGTAGCCACATGG + Intronic
936795156 2:116195537-116195559 TCATAGTGGTGGTAGCCACAGGG - Intergenic
936831590 2:116654176-116654198 TTGTGGTGGTGGTGGCCACAGGG + Intergenic
936925394 2:117731322-117731344 CTGTTGTGGTGGTGGACATAAGG + Intergenic
937557802 2:123180677-123180699 CTGTGGTAGTGGTGGCCATGGGG + Intergenic
938305940 2:130253964-130253986 CTATGGCGATGGGGGCCACATGG + Intergenic
938448214 2:131393807-131393829 CTATGGCGATGGGGGCCACATGG - Intergenic
938486796 2:131719896-131719918 TCATGGTGGTGGTGGTCATAGGG - Intergenic
939144567 2:138396738-138396760 CTGAGGTTGTGGTGGCCACAGGG + Intergenic
939273697 2:139971711-139971733 TTCCAGTGGTGGTGGCCACAGGG + Intergenic
939405019 2:141745446-141745468 CTGTGGTGGTGGTGGCCATAGGG - Intronic
939443096 2:142275364-142275386 TCATAGTGGCGGTGGCCACAGGG - Intergenic
940315062 2:152319934-152319956 TCCTTGTGGTGGTGGCCACAGGG - Intergenic
940503735 2:154527148-154527170 CTACGGTGGGGGTGGCCACAGGG - Intergenic
940560389 2:155288034-155288056 CTGTGGTGGTGTTGTCCACAAGG + Intergenic
940795448 2:158072207-158072229 CAGTGGTGGTGGTGGCCACTGGG + Intronic
941227767 2:162869279-162869301 TCATAGTGGTGGTGGCCACAGGG + Intergenic
941672528 2:168310370-168310392 CTGTGGTGGCAGTGGCCACAGGG - Intergenic
941803362 2:169686125-169686147 CTCAGGTGGTTGTGGCCAGAAGG - Intronic
942193268 2:173492676-173492698 GGATGGTAGTGATGGCCACACGG - Intergenic
942769143 2:179495242-179495264 CTAAGGTGGTGGTGGCTATGAGG + Intronic
942834464 2:180277237-180277259 CTGTGGCAGTGGTGGCCACAGGG - Intergenic
943208156 2:184927747-184927769 CTGTGATGGTGGTGGCCATGGGG - Intronic
943967416 2:194354395-194354417 CTCAGGTGGTGGTGGCCACAGGG + Intergenic
944046221 2:195414464-195414486 CTGCAGTGGTGGTGGACACAGGG + Intergenic
944751946 2:202718049-202718071 CTGTGGTAGTGGTGGCTACAAGG - Intronic
945575699 2:211525823-211525845 CTGTAGTGGTGGTGACCACAGGG + Intronic
947687077 2:232097508-232097530 CTGTAGTGGTGGCAGCCACAGGG - Intronic
947892967 2:233642960-233642982 TCATAGTGGTGATGGCCACAAGG - Intronic
948482457 2:238258800-238258822 CTGTGGTGCTCGTGCCCACAGGG - Intronic
949079527 2:242085768-242085790 TTAGGGTGGTGGTGAGCACAGGG - Intergenic
1168741958 20:199811-199833 TCATAGTGTTGGTGGCCACAGGG - Intergenic
1169001285 20:2169585-2169607 CAATGGTGGTGGTGGTCCCAGGG + Intronic
1169088257 20:2840538-2840560 CGATGGAGGTGGCCGCCACAGGG + Exonic
1170236083 20:14106277-14106299 TGGTGGTGGTAGTGGCCACAGGG + Intronic
1170668446 20:18406934-18406956 CAGTAGTGGTGGTGGCCACAGGG + Intronic
1170863993 20:20137167-20137189 TCACAGTGGTGGTGGCCACAAGG - Intronic
1170864052 20:20137514-20137536 CTGTGGTGGTGGTGGACATGGGG - Intronic
1171938021 20:31294200-31294222 CTATGGTGGTGATGGCTATGGGG + Intergenic
1172707282 20:36891485-36891507 CAAAGCTGGTGGTGGCCAGAGGG - Exonic
1172886092 20:38231878-38231900 AAATAGTGCTGGTGGCCACAGGG - Intronic
1173099022 20:40066081-40066103 TCATAGTGCTGGTGGCCACAGGG + Intergenic
1173126936 20:40345830-40345852 CTGTGGTGCTGGTGGCCATGAGG + Intergenic
1173126990 20:40346198-40346220 CCCCAGTGGTGGTGGCCACAGGG + Intergenic
1173872452 20:46350507-46350529 CCAAGGTGATGGTGGCCCCAAGG - Exonic
1175632127 20:60550183-60550205 CTGGGCTGGTGGTGGCCATAGGG - Intergenic
1176235281 20:64050921-64050943 CTGTGGGGGTGCTGGCCTCAGGG - Intronic
1176372628 21:6071599-6071621 CTATGGTTGCAGAGGCCACAAGG - Intergenic
1176386253 21:6139850-6139872 CTCTGGGGGAGGTGACCACAGGG + Intergenic
1177069523 21:16486133-16486155 TCACAGTGGTGGTGGCCACAGGG - Intergenic
1177212888 21:18091829-18091851 TAGTGGTGGTGATGGCCACAGGG + Intronic
1177401149 21:20606440-20606462 TTATAGTGATGGTGGCCACAGGG + Intergenic
1177456367 21:21344505-21344527 CTGGGGTGGTGGTGGCTACAGGG + Intronic
1177503979 21:21997856-21997878 CTTTAGTAGTGGTGGCCACAGGG - Intergenic
1177771360 21:25519597-25519619 CTTGGGTGGTGGTGGACACAAGG + Intergenic
1179312735 21:40210939-40210961 TGATGGTGGTGGTGGGTACATGG - Intronic
1179358256 21:40682170-40682192 CTTTGTTGGAGGTGGCCAGAGGG + Intronic
1179582787 21:42354069-42354091 CTATGCTGTTCGTGCCCACAAGG + Intergenic
1179737220 21:43398402-43398424 CTCTGGGGGAGGTGACCACAGGG - Intergenic
1179750848 21:43466646-43466668 CTATGGTTGCAGAGGCCACAAGG + Intergenic
1181109012 22:20590614-20590636 CAGTGGTGATGGTGGGCACAGGG - Intergenic
1181716930 22:24737825-24737847 CTGTGGTGGTGGTGGCCATGGGG + Intronic
1181734981 22:24874490-24874512 CCATGCTGGTGGTGGCCAGAGGG + Exonic
1183367932 22:37417082-37417104 CTGTGTTGGTGGCGGCCACGTGG - Intronic
1184411449 22:44328704-44328726 CCATGGTTGAGGTGGGCACAGGG - Intergenic
1184668673 22:46001673-46001695 CTCTGGGGCTGGTGGCCAAACGG - Intergenic
949155981 3:827578-827600 TCATAGTGGTGGTGGCCACATGG + Intergenic
949829206 3:8196584-8196606 CTGGGGTGGTGGTGGCCACAGGG - Intergenic
950490789 3:13303734-13303756 CAGTGGTGGTGGTGGCATCAAGG - Intergenic
950695589 3:14699039-14699061 ACCTGGTGGTGGTGGCCAAAGGG - Intronic
951029180 3:17862746-17862768 TTGCAGTGGTGGTGGCCACAGGG - Intronic
951160669 3:19417053-19417075 CTATGGTGGTGGTGCTGACAGGG - Intronic
951172098 3:19554501-19554523 TGGTGGTGGTGGTGGCTACAGGG - Intergenic
951259866 3:20495169-20495191 CAGTGGTGGTGGCGGCCACAGGG - Intergenic
