ID: 1088158582

View in Genome Browser
Species Human (GRCh38)
Location 11:106840173-106840195
Sequence AAAAATGATGATATTGTTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 860
Summary {0: 1, 1: 0, 2: 4, 3: 77, 4: 778}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088158580_1088158582 8 Left 1088158580 11:106840142-106840164 CCTAAGAAATAAGGTATCTCTCA 0: 1
1: 0
2: 0
3: 24
4: 248
Right 1088158582 11:106840173-106840195 AAAAATGATGATATTGTTATTGG 0: 1
1: 0
2: 4
3: 77
4: 778
1088158576_1088158582 27 Left 1088158576 11:106840123-106840145 CCCTCCATCTATACATTCACCTA 0: 2
1: 1
2: 56
3: 700
4: 5382
Right 1088158582 11:106840173-106840195 AAAAATGATGATATTGTTATTGG 0: 1
1: 0
2: 4
3: 77
4: 778
1088158577_1088158582 26 Left 1088158577 11:106840124-106840146 CCTCCATCTATACATTCACCTAA 0: 1
1: 0
2: 4
3: 34
4: 284
Right 1088158582 11:106840173-106840195 AAAAATGATGATATTGTTATTGG 0: 1
1: 0
2: 4
3: 77
4: 778
1088158578_1088158582 23 Left 1088158578 11:106840127-106840149 CCATCTATACATTCACCTAAGAA 0: 1
1: 0
2: 1
3: 20
4: 233
Right 1088158582 11:106840173-106840195 AAAAATGATGATATTGTTATTGG 0: 1
1: 0
2: 4
3: 77
4: 778

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088158582 Original CRISPR AAAAATGATGATATTGTTAT TGG Intronic
901300215 1:8194917-8194939 AAAAAGGATGACATTGCTTTTGG - Intergenic
901549502 1:9985106-9985128 AAAAATTATGAGAATGTTAGAGG - Exonic
901972112 1:12916264-12916286 AAACCTGATGATATCTTTATGGG - Intronic
901989326 1:13100041-13100063 AAACCTGATGATATCTTTATGGG + Intergenic
901992487 1:13126723-13126745 AAACCTGATGATATCTTTATGGG - Intergenic
902013066 1:13285498-13285520 AAACCTGATGATATCTTTATGGG + Intergenic
903244862 1:22007849-22007871 AACAATGATGGTATTCTTAATGG - Intronic
903583257 1:24388163-24388185 AAAAATAAAGATGTTGTAATAGG - Intronic
905104484 1:35556516-35556538 AAAAATGAACAGATTGTTCTGGG + Intronic
905508310 1:38498209-38498231 ATAAATTATCATATTGTTAAAGG - Intergenic
905607533 1:39316270-39316292 AAAAATGGTGACATTGATTTTGG + Intronic
907167535 1:52427772-52427794 AAAAATGATGAATTTGATAATGG + Intronic
907295706 1:53451604-53451626 ACATATGATGTTATTTTTATGGG - Intergenic
907350156 1:53822787-53822809 AATAATGATGATAATGATAATGG + Intronic
907519909 1:55016385-55016407 CAAAATGATGCCAGTGTTATGGG - Intergenic
907860537 1:58348432-58348454 AAAAAAGATGATTTTGTTTGAGG + Intronic
908176218 1:61557714-61557736 AAAAATCATGGTATTGAGATAGG - Intergenic
908176221 1:61557756-61557778 AAAAATCATGGTATTGAGATAGG - Intergenic
908338663 1:63153764-63153786 GACAATGATGATATTTTTATAGG - Intergenic
908604582 1:65782035-65782057 AACAATGATGATATTTTGATGGG - Intergenic
908624539 1:66025985-66026007 AAAAATAATTATATTATTAAAGG - Intronic
908862297 1:68503124-68503146 AACAATGGTGGTATTTTTATGGG - Intergenic
908919180 1:69169587-69169609 CAAAATGCTGATAATGATATAGG + Intergenic
909800349 1:79798665-79798687 GAAAATGACAATATTGTAATTGG + Intergenic
