ID: 1088157230

View in Genome Browser
Species Human (GRCh38)
Location 11:106822011-106822033
Sequence AAATAACTAGAATTTAGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 684
Summary {0: 1, 1: 0, 2: 2, 3: 78, 4: 603}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088157230 Original CRISPR AAATAACTAGAATTTAGGCT GGG Intronic