ID: 1088156147

View in Genome Browser
Species Human (GRCh38)
Location 11:106805987-106806009
Sequence ATAATGCCACATGTTATTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 215}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088156145_1088156147 9 Left 1088156145 11:106805955-106805977 CCAAAACTCAGTTTTCTTATCCG 0: 1
1: 1
2: 13
3: 81
4: 542
Right 1088156147 11:106805987-106806009 ATAATGCCACATGTTATTCAAGG 0: 1
1: 0
2: 0
3: 21
4: 215
1088156144_1088156147 14 Left 1088156144 11:106805950-106805972 CCTTTCCAAAACTCAGTTTTCTT 0: 1
1: 1
2: 19
3: 149
4: 1111
Right 1088156147 11:106805987-106806009 ATAATGCCACATGTTATTCAAGG 0: 1
1: 0
2: 0
3: 21
4: 215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088156147 Original CRISPR ATAATGCCACATGTTATTCA AGG Intronic
902074334 1:13771085-13771107 ATAATGACAAAGGTTCTTCAGGG - Intronic
907069547 1:51521331-51521353 ATAATTTCACTTGCTATTCAAGG + Intergenic
910991790 1:93064139-93064161 TTATTTCCCCATGTTATTCAAGG + Intergenic
911896290 1:103438975-103438997 ATACTGCCAGAGGTTAATCAAGG - Intergenic
914686794 1:149987249-149987271 ACAATGCCACATTTTGTCCAGGG + Intronic
916173421 1:162019246-162019268 TTATTACCACATGTTATTCAAGG + Intronic
916456880 1:164980210-164980232 ATAATGGAAAATGTTAGTCAGGG + Intergenic
916651192 1:166836190-166836212 ATAAAGCCAGAAGTTATTCCTGG - Intergenic
920431713 1:205923009-205923031 ATACTGCCCCCTGTTACTCATGG - Intronic
921991092 1:221368502-221368524 GTAATACCACCTGATATTCAAGG - Intergenic
923197291 1:231680843-231680865 TTAATGCCATATTTTATGCATGG - Intronic
1064479748 10:15727326-15727348 AAAATGCCACATGCCATCCATGG + Intergenic
1064610848 10:17100645-17100667 AACAGGCCACAGGTTATTCAGGG - Intronic
1065039155 10:21673144-21673166 AAAATGACACATGTTTTTAAAGG + Intronic
1065085886 10:22175999-22176021 ATTATGCCACTTCTTATTTAGGG - Intergenic
1065852606 10:29803268-29803290 CTAATGACAGATGTTATTAAGGG - Intergenic
1065983369 10:30925632-30925654 ACAAGGCCACATGTGATACAAGG - Intronic
1067765881 10:49086060-49086082 ATAATGCCACATGGTACACATGG + Intronic
1068819444 10:61357026-61357048 ATAATCCCACATGTTGTGGAAGG + Intergenic
1069218987 10:65859072-65859094 ATGCTGCCACAAGTTATTCCAGG + Intergenic
1072431372 10:95374472-95374494 ATAATGCCATACTTTAGTCAAGG - Intronic
1072566650 10:96621924-96621946 ATATTGCCAAATGTTCTTTAGGG + Intronic
1074345540 10:112682342-112682364 ATAATTTAACATGTAATTCAGGG - Intronic
1074523295 10:114243968-114243990 CTAATCCCACTTGTTATTCCTGG - Intronic
1074547934 10:114416203-114416225 AAATGGCCACAAGTTATTCATGG + Intergenic
1077534889 11:3119327-3119349 TTAATGTCACATTTTACTCATGG + Intronic
1079365886 11:19809337-19809359 CTAAATCCACATGTTATCCATGG + Intronic
1079853061 11:25562627-25562649 ATTAAGCCAAATGTTATTCCTGG - Intergenic
1081234435 11:40629364-40629386 ATTATGCTACATTTTTTTCAAGG - Intronic
1081392832 11:42549504-42549526 ATAATGCTTAATGATATTCAAGG - Intergenic