909899932 1:81120583-81120605 AAAAATAATAATTTTCTTATAGG - Intergenic
909914860 1:81304081-81304103 AAAAAAGATGAGTTTGTTATTGG - Intergenic
909988553 1:82192720-82192742 AAGAATGATGACAATGTTTTTGG - Intergenic
910356803 1:86366654-86366676 AAAAATGAAAAAATTCTTATAGG + Intronic
910568450 1:88673284-88673306 AAAAATGATGTTAATAATATAGG + Intergenic
910663636 1:89700968-89700990 AGCTATGATTATATTGTTATAGG - Intronic
911005056 1:93211714-93211736 ATAAATTATGACACTGTTATAGG - Intronic
911099062 1:94079607-94079629 ACTAATGATGAGCTTGTTATTGG - Intronic
911386955 1:97188262-97188284 AAAAATGATGAAATACATATTGG - Intronic
911407731 1:97463659-97463681 AAAAATGCTGATAATGATAAGGG + Intronic
911715815 1:101131526-101131548 AAAAATGAAGGAGTTGTTATTGG - Intergenic
912121883 1:106481205-106481227 AATAATGATGATATTTTCATAGG - Intergenic
913037127 1:114980558-114980580 GAAAAGGCTGATATTTTTATAGG + Intronic
913413519 1:118579006-118579028 ATAAAAGTTCATATTGTTATGGG - Intergenic
913429365 1:118773471-118773493 AATGATGATGGTATTTTTATGGG - Intergenic
913663505 1:121026578-121026600 AAAAATTATAAAATTCTTATGGG + Intergenic
914014897 1:143809857-143809879 AAAAATTATAAAATTCTTATGGG + Intergenic
914162925 1:145151358-145151380 AAAAATTATAAAATTCTTATGGG - Intergenic
914653517 1:149718396-149718418 AAAAATTATAAAATTCTTATGGG + Intergenic
916082849 1:161246507-161246529 CAAAGGCATGATATTGTTATAGG - Intergenic
916429668 1:164715276-164715298 AAAAATGATGATGATGTCTTTGG + Intronic
916532219 1:165667916-165667938 AAAAATGTTGATAGTTTTGTAGG - Intronic
916803534 1:168236685-168236707 AAAAATAATAATATGGTTATAGG - Intronic
917285318 1:173416527-173416549 GATAATGAAGATATTGTTACTGG - Intergenic
917387555 1:174493512-174493534 AAAGTTGATGATAATTTTATAGG + Intronic
917739841 1:177951797-177951819 AAAAGTGATGATAATATTAATGG - Intronic
917921980 1:179758264-179758286 ATCAATGTTGATATTATTATTGG + Intronic
918648205 1:186926466-186926488 AAAAATGTTACTTTTGTTATGGG - Intronic
918828702 1:189362975-189362997 TAAAATCATGATACTGTTACGGG - Intergenic
919162167 1:193844597-193844619 AAAAGTGATGATATATTAATTGG + Intergenic
919346939 1:196394110-196394132 AAAAATAATGATATTGTGAGAGG + Intronic
920074830 1:203328385-203328407 ATAAATGGTGATATTATTTTAGG + Intergenic
920723570 1:208412741-208412763 AAAAATGATGATGATGATAGTGG - Intergenic
920754287 1:208713997-208714019 AAAAGTGAGGAAAATGTTATTGG - Intergenic
920887105 1:209939292-209939314 AGAAATAATGATATAGCTATAGG - Intronic
921370425 1:214417571-214417593 AATGTTGAAGATATTGTTATGGG - Intronic
921556535 1:216604847-216604869 AAAAATGATGATATACTTTGTGG - Intronic
922361422 1:224825637-224825659 AATGATGATGGTATTTTTATGGG + Intergenic
923624286 1:235601560-235601582 AGCAATGATCATATTGTCATGGG + Intronic
923952477 1:238973644-238973666 AAACATGATAATATGGTTCTAGG - Intergenic
924314402 1:242781024-242781046 AAAAATGAGGAAATTGACATTGG + Intergenic
924601675 1:245495392-245495414 CAAAGTGATGATTTTGGTATAGG + Intronic
