ID: 1088156259

View in Genome Browser
Species Human (GRCh38)
Location 11:106807572-106807594
Sequence GCTAGTAAGTACATGTATCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 80}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088156259_1088156261 19 Left 1088156259 11:106807572-106807594 CCTAGATACATGTACTTACTAGC 0: 1
1: 0
2: 0
3: 2
4: 80
Right 1088156261 11:106807614-106807636 TGTAAACGTCATTGGATTGAAGG 0: 1
1: 1
2: 58
3: 1851
4: 1844
1088156259_1088156260 11 Left 1088156259 11:106807572-106807594 CCTAGATACATGTACTTACTAGC 0: 1
1: 0
2: 0
3: 2
4: 80
Right 1088156260 11:106807606-106807628 ATATTGAGTGTAAACGTCATTGG 0: 1
1: 1
2: 19
3: 568
4: 1786

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088156259 Original CRISPR GCTAGTAAGTACATGTATCT AGG (reversed) Intronic
903117413 1:21189673-21189695 GCTTGTAATTACTTGTATCATGG + Intergenic
904150600 1:28435868-28435890 GCTAATAAGTATAAGTACCTAGG + Intronic
910768917 1:90811104-90811126 GGTAGAAAGTACATTAATCTGGG - Intergenic
911845456 1:102746592-102746614 GCTATTAACTACATGAATATGGG - Intergenic
912248279 1:107984004-107984026 ACAAGTAAATACATGTGTCTTGG - Intergenic
912937011 1:114012404-114012426 GCTATTAAAGACATATATCTGGG + Intergenic
916205405 1:162311502-162311524 GCTAATATGTACATATAACTTGG - Intronic
917676415 1:177323009-177323031 GCTATTATCTACATGAATCTGGG + Intergenic
917985154 1:180309131-180309153 GCTAGTAAATATATATCTCTGGG - Intronic
918019729 1:180674857-180674879 GCTAAAAAGAACATGTATATTGG + Intronic
919004752 1:191882310-191882332 GCAAGTGATTACATGTATATAGG - Intergenic
919410216 1:197233364-197233386 GAAATTAGGTACATGTATCTGGG + Intergenic
1072470199 10:95706708-95706730 GGTAGTAAGTACATGCAGATTGG + Intergenic
1073924505 10:108499510-108499532 TCAAGTAAGTACATGAATTTAGG - Intergenic
1079674437 11:23208089-23208111 GTTAGTAATTAAATATATCTAGG + Intergenic
1080212991 11:29808495-29808517 GCTAGTTAGTACATATATTAGGG - Intergenic
1082806228 11:57453281-57453303 GAGAGTGAGTACATGTATGTGGG - Intergenic
1086337655 11:85814742-85814764 GCTAGTAAGTAAATATTTATTGG + Intergenic
1086467440 11:87069820-87069842 GCTATTGAGGACATGTAACTTGG - Intronic
1088156259 11:106807572-106807594 GCTAGTAAGTACATGTATCTAGG - Intronic
1088353310 11:108913763-108913785 GCTAGAAAGTACATACTTCTAGG + Intronic
1088832039 11:113545464-113545486 GCAAGTAAGTAAATGAATCCAGG - Intergenic
1089857903 11:121562974-121562996 GATAGTAACTACATGTATTGAGG + Intronic
1098074297 12:66711320-66711342 ATTAGTAAATACATGTCTCTGGG + Intronic
1111084340 13:83353868-83353890 GCAATTAAATACATGTATCCAGG - Intergenic
1114975118 14:28086365-28086387 GCTAGTAAGTATATGCATAAAGG + Intergenic
1115714039 14:36083227-36083249 GCTAATAAGTCCTTGCATCTAGG - Intergenic
1121373307 14:93381122-93381144 ACTAGTTAGTACCTTTATCTTGG - Intronic
1124900201 15:33815404-33815426 GCTCGAAAGCACATGTCTCTGGG + Intronic
1129979255 15:79851604-79851626 GCTGGTCAGTACATCTACCTAGG + Intronic
1132017913 15:98335303-98335325 GCTTGTTAGTACATGTGGCTTGG + Intergenic
1141815461 16:86406417-86406439 GCTATTCAGTGCAGGTATCTAGG - Intergenic
1149066556 17:52487702-52487724 GCAAGTGATTACCTGTATCTGGG + Intergenic
1150673947 17:67228194-67228216 CCTAGTAAGTAAAGATATCTTGG - Intronic
1154425298 18:14267488-14267510 GCTAGTGAGTCTATGAATCTGGG - Intergenic