1085856731 11:80183704-80183726 AAAATGCCAAATATTATTCTTGG + Intergenic
1085877640 11:80427937-80427959 ATAAAGGCATATGTTCTTCATGG + Intergenic
1086170858 11:83835014-83835036 ATAATGCATCATTTTATGCATGG - Intronic
1087060465 11:93972118-93972140 TAAATACCACATGTTATTAAAGG + Intergenic
1088156147 11:106805987-106806009 ATAATGCCACATGTTATTCAAGG + Intronic
1089027019 11:115281597-115281619 ATAATGAAACTTGTTCTTCAAGG + Intronic
1089828958 11:121307722-121307744 AAAATGCCAGATGTTGTTCGGGG + Exonic
1089893133 11:121901141-121901163 ATAAAGCCACCTTTTATTGAGGG - Intergenic
1090505131 11:127303257-127303279 ATAAAGCCATATTTTATTTATGG - Intergenic
1091313377 11:134592521-134592543 AAGATGCCACACATTATTCAGGG + Intergenic
1093592988 12:20928595-20928617 AGGATGCCCCATGTAATTCATGG + Intergenic
1095236895 12:39807416-39807438 ATTATGCAAGTTGTTATTCAGGG + Intronic
1098840762 12:75475339-75475361 CAAATGCCACTTGATATTCAAGG - Intergenic
1100125224 12:91416699-91416721 ATAGTGCTACATGTTGTTGAAGG - Intergenic
1100150920 12:91736442-91736464 ACAATGCCACATAATTTTCAAGG - Intergenic
1100591299 12:96032683-96032705 ATAATGTTACATGTTATACAAGG - Intronic
1100782001 12:98036989-98037011 CTAATTCAACATGTTAATCATGG - Intergenic
1100884021 12:99049726-99049748 ATAATGCCAGATTATTTTCATGG + Intronic
1103369812 12:120410290-120410312 ATAATCCCCCATATTATTCAAGG - Intergenic
1106323487 13:28664672-28664694 ATAACGCCTCATATTCTTCATGG - Intronic
1109046647 13:57421233-57421255 ATTATGCCACAGGGTATTTAAGG + Intergenic
1109459189 13:62632076-62632098 GTATTGCCACATTTTTTTCAGGG - Intergenic
1109471959 13:62819555-62819577 AAAATTCCAATTGTTATTCAAGG + Intergenic
1111105380 13:83638860-83638882 ATAATGCGTCATGTTGTACAAGG - Intergenic
1111500940 13:89119355-89119377 ATAACTCCACATGTCATTCAAGG + Intergenic
1113209674 13:107961159-107961181 ATAATAGCAAATGTCATTCATGG + Intergenic
1113393860 13:109924965-109924987 CTAAAGCCAAATGTTTTTCAAGG + Intergenic
1114971688 14:28038111-28038133 ATAATGTAAACTGTTATTCATGG - Intergenic
1116090789 14:40303227-40303249 AAAATGACACATGTAATACATGG - Intergenic
1116189354 14:41643989-41644011 ATATTACCACATGTTATAAAGGG - Intronic
1119722852 14:76902840-76902862 ATATTGCCACATGTCCTTGAAGG + Intergenic
1202892244 14_KI270722v1_random:169448-169470 ATGATGCCACCTATCATTCAGGG + Intergenic
1123901701 15:24883611-24883633 ATAATTGCACATATTTTTCAAGG - Intronic
1127351387 15:58156300-58156322 ATAGTGCAATATATTATTCATGG - Intronic
1130097307 15:80865528-80865550 ACATAGCCACATGTGATTCATGG + Intronic
1130175162 15:81561098-81561120 AAAATGACACATATTTTTCAAGG + Intergenic
1135829126 16:25758025-25758047 ATAATGCTGCAAGTTATTCTGGG - Intronic
1138442270 16:57042256-57042278 ATAATCCCACTTCTGATTCAAGG + Intronic
1142801369 17:2348068-2348090 ATAAAGCCTGATGTTATTCCCGG - Intronic
1144000259 17:11047723-11047745 ACAATACCATATGTTTTTCAAGG + Intergenic
1144619922 17:16811848-16811870 ATAATGCCACTTGCCATTAATGG + Intergenic