924783810 1:247175988-247176010 AAAAGTTATGAAATTGTTTTTGG - Intergenic
924888869 1:248252654-248252676 AAAAATCATGACATTGTATTTGG - Intergenic
1064191426 10:13209200-13209222 AAAAATGAAAATATTTTAATAGG - Intronic
1064667191 10:17666874-17666896 TAAAATGAGGATATGATTATAGG - Intronic
1065040406 10:21688394-21688416 AAAACTGAAGATATTATGATGGG - Intronic
1065851983 10:29797961-29797983 AAAAATGAGGACATTGTTTCAGG + Intergenic
1065910316 10:30297886-30297908 AATGATGATGATATTTTGATGGG + Intergenic
1066123323 10:32313153-32313175 AAAAATGATTCCATTGTCATTGG - Intronic
1066231904 10:33442934-33442956 TAAACTAATGATTTTGTTATTGG - Intergenic
1066273398 10:33845185-33845207 CAAAATGCTGATAATGATATGGG - Intergenic
1067264725 10:44730038-44730060 AAAAATATTTATATTGTTTTTGG + Intergenic
1067383560 10:45797361-45797383 TAAAATAAAGAAATTGTTATGGG + Intergenic
1067783216 10:49224039-49224061 CAAAATGCTGATAATGATATGGG - Intergenic
1067880618 10:50041439-50041461 TAAAATAAAGAAATTGTTATGGG - Intergenic
1068083748 10:52348639-52348661 AAAAGAGATGCTAATGTTATGGG - Intergenic
1068097917 10:52515275-52515297 AAATGTGATATTATTGTTATTGG - Intergenic
1068367865 10:56075574-56075596 AAAAATGATGATAATGATGATGG - Intergenic
1068639502 10:59387477-59387499 AAAAATTATAACAGTGTTATGGG + Intergenic
1068755832 10:60652005-60652027 AAAAATTCTGTTATTTTTATAGG - Intronic
1068846257 10:61678253-61678275 AAAACTTGTGGTATTGTTATGGG - Intronic
1069124391 10:64611476-64611498 AAAACAGATGATATTGTGAAAGG + Intergenic
1069150092 10:64949391-64949413 AATAATGTTGGTATTTTTATGGG + Intergenic
1070438565 10:76418166-76418188 AAAAAAGATGATATTTTGATTGG + Intronic
1071170022 10:82853329-82853351 AATGATGGTGATATTGTGATGGG + Intronic
1072093787 10:92156325-92156347 AAAAATGAAGATAATGATGTTGG + Intronic
1072469959 10:95704248-95704270 AAAAATGCTGAAATTTTTACTGG - Intergenic
1072866578 10:99068105-99068127 CAAAATGCTGATAGTGATATGGG - Intronic
1072942190 10:99775694-99775716 AAAAATGTTAATATTATTCTTGG + Intergenic
1073321943 10:102620902-102620924 AAATATGAGAATATTGTTTTAGG + Intronic
1074092737 10:110277523-110277545 AAAAATGAAAATTTTGTTAAAGG + Intronic
1074409003 10:113208050-113208072 AAATATGCTGATAGTATTATGGG - Intergenic
1074625765 10:115184151-115184173 AAAAATGATATTATTTTCATTGG + Intronic
1076075218 10:127528746-127528768 AAAAATGATGATTTTGAAAGGGG - Intergenic
1077270528 11:1677110-1677132 AAGAATGTTGATATTGTTGGTGG + Intergenic
1077912336 11:6583841-6583863 TAAAATGATCATATGGTTTTTGG - Intronic
1078237465 11:9499158-9499180 TAAAATCATGATATTTTCATTGG + Intronic
1078241927 11:9537750-9537772 AAAAAAGTTGATAATGTTGTTGG + Intergenic
1078649545 11:13175728-13175750 AAAAAATAGGGTATTGTTATGGG - Intergenic
1078833492 11:15000858-15000880 AAAAAAGATGAAAATGTTATAGG - Intronic
1078961551 11:16278606-16278628 AAACTTGATGTTATTGTTCTGGG - Intronic
1079270375 11:18979461-18979483 AATGATGATGATATTTTTGTGGG + Intergenic
1079717459 11:23766298-23766320 AAAAATGATGATTGAGTTACTGG + Intergenic