1154432994 18:14322727-14322749 GCTAGTGAGTCTATGAATCTGGG - Intergenic
1155381610 18:25228418-25228440 GCTAGATATTACATGTAGCTAGG + Intronic
1158738387 18:60110474-60110496 GTAGGTAAGTACATGAATCTGGG + Intergenic
1167914523 19:52729724-52729746 GCAAATAAGTACATTTATATAGG + Intronic
928923478 2:36551701-36551723 CTGTGTAAGTACATGTATCTGGG + Intronic
938171216 2:129078573-129078595 GCTAATAAGTCCAGATATCTGGG - Intergenic
940861451 2:158774264-158774286 GCTATTAAGGAGATGTATATTGG - Intergenic
944771405 2:202917692-202917714 ACAGGTAACTACATGTATCTTGG - Intronic
945918770 2:215732944-215732966 CCTATTAAATAGATGTATCTTGG - Intergenic
1174980317 20:55387130-55387152 CCTTGTAAGTACCTGGATCTAGG + Intergenic
1176240397 20:64073272-64073294 CCTAGTAAGGACATGTTTCCAGG + Exonic
960268187 3:115645586-115645608 CCTAGTAAATACTAGTATCTTGG + Intronic
960400947 3:117198114-117198136 GATAGCAAGTACATGTTTCATGG - Intergenic
963244991 3:143049552-143049574 GGTAGAAAGCACATGGATCTTGG - Intronic
971157083 4:24095042-24095064 GCTAATAACTAAATGTATGTGGG + Intergenic
972407063 4:38756934-38756956 ACTAGACAGTACAGGTATCTGGG + Intergenic
973731846 4:53830288-53830310 GATAGAAAGAACATGTATTTTGG - Intronic
974291566 4:59938645-59938667 GGTAGTGTGTACATGGATCTTGG - Intergenic
977085122 4:92586468-92586490 GCAAGTAAGTATATGTATTTTGG + Intronic
981890573 4:149731399-149731421 GCTAGTTAGTACCTTGATCTTGG + Intergenic
982986553 4:162215609-162215631 GATAGTCAGTACTTGTATCAAGG - Intergenic
987570934 5:19657784-19657806 TCTAGGAAGCACATGTTTCTTGG + Intronic
987898681 5:23982173-23982195 ACTACTAAGTACAGGTTTCTGGG + Intronic
992717809 5:79528913-79528935 GCTATTAAGAACATGAATTTTGG + Intergenic
993458922 5:88159197-88159219 CCTAGTAAGTAAATGTATGAAGG + Intergenic
994146773 5:96404135-96404157 GGTAGTTAGTAGGTGTATCTTGG - Intronic
995647460 5:114329075-114329097 TATAGAAAGAACATGTATCTAGG - Intergenic
999040328 5:148402510-148402532 GTTGGTGAGTACATGTTTCTTGG + Exonic
1000807580 5:165815433-165815455 TTTAGTAAAAACATGTATCTAGG - Intergenic
1004233458 6:13852892-13852914 GCTAGGAAGTCCATGAACCTAGG - Intergenic
1004898669 6:20173623-20173645 GCTAGGCAGTGCAAGTATCTTGG + Intronic
1008244692 6:49156697-49156719 TCTAGTAATTACATGACTCTGGG + Intergenic
1009802855 6:68564079-68564101 TCTAGAATGTACATGTATATAGG + Intergenic
1009850037 6:69184471-69184493 ACTAATATGTACATGTACCTTGG + Intronic
1015988307 6:138908630-138908652 CCTAGTAATTAAATGTGTCTAGG + Intronic
1016323389 6:142872720-142872742 GCTAGTTAGTTCATATCTCTGGG - Intronic
1016935455 6:149446251-149446273 GCTATGAAGCACATGCATCTTGG + Intergenic
1017738709 6:157385587-157385609 TCTAGTAAGTTCATTTCTCTTGG - Intronic
1020726834 7:11826280-11826302 GCTATTATGTACATGTTTCTTGG + Intronic
1024290971 7:47803749-47803771 CCTATTCTGTACATGTATCTGGG - Intronic
1026421452 7:70241453-70241475 AGTAGTAAGTACTTTTATCTAGG - Intronic
1031416649 7:121503752-121503774 GCTTGTAAGCACAGGTTTCTAGG - Intergenic
1032853891 7:135818125-135818147 GAAAGTCAGTACATGTGTCTGGG + Intergenic
1038597258 8:28899192-28899214 GATAGTACGTTCATGTATCCAGG - Intronic
1048468993 8:134690591-134690613 CCTAGTATTTACATGTGTCTAGG + Intronic
1052289635 9:26826858-26826880 GCTATTATGTACATGAATATGGG + Intergenic
1054708178 9:68484038-68484060 CCTAGCAAGTACCTGTTTCTTGG - Exonic
1188167036 X:26874239-26874261 GCCAGTTAGTACATATATGTAGG + Intergenic