951379788 3:21969093-21969115 CTGTGGTAGTGGTGGTCATAGGG + Intronic
951819251 3:26790545-26790567 TCATAGTGGTGGTAGCCACAGGG - Intergenic
952072347 3:29653131-29653153 TTGTGGTGGTGGTGGCGCCATGG + Intronic
952222011 3:31332477-31332499 CTGTGGTGGTGGTGGCCATAGGG + Intergenic
952566881 3:34669432-34669454 CTGTGGTAGTGGTAGCCACAGGG + Intergenic
953229270 3:41050263-41050285 TACTAGTGGTGGTGGCCACAGGG - Intergenic
953362355 3:42309262-42309284 CAGTGGTGGTGGTGGCCACAGGG - Intergenic
954360777 3:50121709-50121731 CTGTGTTGTTGGTGGCCACCAGG + Intergenic
956258820 3:67314415-67314437 CTATGGTGTTGTTGGCTCCATGG - Intergenic
956476231 3:69622473-69622495 TGGTGGTCGTGGTGGCCACAGGG + Intergenic
956549548 3:70442386-70442408 TTAGGGTGGTGGTGGCCATGGGG + Intergenic
958078459 3:88713419-88713441 TCATAGTGGTGTTGGCCACAGGG + Intergenic
958099434 3:88989561-88989583 CTTTGGTGGTGTTAGCCACAGGG + Intergenic
958428242 3:94005329-94005351 CTATGGTGGTAGTGATGACAAGG + Intronic
958632234 3:96699555-96699577 CATTGGTGGTAGTGGCTACAGGG - Intergenic
958765219 3:98360067-98360089 TCCTAGTGGTGGTGGCCACAGGG - Intergenic
958847291 3:99279565-99279587 TCATAGTAGTGGTGGCCACAGGG + Intergenic
958876733 3:99625080-99625102 CTGTGGTGGCAGTGGCCACAGGG + Intergenic
958876795 3:99625425-99625447 TCACAGTGGTGGTGGCCACAGGG + Intergenic
959279304 3:104317289-104317311 CTGTGGTGGTCATGGCTACAGGG + Intergenic
959547335 3:107612654-107612676 TTCCGGTGGTGTTGGCCACAGGG - Intronic
959724908 3:109532645-109532667 TCATAGTGGTGGTGGCCACAGGG - Intergenic
959724973 3:109533004-109533026 CTGTGGTGGTGGTGGCTATGGGG - Intergenic
960214191 3:115010357-115010379 TCATAGTGGTGATGGCCACAAGG + Intronic
960298023 3:115967960-115967982 CTAGGATGGTGGTGGTCACAGGG - Intronic
960541078 3:118863777-118863799 TCATAGTGGTGATGGCCACAGGG - Intergenic
960564968 3:119123225-119123247 CTGTGGTGGTAGCGGCCACAGGG + Intronic
960784899 3:121362195-121362217 TAATAGTAGTGGTGGCCACAAGG - Intronic
960862700 3:122168111-122168133 CAGTGGTGGTGGTAGCCACTGGG - Intergenic
960870072 3:122239294-122239316 TAGTGGTGGTGGTGGCCACCAGG + Intronic
961556363 3:127698971-127698993 CCATGGTGGGGGTGGTCACTTGG - Intronic
961952354 3:130762854-130762876 CTGTGGTGGTAGTGGCTACAGGG + Intergenic
961986282 3:131138288-131138310 CTGTAGTGGTGGTGGCCATGGGG + Intronic
962638758 3:137361277-137361299 CTGGGGTAGTGCTGGCCACAGGG - Intergenic
962688478 3:137869516-137869538 TCATAGTGGTGGTGGCCACAGGG + Intergenic
963331951 3:143924450-143924472 CTATGGTGGGAGAGGCCAAATGG - Intergenic
963528632 3:146446565-146446587 TTCTAGTGGTGGTGGTCACATGG - Intronic
963692367 3:148519973-148519995 TCATAGTGGTGGTGGCTACAGGG + Intergenic
964059481 3:152504753-152504775 TCATAGTGGTGGTGGACACAGGG - Intergenic
964179457 3:153865702-153865724 CAGTGGTGGTGGTGGACACAGGG + Intergenic
964253747 3:154750484-154750506 CTGTGGTAGTGGTGGCCATGAGG + Intergenic
964349861 3:155791706-155791728 CTGGGATGGTGGTGGCCCCAGGG + Intronic
964871795 3:161320397-161320419 TTTTAATGGTGGTGGCCACAAGG + Intergenic
964904385 3:161701156-161701178 TCATAGTGGTGGTGGCCACAGGG + Intergenic
964952729 3:162316837-162316859 CTCTGGTGGTGATGACTACAAGG - Intergenic
964961101 3:162427711-162427733 CTGTGGTGGTCACGGCCACAGGG + Intergenic
965016650 3:163167436-163167458 CCAAAGTGGTGGTGGCCACAAGG - Intergenic
965118220 3:164519510-164519532 TCACAGTGGTGGTGGCCACAAGG - Intergenic
965144949 3:164889631-164889653 CTAGGGTGGTAGTGGTCATAGGG - Intergenic
965209511 3:165767460-165767482 TCATAGTGGTGGTGGCCACAGGG - Intergenic
965250875 3:166342585-166342607 CTGTGGTGATGGTTGCCACAGGG + Intergenic
965415134 3:168384136-168384158 CTGTGGTGATAGTGGCCACAGGG - Intergenic
965975246 3:174613199-174613221 TCCTGGTGATGGTGGCCACATGG - Intronic
966400981 3:179546701-179546723 CTGTGGTGGTGGTGGACATGGGG + Intergenic
966440138 3:179935774-179935796 CCATGATGGTGGAGGCCCCATGG - Intronic
966491134 3:180529733-180529755 CTGGGGTGGTGGTGGCTACAAGG + Intergenic
966744935 3:183266515-183266537 GTATGGTGGAGGAGGCCAGAGGG + Intronic
966921708 3:184616113-184616135 TTATTGGGGTGGTGGCTACACGG - Intronic
967814969 3:193790758-193790780 CTAGGGTAGTGATGCCCACATGG - Intergenic
968004936 3:195236362-195236384 CTGTGGTGGTACTGGACACAGGG - Intronic
968818232 4:2832659-2832681 CTGGGGTGGCGGAGGCCACATGG + Intronic
969259632 4:6025211-6025233 CAGAGGTGGGGGTGGCCACAGGG - Intergenic
969993045 4:11283854-11283876 CTATGGGGGTGGGGGTCTCATGG - Intergenic
970011040 4:11459588-11459610 CTGTGATGGTGGTGGCCATGGGG + Intergenic
970011102 4:11459946-11459968 TTCAAGTGGTGGTGGCCACAGGG + Intergenic
970413367 4:15832994-15833016 CTGTGGTGGTGGTGGCCATGAGG - Intronic
970442494 4:16093714-16093736 CAGTGGTGGTGGTGGCCACAAGG + Intergenic
970963390 4:21898957-21898979 TGATGGTAGTTGTGGCCACAGGG + Intronic
971105225 4:23517386-23517408 CGGTGGTAGTGGTGACCACAGGG - Intergenic
971891565 4:32529981-32530003 TCATAGTGGTGGTGACCACAGGG + Intergenic
972009498 4:34158891-34158913 TGGTGGTGGTGGTGGCCACAGGG + Intergenic
972237342 4:37149903-37149925 TCATAGTAGTGGTGGCCACAGGG - Intergenic
972271024 4:37510971-37510993 CTGTGGTGGTGGTGGCAATGGGG - Intronic