1079973914 11:27069116-27069138 AATAATGTTGATATTTTGATAGG + Intronic
1080686351 11:34518491-34518513 AAATATGATTTTATAGTTATAGG + Intergenic
1081099198 11:38981259-38981281 TAAATTGTTGATATTGTTTTTGG + Intergenic
1081113705 11:39171357-39171379 AATAATGATGATGATGCTATCGG - Intergenic
1081123434 11:39293527-39293549 AAAAATAATGATTTTCCTATAGG - Intergenic
1081215134 11:40387287-40387309 AGAAATAAGGATAATGTTATTGG - Intronic
1081230794 11:40583589-40583611 AAAAAGGATGATATTGAGTTGGG - Intronic
1081244998 11:40754637-40754659 ATAAATAATGATATTATTATTGG - Intronic
1081350085 11:42041370-42041392 AAAAATGATTATTTTGTTGGAGG - Intergenic
1081361628 11:42187279-42187301 GAAAATGATGGTAGTGTGATTGG - Intergenic
1081924279 11:46811387-46811409 AAAAATGGTAATATTATTTTGGG - Intronic
1082226264 11:49711371-49711393 AAAAATGATCATCTTGTGTTTGG - Intergenic
1082865396 11:57895630-57895652 AAAAAAGATTTTATTTTTATCGG - Intergenic
1082882771 11:58054454-58054476 AAAAATATTGGTATTGGTATTGG - Intronic
1085493208 11:76941689-76941711 GAAAATGATGATATTTTGATAGG + Intronic
1086953600 11:92914619-92914641 AATGATGATGATATTGATAAAGG - Intergenic
1086992082 11:93314431-93314453 TAAAATGCTGATAGTGATATGGG - Intergenic
1087477426 11:98653815-98653837 AAAAAAGAACATATTGTTAATGG + Intergenic
1087502574 11:98977114-98977136 AATGATGATGATATTTTGATGGG - Intergenic
1087523729 11:99280007-99280029 AAAAATCAGGATATTTTTAAAGG + Intronic
1087674824 11:101148747-101148769 AAAATTGTTGGTATTTTTATTGG + Intergenic
1087877389 11:103374582-103374604 CAAAATGCTGATAGTGATATGGG + Intronic
1088116898 11:106322674-106322696 AATAATGAAGGTATTATTATGGG - Intergenic
1088158582 11:106840173-106840195 AAAAATGATGATATTGTTATTGG + Intronic
1088168516 11:106967579-106967601 AAAAAATATGATATTCTAATTGG + Intronic
1088337498 11:108722940-108722962 AACACTGATGATATGTTTATAGG - Intronic
1088387091 11:109271173-109271195 AAGAATGATGATATTTTGATAGG + Intergenic
1088510000 11:110564637-110564659 AAAAATGTCGAAAATGTTATGGG + Intergenic
1088563874 11:111146877-111146899 TAAAAAGTTGATATTGATATAGG + Intergenic
1089905829 11:122037474-122037496 AACTATGATATTATTGTTATGGG - Intergenic
1090144447 11:124305795-124305817 ATAAATGAGGATAATGTTTTAGG - Intergenic
1090145361 11:124315431-124315453 ATAATTGATGATATTAGTATTGG - Intergenic
1090506603 11:127321514-127321536 TAAAATGCTGATAGTGTTATGGG - Intergenic
1090545077 11:127756364-127756386 AATGATGATGATATTTTGATGGG + Intergenic
1091422671 12:356900-356922 AAAAATGAGGTTAGTGTGATTGG - Intronic
1091528208 12:1327824-1327846 AAAAATGATGAGATGATTTTAGG - Intronic
1092354138 12:7780654-7780676 AAATAGGATGATATGGTTTTGGG - Intergenic
1093078404 12:14781255-14781277 GAAAATGAGGATTTTGTTAGCGG - Intergenic
1093855907 12:24101850-24101872 AAGAATGATGAGATTTTTATTGG - Intergenic
1093860832 12:24165204-24165226 AAAACTGATTATGTTGTCATGGG - Intergenic
1093964956 12:25314395-25314417 AATGATGATGATATTTTGATGGG - Intergenic