1144964596 17:19068526-19068548 ATAATGCAAAATGTTACTAACGG + Intergenic
1144983371 17:19183647-19183669 ATAATGCAAAATGTTACTAACGG - Intergenic
1144984854 17:19194592-19194614 ATAATGCAAAATGTTACTAACGG + Intergenic
1148291468 17:46454836-46454858 ATAAAGCCATATTGTATTCAGGG + Intergenic
1148313656 17:46672538-46672560 ATAAAGCCATATTGTATTCAGGG + Intronic
1148825380 17:50389519-50389541 ATAATGCCAGAGATTATACAAGG - Intronic
1156694099 18:39746241-39746263 AGAATGACACATATTATTCATGG + Intergenic
1159103481 18:63980469-63980491 ATCATGCCACCTGATATGCAGGG + Intronic
1159482722 18:69011177-69011199 TTAATGCCATATGTTAATAAGGG - Intronic
1159715635 18:71819205-71819227 ATAAGTCCAAATGATATTCAAGG - Intergenic
1166584283 19:43931574-43931596 AAAATGCAACAAGTTATTGAAGG - Intronic
1166756613 19:45196382-45196404 ATAATGCAACATGGTGTCCATGG + Intronic
1168341166 19:55624072-55624094 ATAATCCCCCACGTTTTTCAGGG + Intronic
925520863 2:4743660-4743682 ATAATGCAAGATGTTAATAAAGG + Intergenic
925542942 2:4985845-4985867 ATATTGTCATATATTATTCATGG + Intergenic
926789675 2:16557251-16557273 ATAATCCTACATCTTCTTCAAGG + Intronic
927180177 2:20440311-20440333 AAAATCCTACTTGTTATTCAAGG + Intergenic
928176903 2:29040402-29040424 AAAATGCCAAATGTTAATAATGG - Intronic
929273842 2:40004061-40004083 ACAATGCTACATGTCATTTATGG + Intergenic
930636261 2:53809140-53809162 ATAATGCCACATGACAGTAATGG - Intronic
930671145 2:54152012-54152034 ATAATGCAAGATGTTAATAATGG - Intronic
931351528 2:61493893-61493915 ATATTTGCCCATGTTATTCAAGG - Exonic
931714259 2:65016543-65016565 ATATTGGGCCATGTTATTCATGG + Exonic
931838021 2:66120051-66120073 ATAATGGGAAATGTTATGCACGG - Intergenic
932623489 2:73280988-73281010 AGGAAGCCACCTGTTATTCAAGG - Intronic
933081387 2:77991338-77991360 ATAATGCATCATTTTATTTATGG + Intergenic
933208147 2:79533630-79533652 ATAATGGCACATGTTCCTAATGG + Intronic
933497746 2:83072011-83072033 ATAATGCCACTTTTTCTCCATGG - Intergenic
935135998 2:100302648-100302670 ATAAAGACACATGTTAGGCAAGG - Intronic
935541057 2:104350005-104350027 ATTTTGCAAGATGTTATTCAGGG + Intergenic
935571663 2:104668608-104668630 AGACTACAACATGTTATTCAGGG - Intergenic
938629685 2:133153339-133153361 TTAATGCAAGATGTTAATCATGG + Intronic
939509937 2:143092788-143092810 ATAGTACAACATATTATTCATGG + Intronic
941697142 2:168564811-168564833 ATAAGGCAGCATGTGATTCAGGG - Intronic
942364578 2:175210803-175210825 ATAATTTCACATGGTATTCTGGG + Intergenic
942805964 2:179931126-179931148 AAATTGCCACATGTTATGCGAGG - Intergenic
945552293 2:211235405-211235427 ATAATACCACATTTTATTTGAGG + Intergenic
946013554 2:216586043-216586065 CTAATACTACATGCTATTCATGG - Intergenic
1170505263 20:17019070-17019092 TTAATGCCGCATATAATTCATGG - Intergenic
1170885028 20:20333248-20333270 ATAATGCCACATCTTTTACCTGG + Intronic
1171071401 20:22071987-22072009 ATTTTGCCACATTTTATTGATGG + Intergenic