972928492 4:44041092-44041114 CCATGGTGGTGGTGCCCAGAGGG + Intergenic
973227495 4:47802490-47802512 TGGTGGTTGTGGTGGCCACAGGG + Intronic
973327338 4:48877233-48877255 AGACAGTGGTGGTGGCCACAGGG - Intergenic
973327394 4:48877581-48877603 CCATGGTGGTGGTGGCCATGAGG - Intergenic
973763340 4:54140505-54140527 TCCTGGTGGTGGTGGCTACAGGG + Intronic
973919754 4:55673284-55673306 CTGCGGTGGTGGTGGCCACAGGG - Intergenic
974292387 4:59948877-59948899 TCCTAGTGGTGGTGGCCACAGGG + Intergenic
974337498 4:60569497-60569519 TAATAATGGTGGTGGCCACAGGG - Intergenic
974630233 4:64479553-64479575 GTCGAGTGGTGGTGGCCACAGGG - Intergenic
974780243 4:66544444-66544466 TCATAGTGGTGGTGGTCACAGGG + Intergenic
975365528 4:73523869-73523891 CTGTGGTGGTGGTGGCCATAGGG - Intergenic
975369450 4:73568014-73568036 CTGTGGTGGTGGTGGCCACAGGG - Intergenic
975375906 4:73645747-73645769 CTGTGGTGGTGGTGGCAATGGGG - Intergenic
975629826 4:76388466-76388488 TAGTGGTGGTGGTAGCCACAGGG + Intronic
976016519 4:80561048-80561070 TCATAGTGGTGGTGGTCACAGGG + Intronic
976254081 4:83082897-83082919 TCATAGTGGTGGTGGCCACAGGG - Intergenic
976451760 4:85199041-85199063 TTACAGTGGTGGTAGCCACAGGG - Intergenic
976451814 4:85199396-85199418 CTGTGGTGGTGGTGGATACAGGG - Intergenic
976908284 4:90267223-90267245 CCTTGGTGGTAGTGGACACAGGG + Intronic
977184991 4:93925628-93925650 TTATAGAGGTGGTGGCCACAGGG + Intergenic
977521889 4:98094733-98094755 CAGTGGTGGTAGTGGACACAGGG + Intronic
977644416 4:99395901-99395923 TTACAGTGGTTGTGGCCACAGGG + Intergenic
977753408 4:100635796-100635818 CTAGGGTGGTGGTGGCTAAAAGG + Intronic
978031023 4:103939799-103939821 TCATAGTGGTGGTGGCCACAGGG + Intergenic
978112463 4:104978935-104978957 CTGTGGTAGTGGTGGCCACAGGG + Intergenic
978261835 4:106768887-106768909 TCATAGTGGTGGTGGCCACTGGG + Intergenic
978520469 4:109610040-109610062 CTATGGTGGCAGTGGCCACAGGG - Intronic
978934552 4:114359260-114359282 CTGTGTTGGTGGTGGACACAGGG - Intergenic
979395086 4:120178129-120178151 CTGGGGTGGTGGTGGCCATGGGG + Intergenic
979413516 4:120407156-120407178 CTGGGGTGGCAGTGGCCACAGGG + Intergenic
979573042 4:122252530-122252552 CTGTGATGGTGGTGGCCATGGGG + Intronic
980413104 4:132447910-132447932 TTATAGAGGTGGTGGTCACAGGG + Intergenic
980442557 4:132867615-132867637 CAGTGGTGGTAGTGGGCACAGGG + Intergenic
980596984 4:134966959-134966981 CTGGGGTGGTAGTGGCCATAGGG + Intergenic
980657731 4:135811702-135811724 CTGGTGTGGTGGTGGCCACAGGG + Intergenic
980660702 4:135854889-135854911 TCACAGTGGTGGTGGCCACAAGG - Intergenic
980960445 4:139469913-139469935 TCATAGTGGTGGTGGTCACAGGG - Intronic
981241390 4:142480567-142480589 CTACGGTGGAGATGGCCAGATGG - Intronic
981298062 4:143156037-143156059 TTGTGGTGGTGGTGGGCACAGGG - Intergenic
981518247 4:145633972-145633994 TTACAGTGGTGGTGACCACAGGG - Intronic
981836919 4:149065046-149065068 CTGGGGTGGTGCTGGCCACAGGG + Intergenic
981870998 4:149486406-149486428 TGGTGGTGGTGGTGGCAACAGGG - Intergenic
981895757 4:149796648-149796670 TCATAGTGGTGGTGGCCACAGGG + Intergenic
981975613 4:150723939-150723961 CGGTGGTGGGGGTGGCCACAGGG + Intronic
981996203 4:150977778-150977800 CTGTGGTGGTGGTGGCTAGTGGG + Intronic
982622880 4:157728466-157728488 TTCCAGTGGTGGTGGCCACAGGG + Intergenic
982683325 4:158458934-158458956 AAATGATGGTGGTGACCACAGGG - Intronic
982899420 4:160980256-160980278 TTCCAGTGGTGGTGGCCACAGGG - Intergenic
983017285 4:162628729-162628751 CTGGGGTGGTGGTGGTCAGAGGG + Intergenic
983219328 4:165029960-165029982 CTAAGCTGGGGGTAGCCACATGG - Intergenic
983936711 4:173507647-173507669 TTCTGGTGGTGGCGGCCACAGGG - Intergenic
985229534 4:187799623-187799645 CTGTGGTGGTGGCAGCCACCAGG + Intergenic
985823669 5:2178006-2178028 CAAGGTGGGTGGTGGCCACACGG + Intergenic
986544334 5:8879521-8879543 TCACAGTGGTGGTGGCCACAGGG - Intergenic
986756370 5:10840099-10840121 TTGTGGTGGTGGTGGCTACAGGG + Intergenic
987443448 5:17986172-17986194 CTAGGGTGGTGGTGAGAACATGG + Intergenic
987496532 5:18652580-18652602 CTCTGGTGGTGTTGGCCATGTGG - Intergenic
987773058 5:22331031-22331053 TGTTGTTGGTGGTGGCCACAAGG + Intronic
987823156 5:22991742-22991764 CTGTGGTGATGGTGGCTACAGGG + Intergenic
987823211 5:22992128-22992150 TTGTAGTGGTAGTGGCCACAGGG + Intergenic
987953084 5:24701753-24701775 CAGTGGTAGTAGTGGCCACATGG - Intergenic
988236866 5:28557190-28557212 CTGTGATGGTGGTGGCCATGGGG - Intergenic
988340167 5:29960506-29960528 CTGTGCTTCTGGTGGCCACAGGG + Intergenic
988376280 5:30439666-30439688 CTGGGGCAGTGGTGGCCACAGGG + Intergenic
989239188 5:39183852-39183874 CTATGGTGGTGGTGGAATAAGGG + Intronic
989427858 5:41316734-41316756 CTAGGGTGGTGGTGGCTATAGGG + Intronic
989629078 5:43462024-43462046 TCATGGTAGTTGTGGCCACAGGG + Intronic
989672656 5:43936546-43936568 CTATGGTGGAGGTGTCCATGGGG + Intergenic
989681346 5:44032752-44032774 TTAGAGTGGTGGTGGCCATAGGG + Intergenic
989722984 5:44552233-44552255 TCATAGTGGTGGTGGCCACAGGG - Intergenic
990148945 5:52794747-52794769 CTTTGCTGGTGGAGGTCACATGG + Intronic
990578935 5:57150154-57150176 CTGTGGTGGTGGTGGCCATGGGG - Intergenic
990774261 5:59287291-59287313 CTGGGGCAGTGGTGGCCACAGGG + Intronic
990827981 5:59923086-59923108 CTAGGGTGGTGGTAGCCTCAGGG + Intronic