1094000037 12:25685103-25685125 CAAAATGATGATTTTTTTTTAGG + Intergenic
1095117588 12:38373657-38373679 TAAAATGATGGAATTGTTACCGG + Intergenic
1095345992 12:41149041-41149063 CAAAATGCTGATAGTGATATGGG - Intergenic
1095562373 12:43581338-43581360 AAAAATGTTGCAATGGTTATAGG - Intergenic
1096012191 12:48228573-48228595 AATGATGATGATATTTTGATGGG - Intergenic
1097009933 12:55945776-55945798 AAAAATGAGGATTTTGAGATGGG - Intronic
1097343751 12:58468239-58468261 AAAAATGGTGATAGTGATATGGG - Intergenic
1097664568 12:62465005-62465027 AAAAATGATGCTTTAGTAATTGG - Intergenic
1097741597 12:63249664-63249686 AAAAATGTTCATATTGTTTGAGG - Intergenic
1097885287 12:64722703-64722725 AAAAAAAATGGTACTGTTATTGG + Intronic
1097916713 12:65028398-65028420 AAAAATGATGGTAGTTTGATAGG + Intergenic
1098078667 12:66760147-66760169 AAAAATGCTGATAGTGTGCTGGG - Intronic
1098420103 12:70286610-70286632 AGAAAACATGATATTGGTATAGG - Intronic
1099091201 12:78311473-78311495 AGAAATGATCAGATTGTTTTGGG + Intergenic
1099487693 12:83248739-83248761 CAAAATGCTGATAGTGATATGGG + Intergenic
1099495611 12:83342710-83342732 CAAAATGCTGATAGTGGTATGGG + Intergenic
1099496551 12:83353912-83353934 AGAAATGATGCTATTGAAATGGG - Intergenic
1099658609 12:85526953-85526975 CAAAATGCTGATAGTGATATGGG + Intergenic
1099767101 12:87000566-87000588 TAAAATGATGAAATTTTTAAGGG + Intergenic
1100087777 12:90932458-90932480 AATAATGGTGATATTTTGATGGG + Intronic
1100943508 12:99751912-99751934 AAAAATAATGAAATTGGTTTGGG + Intronic
1101069236 12:101056169-101056191 AAAAGTGTTGATATTTTGATTGG + Intronic
1101120275 12:101571908-101571930 GAACATCATGATATTGTTATTGG + Intronic
1101190359 12:102326181-102326203 TAAAATGCTGATAGTGATATGGG + Intergenic
1101464685 12:104936221-104936243 ATAAATAATGATTTTGTTACTGG + Intronic
1101883687 12:108643207-108643229 AGAAATGTTGTTATTGCTATAGG - Intergenic
1102664399 12:114557817-114557839 AAAAATGATAGTATTGTGAGTGG + Intergenic
1103267421 12:119642757-119642779 AAAAATGCTGAAATTTGTATTGG - Exonic
1104323922 12:127777921-127777943 AAAAATAATTATTTTGTTCTTGG - Intergenic
1105528997 13:21201293-21201315 CAAAATGCTGATAGTGATATAGG - Intergenic
1105961419 13:25344612-25344634 AAAAATTCTGAGATTTTTATTGG + Intronic
1107206614 13:37797892-37797914 AAAAATGATCACAATGTCATAGG - Intronic
1107406271 13:40116896-40116918 AAAAATAATGATTATGTTGTTGG - Intergenic
1107563046 13:41574526-41574548 AATAATGATGGTATTTTGATGGG - Intronic
1108447545 13:50525047-50525069 TAAAAAGAGGCTATTGTTATTGG - Intronic
1108838546 13:54582373-54582395 AAAAATGAGGAAAATGTTATTGG + Intergenic
1109044634 13:57393572-57393594 AAAAACAATGAAATGGTTATTGG - Intergenic
1109567494 13:64136303-64136325 AATGATGATGATATTTTGATGGG - Intergenic
1109643946 13:65227875-65227897 ACATATGATGATATTCTTAAAGG - Intergenic
1109856162 13:68130523-68130545 AATAATAATGATAATGTTTTTGG + Intergenic
1109978603 13:69874579-69874601 TAAAATGATGACATTAATATAGG - Intronic