1173231836 20:41204515-41204537 ACAATGCCACATGTCACTCCGGG - Exonic
1177270454 21:18841373-18841395 ATAATCCCACTTTTTATTCCTGG + Intergenic
1177934857 21:27332378-27332400 CTATTTTCACATGTTATTCATGG + Intergenic
1178704270 21:34860107-34860129 AAAATGCCAGATGTTATTAGAGG + Intronic
949688579 3:6607895-6607917 ATATTGCCATAAATTATTCATGG + Intergenic
952673007 3:35993816-35993838 ATATTGCTACAGGTTATTCAGGG - Intergenic
952973591 3:38673822-38673844 TTAATGTCATATGTTATTGAAGG + Intergenic
954816332 3:53284254-53284276 ATAATGCAACATGAAATTGAAGG - Exonic
956478102 3:69644915-69644937 AAAATGCCACATGCTCTTTATGG - Intergenic
958595759 3:96219560-96219582 ATAATTTCACATTTTATTCTTGG + Intergenic
958685807 3:97391840-97391862 AAAATGCCTAATGTTATTCATGG + Intronic
962576754 3:136762004-136762026 AGAAGGCCAAATGTTCTTCAGGG - Intergenic
963334547 3:143958395-143958417 AAAATAGCACATGTTATACAAGG - Intergenic
963492862 3:146022714-146022736 ATAATGCCAGATGTTAATGAGGG + Intergenic
964804075 3:160587661-160587683 ATATTGCTACTAGTTATTCAGGG - Intergenic
965494434 3:169380868-169380890 CTAATGCCACATGCTACACATGG + Intronic
966411033 3:179645963-179645985 CTTATGCCACATGATTTTCATGG + Intergenic
967468866 3:189839748-189839770 AAAAAGCCACATGATATTCAGGG - Intronic
967484077 3:190009721-190009743 ATAAAACCACATGTTTTTCTGGG - Intronic
969486725 4:7476445-7476467 ATAAGGCCTCATGTTATTTTGGG + Intronic
972077468 4:35105221-35105243 ATAATGCCCCATGTACTTGAAGG - Intergenic
972434966 4:39024447-39024469 ATAATACCACATTTTCTTTATGG - Intronic
972881656 4:43431276-43431298 TTTATGCCACATTTTATACATGG + Intergenic
973254917 4:48100291-48100313 ATAATGCCACATGTCACAAAGGG + Intronic
976117174 4:81740267-81740289 ATAAGGCCACACCTAATTCAAGG + Intronic
976693892 4:87897962-87897984 ATAATGATACATGCTATTTATGG - Intergenic
977387566 4:96362307-96362329 AGAAGGGAACATGTTATTCAAGG + Intergenic
979007451 4:115318843-115318865 ATAATGAAACAGGTTATTCTTGG + Intergenic
979762367 4:124422139-124422161 CTAATGCTACAGGTTCTTCATGG + Intergenic
980475800 4:133314299-133314321 ATATTGTGACATTTTATTCAAGG + Intergenic
980491780 4:133537200-133537222 ATAATAGCACATTTTATTTAAGG + Intergenic
981340342 4:143615207-143615229 AGAATGCCCCATGATATCCAAGG + Intronic
982148665 4:152427241-152427263 GAAATGCAACATGTTACTCAGGG + Intronic
982708104 4:158732293-158732315 ATAATGCCACATTTTCTTCCTGG - Intergenic
983123154 4:163913887-163913909 TTAATGACACATATCATTCAGGG - Intronic
983455308 4:167955517-167955539 GTCATGCCACCTCTTATTCAGGG - Intergenic
985873076 5:2574305-2574327 AAAATGCCACCTGTTTTTCAAGG - Intergenic
986552624 5:8974903-8974925 AAACTCCCACATGTTATCCATGG - Intergenic
986564551 5:9099297-9099319 AAAATGCCACATGTTGTTAAAGG - Intronic
986756294 5:10839695-10839717 GTATTGCCACTGGTTATTCAGGG - Intergenic
986793723 5:11189207-11189229 ATCATGGCACCTGTTTTTCAAGG - Intronic
989042229 5:37240886-37240908 ATAATGCCAAATATTTTTAAAGG + Intronic