990899999 5:60739544-60739566 CTGTGGTGGTGGTGGACACAGGG + Intergenic
990933070 5:61115176-61115198 CTGGGGTGGTGGTGGCCATGGGG - Intronic
991018612 5:61957861-61957883 CTGTGGTGGTGGTGGCTATGGGG - Intergenic
991107416 5:62860698-62860720 CAATAGTGGTGGTGGCCACAGGG - Intergenic
991180547 5:63746541-63746563 CTGTGGTGGTGGTGGCTATGGGG - Intergenic
991237805 5:64419267-64419289 CTGTGGTGGTGGTGGCCACAGGG + Intergenic
991297219 5:65093867-65093889 CTGTGGTGGTAGTGGCCATGGGG + Intergenic
991621807 5:68552378-68552400 TAATGGTGGTGGTGGTCACATGG - Intergenic
991682018 5:69149471-69149493 TCCTAGTGGTGGTGGCCACAGGG - Intergenic
992285007 5:75226038-75226060 CTATGGTAGTGATGGCCATGGGG + Intronic
992327115 5:75671134-75671156 CTATGATGATGGTGGTGACAGGG + Exonic
992345238 5:75869384-75869406 CTGTGGTGGTAACGGCCACAGGG + Intergenic
992531675 5:77658720-77658742 GTCCTGTGGTGGTGGCCACAAGG - Intergenic
993257871 5:85616732-85616754 CTATAGGGGTGGAGGCCTCATGG - Intergenic
993278758 5:85898083-85898105 TCCTAGTGGTGGTGGCCACAGGG - Intergenic
993582403 5:89678326-89678348 TCACAGTGGTGGTGGCCACAGGG + Intergenic
993981373 5:94546453-94546475 TTCTAGTGGTGGTGGCCACAGGG + Intronic
994028610 5:95114531-95114553 CTGTGGTATTGGTGGCCACCGGG + Intronic
994233926 5:97339764-97339786 CTGTGATGGTGGTGGTCACAGGG + Intergenic
994235508 5:97358012-97358034 TCATAGTGGCGGTGGCCACAGGG - Intergenic
994274660 5:97821811-97821833 CAGTGGTGGTGGTGGCCACAGGG - Intergenic
994428628 5:99627660-99627682 TCATAGAGGTGGTGGCCACAGGG - Intergenic
994660055 5:102642234-102642256 CAGTGGTGGTGGTGGCCACAGGG + Intergenic
995777875 5:115745339-115745361 TCATAGTGATGGTGGCCACAGGG - Intergenic
996192510 5:120563505-120563527 TGTTGGTGGTGGTGGCCACAGGG - Intronic
996666613 5:126066958-126066980 GTGGGCTGGTGGTGGCCACAGGG + Intergenic
997186293 5:131884907-131884929 CTGTGGTGGCCGTGGCCGCAGGG + Intronic
998548213 5:143050100-143050122 CTATGTTGTTGGTGGGCAGAGGG + Intronic
998651683 5:144127704-144127726 CCATGGTGCTGGTGACCTCAAGG + Intergenic
998716512 5:144890158-144890180 TCATAGTGGTGGTGGCCACAGGG + Intergenic
999345755 5:150817511-150817533 TCATAGTGGTGGTGGCCACAGGG + Intergenic
999523720 5:152380138-152380160 CTATGGTGAAGGTGTCCACTGGG + Intergenic
999590862 5:153143760-153143782 CTGTGGTGGTGGTGGCAAGTTGG - Intergenic
1000159810 5:158586620-158586642 CTGTGGTGGTGGTGGCTACAGGG - Intergenic
1000455042 5:161438133-161438155 TCATAGTGGTGGTGGCAACAGGG + Intronic
1001177765 5:169487495-169487517 TTCTAGTGGTTGTGGCCACAGGG + Intergenic
1001308858 5:170596281-170596303 CTATGGGTGTGATGGGCACAGGG - Intronic
1003240118 6:4337398-4337420 CTTTGGTGATAGTGGCCACCTGG + Intergenic
1003708687 6:8564557-8564579 CTAGGATGGTGCTTGCCACATGG + Intergenic
1005157012 6:22819000-22819022 CAGTGGTGGTGTTGACCACAGGG - Intergenic
1005266453 6:24117090-24117112 CTATGGTCTTGGTGGTCATATGG + Intergenic
1005479030 6:26237740-26237762 CTATGGTGGTGGTGGGGATGGGG - Intergenic
1006844433 6:37052398-37052420 CTATGATGGGGGTGGCCGGAGGG + Intergenic
1007377678 6:41467777-41467799 CTAGGGAGGTGGAGGCGACAGGG + Intergenic
1007522367 6:42460819-42460841 GTATTGTGATGGTGGCCTCAGGG - Intergenic
1007764254 6:44151716-44151738 CTAAGCTGGGGGTGTCCACATGG + Intronic
1008017968 6:46542242-46542264 TCATAGTGGTGGTGGCCACATGG + Intergenic
1008215199 6:48779212-48779234 TCACAGTGGTGGTGGCCACAGGG + Intergenic
1008382032 6:50846823-50846845 CTATGGGTGTGGAGGCCAGAAGG - Exonic
1008707505 6:54181274-54181296 TGGTGGTGTTGGTGGCCACAGGG - Intronic
1008727476 6:54440666-54440688 TCATAGGGGTGGTGGCCACAGGG - Intergenic
1008822562 6:55651297-55651319 CTCCAGTAGTGGTGGCCACAGGG + Intergenic
1008848471 6:55996233-55996255 CTGGGCTGGTGGGGGCCACAGGG - Intergenic
1009301725 6:62031969-62031991 TCATAGTGGTGGTAGCCACAGGG + Intronic
1009353052 6:62706979-62707001 TGACAGTGGTGGTGGCCACAGGG - Intergenic
1009371216 6:62905605-62905627 TGGTGGTGGTGGTGCCCACAAGG + Intergenic
1009373480 6:62938348-62938370 CTGTGGTGGTGGTGGCCATGAGG - Intergenic
1009390810 6:63140952-63140974 TCATAGTGTTGGTGGCCACAAGG + Intergenic
1009478149 6:64121062-64121084 CTATGGGGGAGGGGGGCACATGG - Intronic
1010296656 6:74206579-74206601 CTATGGTTTTGGTGGCCCCCTGG + Intergenic
1010299392 6:74242992-74243014 CCATAGTGGTGGTGGCCACAAGG - Intergenic
1010328172 6:74588662-74588684 TCATAGGGGTGGTGGCCACAGGG + Intergenic
1010483472 6:76381990-76382012 TCAGAGTGGTGGTGGCCACAGGG - Intergenic
1010483524 6:76382346-76382368 CTGGGGTGGTGGTGACTACAGGG - Intergenic
1010529004 6:76942840-76942862 TCATAGTGGTGGTGGCCACAGGG + Intergenic
1010548053 6:77183586-77183608 CTGTGATGGTGGTAGCCATAGGG + Intergenic
1010560235 6:77340454-77340476 TGCTGGTCGTGGTGGCCACAGGG - Intergenic
1010664786 6:78615897-78615919 CTAAGGTGTTTGTGGCCACCAGG - Intergenic
1010838869 6:80623635-80623657 AAGTGGTGGTGGAGGCCACAGGG + Intergenic
1010838919 6:80623996-80624018 TTCCAGTGGTGGTGGCCACAGGG + Intergenic
1011102881 6:83743875-83743897 CGATGATGGTGGTGGCCATATGG - Intergenic
1011232494 6:85178555-85178577 CTGATGTGGTGGTGGCCACAGGG - Intergenic
1011659112 6:89578914-89578936 CTATGGAGGTGCTGGAAACAAGG - Intronic