1110338045 13:74354989-74355011 AAAAATAATTATGTTGTTTTTGG + Intergenic
1110503077 13:76251766-76251788 AAAACTGATGATATTTTTGTTGG + Intergenic
1110629234 13:77687403-77687425 AAAAATGATGATATTTTAACAGG - Intergenic
1110766893 13:79290518-79290540 TAAAATGATGATCTTGTTGAGGG + Intergenic
1110803567 13:79728703-79728725 AAAAATGTTGGTAGTGTGATAGG + Intergenic
1110895929 13:80752677-80752699 AAGAATGTTGATATTGCTGTTGG + Intergenic
1111128426 13:83942364-83942386 AAAAATGAAGATATTCAAATGGG + Intergenic
1111164640 13:84443224-84443246 AATAATGTTGATATTTTGATAGG + Intergenic
1111192922 13:84832677-84832699 AAAAATAATGATAATGTCACGGG - Intergenic
1111248776 13:85576195-85576217 ATAAATGATGGTATTATTAATGG - Intergenic
1111326634 13:86705807-86705829 AATAATGATGGTATTTTGATGGG - Intergenic
1111499585 13:89099347-89099369 AAAACTAATGATATTGATCTTGG + Intergenic
1111633653 13:90875311-90875333 AAGAATGATGATATGAGTATGGG - Intergenic
1112617889 13:101024091-101024113 AAAAATGATTACATTATTAGGGG - Intergenic
1112937260 13:104816460-104816482 AAAAAAAATGATTTTGTCATTGG - Intergenic
1113054974 13:106258234-106258256 AAAATTGCTGCTATTGTCATTGG + Intergenic
1114383519 14:22233166-22233188 CAAAATGCTGATAGTGATATGGG - Intergenic
1114899508 14:27039203-27039225 AAAAATAATTATTTTCTTATTGG + Intergenic
1114932225 14:27487217-27487239 AGAAATGAGGAAAATGTTATTGG - Intergenic
1115012168 14:28562123-28562145 AATAATTCTGATATTGCTATAGG + Intergenic
1115813706 14:37138967-37138989 ACAAATGAAAATATTGTTTTTGG - Intronic
1116036406 14:39632472-39632494 AAAAATGATTATTTTATTGTTGG + Intergenic
1116124307 14:40761997-40762019 AAAAATGAAGCTACTGTTAGTGG - Intergenic
1116248293 14:42446835-42446857 AAAAATGATGATAAAGTCATTGG - Intergenic
1116285275 14:42963179-42963201 AAAAATGTGTATATGGTTATAGG + Intergenic
1116695295 14:48167804-48167826 AATAATGATGGTATTTTAATAGG - Intergenic
1116753630 14:48918307-48918329 AATAATGTTGATATTTTGATAGG - Intergenic
1116896163 14:50316927-50316949 AAGAATGATGGTATTTTTATGGG + Intronic
1117697460 14:58380198-58380220 AAGAATGATGGTATTTTTATGGG + Intergenic
1117703990 14:58443932-58443954 AAAAATGTTTTTATTGTTTTAGG + Exonic
1117850374 14:59962039-59962061 AAAAAAACTGTTATTGTTATGGG + Intronic
1118089120 14:62452744-62452766 AAAAATACTAATATTGTTACTGG + Intergenic
1118988675 14:70778609-70778631 AATGATGATGACAGTGTTATAGG - Intronic
1118998395 14:70858547-70858569 AAAACTGTTGATCTTGTTCTAGG - Intergenic
1119184289 14:72628484-72628506 CAAAATAGTGATATTCTTATTGG - Intronic
1119359556 14:74036938-74036960 AAAAAAGATAATATTTTAATGGG - Intronic
1119459228 14:74785262-74785284 AATGATGATTATATTGTTTTAGG + Intronic
1119832242 14:77713856-77713878 AAAAATGAATAGATTTTTATTGG + Intronic
1120094442 14:80372498-80372520 AAAAATTATCATATTCTTTTTGG + Intronic
1120115874 14:80617203-80617225 AAAAAAGATGATATTCACATAGG - Intronic
1120473406 14:84956252-84956274 AAAAATTATAATATTTTCATTGG + Intergenic
1120654240 14:87169935-87169957 CAAAATGCTGATAGTGATATGGG - Intergenic