990956620 5:61347197-61347219 ATACTGCCAGATGTTGTTCAAGG - Intronic
993822462 5:92635811-92635833 ATAATGCTTCATCTTCTTCAAGG + Intergenic
994025910 5:95083297-95083319 AGAATGAAACATGTTATACATGG - Intronic
994424454 5:99566945-99566967 AACATGCAAAATGTTATTCATGG - Intergenic
997887280 5:137641502-137641524 ATAATGGCAAAAGTTGTTCATGG - Intronic
999824499 5:155261039-155261061 GTAATGCTACATGTTGTCCATGG - Intergenic
1000399451 5:160811155-160811177 ATATTGCTACTGGTTATTCATGG - Intronic
1000624364 5:163522193-163522215 ATAGTGGCACATGTGATTCTTGG - Intergenic
1001459297 5:171895454-171895476 AATAAGCCACATTTTATTCAGGG - Intronic
1002121765 5:177010447-177010469 ATAATACCACATGTTTTTGAAGG + Intronic
1005443826 6:25900142-25900164 ATTATGCCACCTGATATTCAGGG - Intergenic
1005638291 6:27771730-27771752 ATAATGCCACTCTTTATTCCTGG - Intergenic
1007907422 6:45476306-45476328 ATACTGCCCCATGAGATTCAAGG + Intronic
1008974370 6:57407706-57407728 TTAATGCCACATGAAATTGAAGG - Intronic
1009163259 6:60309225-60309247 TTAATGCCACATGAAATTGAAGG - Intergenic
1009190646 6:60625424-60625446 ATAATGCCATATGAGACTCATGG - Intergenic
1009496094 6:64348865-64348887 ATAATGCCAAATGTCATTATTGG - Intronic
1009639912 6:66321099-66321121 AGAATGCCAGATGTTTTACATGG - Intergenic
1012265730 6:97139777-97139799 TAAATGCCATATTTTATTCAAGG + Exonic
1012534484 6:100279179-100279201 ATTATGCCACATTATATTAATGG + Intergenic
1013370945 6:109470519-109470541 GTCATGCCCCATGTTATTCTGGG - Intronic
1013749435 6:113386324-113386346 ATAATGCCATATGTCCTTCCTGG + Intergenic
1019038268 6:169081035-169081057 AGAATGCCACATGCAATTGAAGG + Intergenic
1021046122 7:15925066-15925088 ATATTGCTGCTTGTTATTCAGGG - Intergenic
1023472021 7:40533100-40533122 ATAATGCTACTTGTATTTCATGG - Intronic
1024211406 7:47208911-47208933 ATAATGCCACCTATTTTGCATGG - Intergenic
1025909542 7:65817212-65817234 AAAATGGCACATTTTATTCAGGG + Intergenic
1025911052 7:65828935-65828957 AAGATGGCACATTTTATTCAGGG + Intergenic
1026392973 7:69920992-69921014 ATAATGCCATGTGTTTTTCTTGG + Intronic
1027204246 7:76084618-76084640 AAGATGGCACATTTTATTCAGGG - Intergenic
1028273674 7:88824236-88824258 ATAATCCCACATGTTGTGGAAGG + Intronic
1030010511 7:105161784-105161806 ATAATGTAAGATATTATTCAAGG - Intronic
1030447792 7:109669186-109669208 ATAATGTTAAATGGTATTCATGG - Intergenic
1030579183 7:111331626-111331648 ATTATTCCACATTGTATTCATGG + Intronic
1031742225 7:125447984-125448006 ATAATGCCTCATGGAACTCATGG - Intergenic
1032068152 7:128788385-128788407 ATCTTGCCACATTTGATTCAAGG - Intergenic
1032302851 7:130705486-130705508 ACAAATCCACATGTTATTCATGG - Intergenic
1033300966 7:140185134-140185156 CTAATGAGACATGTTACTCATGG + Intergenic
1035092440 7:156325512-156325534 ACATAGCGACATGTTATTCAAGG + Intergenic
1039746186 8:40430199-40430221 ATAATGCCACATTTTTTAAATGG - Intergenic
1040565798 8:48565618-48565640 ATAATGCCACATGGTAATGCAGG + Intergenic
1040890543 8:52312357-52312379 ATAATGCCACATGCTTTCAAAGG + Intronic