1012679044 6:102154734-102154756 TGATAGTGGTGGTAGCCACAGGG + Intergenic
1013925519 6:115467700-115467722 TTGTAGTGGTGGTGGCCACAGGG - Intergenic
1014186903 6:118445288-118445310 CACTGGTGGTCGTGGCCACAGGG - Intergenic
1014865200 6:126521025-126521047 CTGTGGTGGAGGTGGCCACAGGG - Intergenic
1015830515 6:137363614-137363636 CTGTGGTGGTGCTGGCCCCCAGG - Intergenic
1016136778 6:140554329-140554351 TCCTGGTGGTGGTGGCCACAGGG - Intergenic
1016154044 6:140781182-140781204 CTGTGGTGGTGGAGGCCACAAGG + Intergenic
1016230975 6:141803771-141803793 TAGTGGTGATGGTGGCCACAGGG - Intergenic
1016251670 6:142049775-142049797 TTGTAGTGGTGGTGGTCACAGGG + Intergenic
1016457321 6:144244849-144244871 CTGTGGTGGTGGTGGCCACAGGG - Intergenic
1016808607 6:148237943-148237965 CTATGTAGGTGGTGTCCACTGGG - Intergenic
1017282392 6:152638354-152638376 CTCTGGTGGTTGTCTCCACAAGG - Intergenic
1017924764 6:158901391-158901413 CAGTGGTGGTGGTGGCCACATGG - Intronic
1018316668 6:162562918-162562940 TCATAGTGGTGGTGGCCACAGGG + Intronic
1019002997 6:168771006-168771028 CTATGGTGGGAGAGGCCAAATGG + Intergenic
1019044444 6:169132318-169132340 CAGTGGTGGTGGCGGCCACAGGG + Intergenic
1020519879 7:9172755-9172777 TCATAGTGGTGGTGACCACAGGG - Intergenic
1021365795 7:19776169-19776191 ATATGGTGGTCGTGGGCACTGGG + Intergenic
1021413912 7:20359968-20359990 ATCTGGAGGAGGTGGCCACATGG - Intronic
1021641094 7:22736441-22736463 TCACAGTGGTGGTGGCCACATGG + Intergenic
1022080253 7:27012928-27012950 CTGTGGTGGTGGTGGCTATGGGG + Intergenic
1022205117 7:28156308-28156330 GTGTGGTGGTGGTGGTCACCTGG + Intronic
1022226790 7:28371580-28371602 CCATGGTGGTGCTGCCCGCAGGG - Intronic
1022348360 7:29539807-29539829 TCATAGTGGTGGTGGCCACAGGG + Intergenic
1022741080 7:33122493-33122515 CTGTGGTGGTGGTGGCCACAGGG - Intergenic
1024410891 7:49039600-49039622 CTGGGGTGGTGGTGGCTACAAGG + Intergenic
1024488424 7:49947618-49947640 CACAGGTGGTGGTTGCCACAGGG - Intronic
1024661217 7:51497215-51497237 CTAGGGTGGTGGTGGCTATGCGG - Intergenic
1025718247 7:63983632-63983654 TTTGGGTGGTGGTGGCCACAGGG + Intergenic
1025765691 7:64445663-64445685 GTATGATGGTGGGTGCCACATGG - Intergenic
1025800219 7:64780024-64780046 CTGTGGTGGTGGTGGCAATGGGG - Intergenic
1027363596 7:77434139-77434161 CTATGGTGTGGTTGTCCACATGG + Intergenic
1028339139 7:89695782-89695804 CCATAGTGGTAGTGGCCACAGGG + Intergenic
1028950475 7:96630039-96630061 TGCTAGTGGTGGTGGCCACAAGG - Intronic
1028972648 7:96875839-96875861 CTGGGATGGTGGTGGCCATAGGG + Intergenic
1029127073 7:98301854-98301876 GGGTGGTGGTGGTGTCCACATGG + Intronic
1029634332 7:101773894-101773916 CTATGGTCTGGGTGGCCTCAGGG - Intergenic
1029797192 7:102908806-102908828 TCATAGTGGTGGAGGCCACAGGG - Intronic
1029797260 7:102909164-102909186 CTGGGGTGGCGGTGGCTACAGGG - Intronic
1030222505 7:107111144-107111166 CTATAGTGGTGGTGGCCACAGGG + Intronic
1030408212 7:109142557-109142579 TAATGGTGGTGGTGGCCACAGGG - Intergenic
1030431550 7:109455314-109455336 CTGTGGTGATGGTGGCCATGGGG - Intergenic
1030598994 7:111571310-111571332 TCTTAGTGGTGGTGGCCACAGGG + Intergenic
1030881203 7:114882388-114882410 TGGCGGTGGTGGTGGCCACAGGG - Intergenic
1031098544 7:117449217-117449239 CAATGGTGCTAGTGGCCACAGGG + Intergenic
1031231514 7:119113891-119113913 TTACAGTGGTGGTGGCCACAGGG - Intergenic
1031236710 7:119186936-119186958 CTATGGTGGGGAAGGCCAAATGG + Intergenic
1031546128 7:123053271-123053293 CTGGGGTGGTGGTGACCACAGGG - Intergenic
1031612704 7:123846040-123846062 CTCTGGTGGAGGTGGCAGCAGGG + Intronic
1031639009 7:124139678-124139700 TTATAGTGCTGGTGGCCACAGGG - Intergenic
1031657937 7:124380848-124380870 TCATAGTGGTAGTGGCCACAAGG + Intergenic
1031862345 7:126994619-126994641 TAGTGGTGGTGGTGGCAACAGGG + Intronic
1031905876 7:127458953-127458975 CTGGGGTGGTGGCGGCCACAGGG + Intergenic
1032939176 7:136768593-136768615 TGGTGTTGGTGGTGGCCACAAGG + Intergenic
1033667764 7:143458941-143458963 TTATGATGGTGGTGGCAAGATGG + Intergenic
1033691443 7:143741019-143741041 TCATAGTGGTGGTGGCCAAAGGG + Intergenic
1033867746 7:145713388-145713410 CTGTGGTGGTGGTGGCCATGAGG - Intergenic
1033882368 7:145901940-145901962 CCATATTGGTGGTGGACACAGGG - Intergenic
1034245760 7:149643205-149643227 CTCTGATGGTGGTGGCAACCAGG + Intergenic
1034711425 7:153194733-153194755 TGATTGTGGTGGTGGCCACATGG + Intergenic
1035537597 8:404288-404310 TTAGGGTGGTGGTGAGCACAGGG - Intergenic
1036799937 8:11783215-11783237 CTTTGGTGGTGGTGGCTTCCTGG + Exonic
1037974833 8:23201679-23201701 CTATGGGGGTGGAGGCACCATGG + Intronic
1037985890 8:23290294-23290316 ACATGGTGGAGATGGCCACACGG + Exonic
1039410205 8:37348573-37348595 TGATGGTGGTGGTGGTTACATGG + Intergenic
1040628203 8:49175992-49176014 CTGTGGTGGTGGTGGCCATGGGG + Intergenic
1041202797 8:55467183-55467205 CTATTGTGGAGATGGCTACAAGG - Intronic
1041579855 8:59446638-59446660 CAGTTGTGGTGGTGGCCACAGGG - Intergenic
1041606971 8:59793089-59793111 CTGGGGCAGTGGTGGCCACATGG + Intergenic
1042477245 8:69262360-69262382 CTGTGATGGTGCTGGCCTCATGG - Intergenic
1042726767 8:71887826-71887848 TCATAGTTGTGGTGGCCACAGGG - Intronic
1045036481 8:98180262-98180284 CTGGGGTGGTGCTGGCCCCAGGG + Intergenic