1120708535 14:87769902-87769924 AACAATAATGATATAGTTCTTGG + Intergenic
1120785240 14:88528185-88528207 AAAGATGATGGTATTTTGATGGG + Intronic
1121391397 14:93578335-93578357 AAAAAGGATGATACTATTGTTGG + Intronic
1121749485 14:96337811-96337833 AAAAATGACGGTATTTTGATGGG + Intronic
1122527950 14:102402084-102402106 AAAATGTATGCTATTGTTATTGG - Intronic
1123140449 14:106072517-106072539 CAAAATGCTGATAGTGATATGGG + Intergenic
1123663282 15:22585528-22585550 AAAAATGAGCATATTGTTTTTGG - Intergenic
1124009587 15:25826814-25826836 AATAATGATGATAATGATAATGG + Intronic
1124104033 15:26720907-26720929 AAAAATGTTAATATTATCATTGG + Intronic
1124124950 15:26930542-26930564 AAAAATGAGGAACATGTTATTGG - Intronic
1124259381 15:28174955-28174977 AAAAATGAGCATACTGTTTTTGG - Intronic
1124317111 15:28679966-28679988 AAAAATGAGCATATTGTTTTTGG - Intergenic
1124566336 15:30817515-30817537 AAAAATGAGCATATTATTTTTGG + Intergenic
1125049102 15:35276965-35276987 AAAGATGATGATATTTTGATAGG + Intronic
1125126276 15:36225701-36225723 AAAAATGATGGTAGTTTGATAGG - Intergenic
1125233247 15:37482607-37482629 AAAAAGTATGATATTGCTAGTGG - Intergenic
1125273085 15:37961573-37961595 AAGAATGATGGTATTTTGATGGG + Intronic
1125295508 15:38198618-38198640 AAAAATGCTGATACTGTGACTGG - Intergenic
1126487748 15:49201501-49201523 AAAAATGAAAATATTTTTCTAGG + Intronic
1126512954 15:49501292-49501314 CAAAATGCTGATACTGATATGGG + Intronic
1126516445 15:49544029-49544051 AAAGATGATGTTACTTTTATGGG + Intronic
1126825159 15:52541051-52541073 CAAAATGCTGATAGTGATATAGG - Intergenic
1126997076 15:54456387-54456409 AAGAATGATGATGGTATTATGGG + Intronic
1127011988 15:54641429-54641451 AAAAACCATAATATTGTAATAGG + Intergenic
1127090687 15:55463911-55463933 AATGATGATGATATTTTGATGGG - Intronic
1127420588 15:58801404-58801426 AAAAAAGATGATAATTATATAGG + Intronic
1128603072 15:69014356-69014378 ATAATTGATATTATTGTTATTGG + Intronic
1129006413 15:72377094-72377116 ACAAATAATGCTATTGTTATTGG + Intergenic
1129442783 15:75593945-75593967 AAAAAAGATGGTTGTGTTATAGG + Intergenic
1130611607 15:85366415-85366437 AAAAATGATGACAATCTTATGGG + Intergenic
1130628938 15:85545784-85545806 AAGAATGATCATTTTGTTATTGG + Intronic
1130763698 15:86848628-86848650 AAAAAGGATGATATAGTCTTAGG - Intronic
1131635061 15:94224181-94224203 AAAACTGGTAATATTGCTATGGG + Intergenic
1131657674 15:94478504-94478526 AAAAATGCTGAAATTGATACTGG - Intronic
1131963165 15:97810120-97810142 AAACATAAGGACATTGTTATTGG - Intergenic
1133499262 16:6350082-6350104 AAAAATCATGCAATTGATATTGG + Intronic
1135295277 16:21274214-21274236 AAAAATGCTGTTTTTCTTATAGG + Intronic
1136281479 16:29214313-29214335 AAAAATCTGGATATTTTTATTGG - Intergenic
1137834857 16:51582447-51582469 AAAAATGATGATTTTCATCTAGG - Intergenic
1138098164 16:54230057-54230079 TAAAATGTTGATATTTTTATCGG - Intergenic
1138240366 16:55422766-55422788 AATAATGCTGATAGAGTTATTGG - Intronic