1040896092 8:52369938-52369960 ATACTGCCACATGCTATTCTAGG - Intronic
1041996597 8:64068559-64068581 ATTATTCCACATTGTATTCATGG + Intergenic
1044764797 8:95559978-95560000 AGAGTGACACATGTTATTGATGG + Intergenic
1044928399 8:97228838-97228860 AAAATGCCATTTTTTATTCAAGG + Intergenic
1045066567 8:98452328-98452350 ATAATAACACCTGTTATTCGGGG - Intronic
1046163864 8:110403201-110403223 ATAATGCTACATTCTATTCAGGG - Intergenic
1046545573 8:115645721-115645743 ATGATGGCACATGTCATTAAAGG + Intronic
1050435748 9:5608418-5608440 ATAATGCCAAATCCTATTCCAGG - Intergenic
1051051697 9:12940949-12940971 AGAATGAAAAATGTTATTCATGG + Intergenic
1051117997 9:13719424-13719446 AGTATGCTACATGTTTTTCATGG + Intergenic
1051527345 9:18060987-18061009 ATAATGCTACCTGTTACTCATGG + Intergenic
1051726791 9:20095991-20096013 ATAATTCCACATGTTGTGGAAGG - Intergenic
1053527426 9:38844339-38844361 ATAATGCAAAATGTAAATCAAGG - Intergenic
1053698960 9:40667496-40667518 ATAAAGACACATATTATTCTTGG - Intergenic
1054310249 9:63466897-63466919 ATAAAGACACATATTATTCTTGG - Intergenic
1054409038 9:64791049-64791071 ATAAAGACACATATTATTCTTGG - Intergenic
1054442197 9:65274863-65274885 ATAAAGACACATATTATTCTTGG - Intergenic
1054488083 9:65746634-65746656 ATAAAGACACATATTATTCTTGG + Intergenic
1057053835 9:91946616-91946638 ATAATTCCACATTGTAGTCAGGG - Intronic
1058099060 9:100898410-100898432 AAAATGCCAGATGTTTTTCTTGG + Intergenic
1058616224 9:106830859-106830881 ATAATGCCACATGTTCTCATTGG + Intergenic
1059628426 9:116092429-116092451 ATAATCCCACATGTCATGGAAGG + Intergenic
1059848175 9:118304569-118304591 ACAATGCCAAATGTTCCTCAGGG + Intergenic
1061351462 9:130068462-130068484 ATTAACCCACATGTTATACATGG - Intronic
1186272132 X:7900341-7900363 ATCATGCCACATATTCTCCATGG + Exonic
1188122206 X:26321283-26321305 AAAATTCAACATGTTTTTCAGGG - Intergenic
1189098667 X:38166247-38166269 ATAATTTCTCATTTTATTCAGGG + Intronic
1189893977 X:45634024-45634046 ATTATCCAACATGTAATTCAAGG - Intergenic
1191036037 X:56027460-56027482 ATAATGCCCCATGTACTTGAAGG + Intergenic
1191235635 X:58131605-58131627 ACAATGCCAGATGTTGCTCAGGG - Intergenic
1191246708 X:58233868-58233890 AGAATGCCTTATGTCATTCAGGG - Intergenic
1192022378 X:67408164-67408186 ATAATGCCAAATTATATTCCAGG - Intergenic
1192255875 X:69458295-69458317 ATAATACCACCTGATACTCAAGG - Intergenic
1194016239 X:88624956-88624978 GTATTGCCACTGGTTATTCAGGG - Intergenic
1194120115 X:89951483-89951505 AACATGCCACTTGTTGTTCAGGG + Intergenic
1194294597 X:92112948-92112970 ATAAGGTCATATGTTCTTCAGGG - Intronic
1197328743 X:125127087-125127109 ATAATGGAACAAGTTAGTCAAGG + Intergenic
1197507583 X:127326660-127326682 ATTATTCCACATGTTAATAAAGG - Intergenic
1200472977 Y:3609004-3609026 AACATGCCACTTGTTGTTCAGGG + Intergenic
1200612096 Y:5337451-5337473 ATAAGGTCATATGTTCTTCAGGG - Intronic
1201560667 Y:15313073-15313095 GAATTTCCACATGTTATTCAAGG + Intergenic