1045124151 8:99071483-99071505 TCATAGTGGTGGTGGCCACATGG - Intronic
1045245050 8:100435416-100435438 GGATGGTGCCGGTGGCCACAAGG + Intergenic
1045590066 8:103583023-103583045 TCATAGTGGTGGTGGCCACAGGG + Intronic
1045733300 8:105266672-105266694 TTCCAGTGGTGGTGGCCACAAGG - Intronic
1045777345 8:105821564-105821586 TCATCGTGGTGGTGGCCACAGGG - Intergenic
1045994963 8:108351936-108351958 TGTTGGTGGTGGTGGCCAGAGGG + Intronic
1046211300 8:111080658-111080680 CTCAGGTGGAGGTGGCCACAGGG - Intergenic
1046268084 8:111858225-111858247 TCATAGTGGTGGTGGCCACAGGG - Intergenic
1046384012 8:113486012-113486034 TTTCAGTGGTGGTGGCCACAGGG - Intergenic
1048646708 8:136428664-136428686 TGGTGGTGGTGGTGACCACAAGG + Intergenic
1049216840 8:141412225-141412247 GTATGGTGGAAGTGGCCCCAAGG + Intronic
1049301481 8:141872856-141872878 TGAGGGTGGTGGTGGGCACAGGG + Intergenic
1049301499 8:141872913-141872935 TGAGGGTGGTGGTGGGCACAGGG + Intergenic
1049904944 9:207874-207896 CTATCCTGGTGGTGGCTAAAAGG + Intergenic
1050224794 9:3441401-3441423 ATATGCTGGTTGTTGCCACAGGG - Intronic
1050248232 9:3714072-3714094 TACTGCTGGTGGTGGCCACAGGG + Intergenic
1050807107 9:9694736-9694758 CAGTGGTGGTGGCAGCCACAGGG - Intronic
1051966602 9:22836038-22836060 CTGTGGTGGTAGTGGCCAGGGGG - Intergenic
1052063425 9:23987707-23987729 TCATAGTGGTGTTGGCCACAGGG + Intergenic
1052204868 9:25827458-25827480 CAGTGGTGGTGGTGGCCACAGGG - Intergenic
1052214529 9:25950621-25950643 TTATAGTGGTGGTGGCCACAGGG - Intergenic
1052476884 9:28971519-28971541 CTATTGTGGTGGTGGCCATAGGG + Intergenic
1052476936 9:28971882-28971904 TCATAGTGGTGGTAGCCACAAGG + Intergenic
1052732942 9:32310905-32310927 CCGTGGTGGTGGTGGCCACAGGG + Intergenic
1055073811 9:72193908-72193930 CTGTGGTGGCAGTGGACACAAGG - Intronic
1055339137 9:75263179-75263201 TCATAGTGGTGGTGGCCACAGGG - Intergenic
1055579913 9:77697985-77698007 CTACGGTGGTGGTGGCTACAGGG - Intergenic
1055886421 9:81069179-81069201 CGGTAGTGGTGGTGCCCACAGGG - Intergenic
1056007323 9:82285992-82286014 CTGGGGTGGTGGTGGCTTCAGGG + Intergenic
1056516806 9:87359809-87359831 CTGGGGTAGTGGTGGCCACAGGG + Intergenic
1056639407 9:88357764-88357786 CTATGGGGGTGGGGCCCTCATGG + Intergenic
1057112810 9:92490122-92490144 CTGTGGAGGTGCTGGGCACAGGG - Intronic
1058003994 9:99896022-99896044 CTGGGGTGGTGGTGGCCATGGGG + Intergenic
1058522753 9:105828404-105828426 CTCGGGCAGTGGTGGCCACAGGG - Intergenic
1058767908 9:108199435-108199457 TCATAGTGGTGGTGGCCACAAGG + Intergenic
1058780272 9:108325913-108325935 TCATAGTTGTGGTGGCCACAGGG + Intergenic
1058935467 9:109765925-109765947 CAATTGTGATGGAGGCCACATGG + Intronic
1059061716 9:111039653-111039675 CTATGTTGGTGGTGGCCACCAGG + Intergenic
1059510894 9:114845546-114845568 CTGTGGTGGTGGTGGCTCCCTGG - Intergenic
1059515436 9:114889862-114889884 CTGGGGTGGTGGTGGCTACTGGG + Intergenic
1059515493 9:114890214-114890236 TCATAGTGGTGGTGGCCTCAGGG + Intergenic
1059555355 9:115275617-115275639 TTCCAGTGGTGGTGGCCACAGGG - Intronic
1060304544 9:122398781-122398803 CTGTGGTGGTGCTGGCCATGGGG + Intergenic
1060471648 9:123952786-123952808 CAATGGGGGCTGTGGCCACAGGG - Intergenic
1061399646 9:130361447-130361469 GGATGGTGCTGGTGGCCATATGG + Intronic
1061915472 9:133750927-133750949 TCATAGTGGTGGTGGTCACAGGG - Intergenic
1062465837 9:136681063-136681085 AGAGGGTGGTGCTGGCCACACGG - Intronic
1062487217 9:136785123-136785145 CATTGGTGGTAGTGGCCCCAGGG - Intergenic
1187314866 X:18183743-18183765 CTGCGGCAGTGGTGGCCACAAGG + Intronic
1187636867 X:21238667-21238689 CTGTGGTGGTGGTGGCCATGGGG + Intergenic
1187651952 X:21419804-21419826 TCATGGTGGTGGTGGCCACAAGG - Intronic
1187844978 X:23525436-23525458 CTGTGGTGGTGATGACCATAGGG + Intergenic
1187845034 X:23525790-23525812 TCATAGTGGAGGTGGCCACAGGG + Intergenic
1187889388 X:23920066-23920088 CAGTGGTGGTGGTGGCCACAAGG - Intronic
1187950247 X:24464492-24464514 CTATGGTGGTGGTGTAGAGAAGG + Intergenic
1188031680 X:25270657-25270679 ATATGGTGTTGGAGGCCACGAGG + Intergenic
1188040446 X:25365810-25365832 TCATAGCGGTGGTGGCCACAGGG - Intergenic
1188046137 X:25428016-25428038 TCATAGTGGTGGTGGCCACAGGG - Intergenic
1188068750 X:25694469-25694491 TCATAGTGGTGGTGGCCACAGGG - Intergenic
1188108157 X:26167229-26167251 TCATAGTGGTGGTGGCCACAGGG - Intergenic
1188579043 X:31687537-31687559 TCATGGTGGTGAGGGCCACAGGG + Intronic
1188742879 X:33808454-33808476 CCATAGTGCTGGTGGCCACAGGG - Intergenic
1188749961 X:33893142-33893164 TTGTGGTGGCAGTGGCCACAAGG - Intergenic
1188854200 X:35171955-35171977 CAGTGGTGGTGGTAGCCACAGGG - Intergenic
1188917812 X:35934324-35934346 CAGTGGTGGTGGCGGCCATAGGG - Intronic
1188932015 X:36123554-36123576 CTGTGGTGGTTGTGGCCACAGGG - Intronic
1188972262 X:36632570-36632592 CTGTGGTGATGGTGGACACAAGG - Intergenic
1188996145 X:36888080-36888102 CTGTGGTGGTGGTAGCCACAGGG + Intergenic
1189225200 X:39406955-39406977 CTCTGGTGGAGGTGGTTACAAGG - Intergenic
1189374839 X:40458876-40458898 GTCTGGTGGAGGTGGCCCCATGG + Intergenic
1189411833 X:40779570-40779592 CTGGGGTGATGGTGGCTACAGGG - Intergenic
1189875638 X:45433528-45433550 CTGGGGTGGTGGTGGCCATGGGG - Intergenic
1190015170 X:46820241-46820263 CTGTGATGGTGGTGGCCATGGGG + Intergenic
1190122292 X:47672216-47672238 CTAGAGTGGTGGTAGCCACAGGG - Intergenic
1190227923 X:48560270-48560292 CGCTGGTTTTGGTGGCCACAGGG + Exonic
1190374292 X:49774399-49774421 CTATGGTGTTGGTAGCCACAGGG - Intergenic
1190530434 X:51369034-51369056 CGGGGGTGGTGGTGGCTACAGGG + Intergenic
1190588100 X:51967552-51967574 CAGTGTTGGTGGTGGCCACAGGG - Intergenic
1190919458 X:54838691-54838713 TCATAATGGTGGTGGCCACAGGG - Intergenic
1191059286 X:56277918-56277940 CTATGGTAGTGGTAGCCAAGGGG - Intronic
1191123841 X:56933263-56933285 CCTTGGTAGTGGTGGCCACAGGG + Intergenic
1191197207 X:57737065-57737087 TGGTGGTGTTGGTGGCCACAGGG + Intergenic
1191207329 X:57848977-57848999 TCATAGTGTTGGTGGCCACAGGG - Intergenic
1191593176 X:62911949-62911971 CTGGGGTGGTGGTGGCCACAGGG - Intergenic
1191650376 X:63530191-63530213 TCATGGTGGTGGTGGCAACAGGG + Intergenic
1191700707 X:64038741-64038763 CAATGATGGTAGTGGCCACTGGG + Intergenic
1191703796 X:64071242-64071264 CTGTGGTGGTGGTGGCAACAGGG + Intergenic
1191801033 X:65079462-65079484 TCATAGTGGTGGTGGCCACAGGG + Intergenic
1191946891 X:66544334-66544356 CTGTGGTGATGGTGGCAAAAGGG - Intergenic
1192045950 X:67674564-67674586 TGGGGGTGGTGGTGGCCACAGGG - Intronic
1192400298 X:70827615-70827637 CACTGATGGTGGCGGCCACAGGG + Intronic
1192676257 X:73199706-73199728 CTGTGGTGGTGGTGGCCATGGGG + Intergenic
1192694504 X:73399997-73400019 CCATGGTGGTGGTGGACAAAGGG + Intergenic
1192714668 X:73627217-73627239 TCATAGTGATGGTGGCCACAGGG - Intronic
1192812671 X:74560693-74560715 TCACAGTGGTGGTGGCCACATGG + Intergenic
1192836170 X:74801939-74801961 CTGTGGTTGTGGTGGCCATGGGG + Intronic
1192855920 X:75011759-75011781 CTGGGGTGGTGGTGACTACAGGG - Intergenic
1192891028 X:75390439-75390461 CCCTAGTGGTGGTGGCCACAGGG + Intronic
1192908448 X:75578232-75578254 CCATAGTGGTGGTGGCCACAGGG - Intergenic
1192958749 X:76103934-76103956 CTAGGGTGGTGGTGACCATGGGG - Intergenic
1193000520 X:76557792-76557814 TCATAGTGGTGGCGGCCACAGGG - Intergenic
1193052356 X:77115036-77115058 CTGTGGTGGTGGTGGACATGGGG - Intergenic
1193088447 X:77468428-77468450 CTGGGGTGGTGGTGGCTATAAGG + Intergenic
1193088511 X:77468788-77468810 TTATAGTAGTGGTGGCCACAGGG + Intergenic
1193163439 X:78256225-78256247 TCATAGTGGTGGTGGCCACAGGG - Intergenic
1193169161 X:78315982-78316004 TCATAGTGGTGGTAGCCACAGGG + Intronic
1193185153 X:78502654-78502676 TCATAGTGGTGGTGGCCACAGGG + Intergenic
1193192746 X:78592197-78592219 TCATAGTGGTGGTGGCCACAGGG - Intergenic
1193194805 X:78619455-78619477 CTGTGGTGGTGGTGGCCATGAGG - Intergenic
1193246067 X:79231828-79231850 CCATAGTGATTGTGGCCACAGGG - Intergenic
1193289277 X:79752997-79753019 CTATGCTGGTGGTGGCCATGGGG - Intergenic
1193417123 X:81238371-81238393 CTGTGGTGGCAGTGGCCACGGGG + Intronic
1193417179 X:81238728-81238750 TCATAGTGGTGGTGGCCACAGGG + Intronic
1193524407 X:82572154-82572176 TCAGAGTGGTGGTGGCCACAGGG - Intergenic
1193665463 X:84310357-84310379 CTGGGGTGGTGGTAGCTACAGGG + Intergenic
1193673651 X:84419750-84419772 TAATACTGGTGGTGGCCACAGGG + Intronic
1193683621 X:84552099-84552121 TCAGAGTGGTGGTGGCCACAGGG - Intergenic
1193692989 X:84669468-84669490 TAATTGTGGTGGTGGCCACAGGG + Intergenic
1193697159 X:84723485-84723507 TCATAGTGGTGATGGCCACAGGG - Intergenic
1193760853 X:85463256-85463278 TCATAGTGGTGATGGCCACAGGG + Intergenic
1193830908 X:86288653-86288675 CTATGGTAGTGGTAGCCACTGGG - Intronic
1193905815 X:87243213-87243235 CTGTGGTGGTGGTGGACATGCGG - Intergenic
1193917166 X:87379433-87379455 TGATGGTGGTGGTGGCCAGAAGG + Intergenic
1193930361 X:87544541-87544563 TTATAGTGATGGTGGCCACAAGG + Intronic
1193981682 X:88188253-88188275 CTGAGTTGGTGGTGGCCACCTGG + Intergenic
1193985023 X:88229481-88229503 TCTTTGTGGTGGTGGCCACAGGG + Intergenic
1194016303 X:88625347-88625369 CTGTGGTGGAGGTGGCCATTGGG + Intergenic
1194223740 X:91228144-91228166 TCATAGTGGTGGTGGCCACCAGG + Intergenic
1194229300 X:91301892-91301914 CCAAGGTGGTGGTGGCAACAAGG + Intergenic
1194229624 X:91306459-91306481 TCATAGTGGTGATGGCCACAGGG - Intergenic
1194229673 X:91306819-91306841 CTGAGGTAGTGGTGGCTACAGGG - Intergenic
1194285580 X:92007017-92007039 TCATAGTGGTGGTGACCACAGGG - Intronic
1194398502 X:93414707-93414729 CACTGGTGGTGGTGGCCATGGGG + Intergenic
1194415535 X:93606777-93606799 AGGTGGTGGTGGTGGCCATAGGG + Intergenic
1194447118 X:94002091-94002113 CAGTGTTGGTCGTGGCCACAGGG - Intergenic
1194476983 X:94370080-94370102 TCATAGTGGTGGTGGCCACATGG + Intergenic
1194479306 X:94400886-94400908 CAGTGGTGGTGGTGGATACAGGG - Intergenic
1194561660 X:95428695-95428717 TCATAGTGGCGGTGGCCACAAGG + Intergenic
1194568533 X:95523180-95523202 TCATAGTGGTGGTGGCCACAGGG + Intergenic
1194574674 X:95596992-95597014 TCATAGTGGTGGTGGCCACAGGG + Intergenic
1194692875 X:97009191-97009213 CTGGGGTGGTGATGGCCACACGG - Intronic
1194791845 X:98160187-98160209 CTGGGGTGGCGGTGGCTACAAGG + Intergenic
1194795933 X:98210954-98210976 CAGGGGTGGTGGTAGCCACAGGG + Intergenic
1194841925 X:98753776-98753798 TGGTGGTGGTGGTGGCCACAGGG - Intergenic
1194921872 X:99777740-99777762 TTATAGTGGTGGTGGTCACAGGG - Intergenic
1194925412 X:99817794-99817816 TCATAGTGGTGGTGGCTACAGGG + Intergenic
1194990820 X:100544541-100544563 TCATAGTGGTGGTGGCCACAGGG + Intergenic
1195136311 X:101910010-101910032 TCACAGTGGTGGTGGCCACAGGG + Intronic
1195199409 X:102533164-102533186 CAGTGGTGGCGGTGGCCACAGGG + Intergenic
1195289997 X:103423457-103423479 CTGCAGTGGTGGTGGCCACAGGG - Intergenic
1195502144 X:105613715-105613737 CTGTGGTGGTGGTAGCCATGGGG + Intronic
1195782983 X:108485066-108485088 CTGTGGTGGTGGTGACCATGAGG - Intronic
1195852109 X:109294861-109294883 CTTTGGTGGTGGTGGCTACAGGG - Intergenic
1195917274 X:109948118-109948140 CCAGTGTGGTGGTAGCCACAAGG + Intergenic
1195971401 X:110477695-110477717 TCCTAGTGGTGGTGGCCACAGGG - Intergenic
1195971463 X:110478049-110478071 CAGTGGTGGCGGTGGCCACAGGG - Intergenic
1196247444 X:113415977-113415999 CTCTGGTAGTGGTGGCCATGGGG + Intergenic
1196399442 X:115299202-115299224 TCATAGTGGTGGCGGCCACAGGG - Intronic
1196461271 X:115934819-115934841 TCATAGTGGTGGTGGCCACAGGG - Intergenic
1196479884 X:116135772-116135794 CTATGGTGGTGGTGCCAATAGGG - Intergenic
1196510080 X:116499230-116499252 CAGTGGTGGTGGTAGCCACAGGG - Intergenic
1196512052 X:116523579-116523601 CTGTGGTGGTGATGGACATAGGG - Intergenic
1196523725 X:116707044-116707066 CCATAGTGGTGGCAGCCACAGGG - Intergenic
1196579131 X:117359044-117359066 CTGTGGTGGCAGTGGCTACAGGG - Intergenic
1196600824 X:117600222-117600244 TCATAGTGGTGGTGGCCACAGGG - Intergenic
1196609674 X:117696466-117696488 TTATAGTTGTGGTGGCCACAGGG + Intergenic
1196660574 X:118264580-118264602 CTGTGGTGGCAGTGGCTACAAGG + Intergenic
1196660632 X:118264891-118264913 TCATAGTGTTGGTGGCCACAGGG + Intergenic
1196865471 X:120066705-120066727 TCATAGTGGTGGTGACCACAGGG + Intergenic
1196877622 X:120169575-120169597 TCATAGTGGTGGTGACCACAGGG - Intergenic
1196922246 X:120595797-120595819 TCATAGTGGTGGTGGCCACAGGG + Intronic
1196980486 X:121208705-121208727 TCATAGTGGTGGTGGCCACAGGG - Intergenic
1196984436 X:121253210-121253232 TCACAGTGGTGGTGGCCACAGGG - Intergenic
1197025102 X:121738555-121738577 TCCTAGTGGTGGTGGCCACAGGG + Intergenic
1197068583 X:122266284-122266306 TTGTAGTGGTGGTGGCCACAGGG - Intergenic
1197099516 X:122636372-122636394 CTGGGATGGTGGTGGCCACAGGG - Intergenic
1197348369 X:125351153-125351175 TCATAGTGGTGGTGGCCACAAGG + Intergenic
1197363105 X:125532149-125532171 CCATAGTGGTGGTGGCCACGGGG - Intergenic
1197363167 X:125532495-125532517 CTGGTGTGGTGGTGGCTACAAGG - Intergenic
1197370550 X:125621330-125621352 GCATGGTGGTGGTGGCAGCATGG + Intergenic
1197376043 X:125682777-125682799 CAGTGGTGGTGGTGGGCACAGGG + Intergenic
1197438073 X:126456661-126456683 TCATAGTGGTGCTGGCCACAGGG + Intergenic
1197449446 X:126593959-126593981 TCATAGTGGTGATGGCCACAGGG - Intergenic
1197502723 X:127261039-127261061 TAATAGTGGTGGTGGCCACAGGG + Intergenic
1197600419 X:128520642-128520664 CTGTGGTGGCAGTGGCCACAAGG + Intergenic
1197602516 X:128547489-128547511 TCATAGTGGTGGTGGCCAAAGGG - Intergenic
1197661480 X:129178696-129178718 CTGAAGTGATGGTGGCCACAGGG - Intergenic
1198190529 X:134299817-134299839 CTAGGGTGGTGGTGGCTAAGAGG + Intergenic
1198197624 X:134380791-134380813 TTAAGGTGGTGCTGGGCACATGG + Intronic
1198293074 X:135257396-135257418 CAGTGGTGATGGTGGCCACAGGG + Intronic
1198596886 X:138245957-138245979 CTGTGGTGGTGGTGGTTACCTGG - Intergenic
1198697123 X:139354354-139354376 TTTTAGTGGTGGTGGCCACAGGG - Intergenic
1198697184 X:139354713-139354735 CTATGGTGGTGGTGGCCATGGGG - Intergenic
1198702458 X:139413178-139413200 TCCTAGTGGTGGTGGCCACAGGG - Intergenic
1198770530 X:140125867-140125889 CAATGATAGTGGTGGCCACTGGG - Intergenic
1198817961 X:140613760-140613782 TCATAGTGGTGGTGGCCACAGGG - Intergenic
1198841076 X:140858837-140858859 CTGTGGTGGTGGTGGCCATTGGG + Intergenic
1198925487 X:141787718-141787740 TCATAGTGGTGGTGGCAACAGGG - Intergenic
1198982052 X:142409051-142409073 TGATAGTGGTGGAGGCCACAGGG + Intergenic
1198995175 X:142566499-142566521 ATGTGGTGGTGGTAGCCACAGGG - Intergenic
1199018368 X:142846934-142846956 GTATAGTGGTAGTGGCCACAGGG - Intergenic
1199036075 X:143052690-143052712 TCATGGTGGTAGTGGCCACAAGG - Intergenic
1199036131 X:143053033-143053055 CTGTGGTAGTGGTGGCTACAGGG - Intergenic
1199156238 X:144551764-144551786 TCATACTGGTGGTGGCCACAGGG + Intergenic
1199159878 X:144596699-144596721 TTCTGGTGGCAGTGGCCACAAGG - Intergenic
1199191866 X:144980526-144980548 CTGTGCTGGTGGTGGAAACAAGG + Intergenic
1199217883 X:145282078-145282100 CTGTGGTGGCAGTGGCCACAAGG - Intergenic
1199317141 X:146394495-146394517 TCATAGTGGTGGTGGCTACAAGG - Intergenic
1199358412 X:146887337-146887359 TCATAGTGGTGGTGGCCACAGGG + Intergenic
1199680389 X:150220391-150220413 TGGTGGTAGTGGTGGCCACAGGG - Intergenic
1199862074 X:151810098-151810120 CTATTGTGGCTTTGGCCACAGGG + Intergenic
1199908554 X:152260471-152260493 TCATAGTGGTGGTGGCCATAGGG + Intronic
1200163038 X:154018996-154019018 AGATGGCGGTGGAGGCCACAGGG + Exonic
1200370577 X:155720175-155720197 CTGTGATCGTGTTGGCCACAGGG + Intergenic
1200560204 Y:4691526-4691548 TCATAGTGGTGGTGGCCACCAGG + Intergenic
1200603148 Y:5231555-5231577 TCATAGTGGTGGTGACCACAGGG - Intronic
1200636372 Y:5659543-5659565 TGGTGGTGGTAGTGGCCACAGGG - Intronic