1138782053 16:59800521-59800543 AAAGATGGTGATATTTTGATGGG - Intergenic
1139083983 16:63561904-63561926 CAAAATGCTGATAATGATATGGG - Intergenic
1139759376 16:69172169-69172191 AAAAATGAAGTTATTCCTATTGG + Intronic
1140071864 16:71657376-71657398 AAAAAAGATAATATTATTGTTGG - Intronic
1140157243 16:72444182-72444204 AAAAATAATGGTAGGGTTATGGG - Intergenic
1140261144 16:73381275-73381297 AAAAATAATGAAAATGTTACTGG - Intergenic
1140413698 16:74758070-74758092 AAAAATGATGGTATTTATAGAGG + Intronic
1140597356 16:76432000-76432022 AACAATAATGATATTTATATAGG - Intronic
1142085848 16:88180238-88180260 AAAAATCTGGATATTTTTATTGG - Intergenic
1142375397 16:89704241-89704263 AAAAAGGATGAGGTTGTTCTGGG + Intergenic
1142840781 17:2627624-2627646 AAGAATGATGGTATTTTGATGGG + Intronic
1142961027 17:3552759-3552781 AAAAATGAGGATAGAGTTTTGGG - Intronic
1143277784 17:5725695-5725717 AAAGAAGATGATTTTGTAATGGG + Intergenic
1144191951 17:12854509-12854531 AAGAATGATGATACAGTTAGTGG + Intronic
1144510673 17:15872443-15872465 AAAAATGATGGTATTTGGATGGG + Intergenic
1145084253 17:19923016-19923038 AAAGATGATGTTATTCTTAAGGG - Intronic
1145174829 17:20690166-20690188 AAAAATGATGGTATTTGGATGGG + Intergenic
1145920780 17:28607766-28607788 AAAGACGATGAGATAGTTATTGG + Intronic
1146087420 17:29842750-29842772 AAAAATAAGGATATTGTTCATGG + Intronic
1146781488 17:35677641-35677663 AAAAATGCTGAGATTTTTATTGG + Intronic
1146784154 17:35704075-35704097 AAAGAGCATGATATTGTTGTTGG - Intronic
1148879546 17:50715305-50715327 AAAAAAGAAGAAAATGTTATGGG - Intergenic
1149246480 17:54714181-54714203 AAAACTGATTATGTTGATATAGG + Intergenic
1149254147 17:54805692-54805714 AGAGATGATCATATTGTTACCGG - Intergenic
1149321764 17:55488585-55488607 AAATATACTGATATTGTAATAGG - Intergenic
1149438762 17:56656951-56656973 AAAAATGATGCTTTTATTAAAGG + Intergenic
1150946013 17:69746368-69746390 AAATAGGATGATAATGTTGTAGG - Intergenic
1150989944 17:70245553-70245575 TAAAATGATGATAATGATAATGG - Intergenic
1151063867 17:71128582-71128604 AAAACTGATGATATTCTCCTCGG - Intergenic
1151335018 17:73434623-73434645 AAAAAAGATGATACTGTGAGTGG - Intronic
1152213612 17:79018930-79018952 AATAATGAAGATACTGGTATTGG - Intergenic
1154234664 18:12593453-12593475 AAAAAAGATGAGATTGTTAAAGG + Intronic
1155628027 18:27859139-27859161 AAAAATTATCATATTGTCAAAGG + Intergenic
1155697781 18:28703527-28703549 AAAACTCATGATGTTATTATAGG - Intergenic
1156207986 18:34906702-34906724 CAAAATGCTGATAGTGATATGGG - Intergenic
1156274330 18:35568498-35568520 CAAAATGAGGAAATTGATATTGG - Intergenic
1156525514 18:37764089-37764111 GAAAATGATCATATTTGTATAGG - Intergenic
1156760381 18:40582228-40582250 AACATTGATGATATTGTTACTGG + Intergenic
1156790421 18:40966005-40966027 ACACATGATGATTTAGTTATTGG - Intergenic
1157080772 18:44522723-44522745 CATAGGGATGATATTGTTATGGG - Intergenic
1157654653 18:49373130-49373152 AATAAAAATGATATTGTTACAGG + Intronic
1158169724 18:54584101-54584123 AAAAATGGGAATATTTTTATGGG + Intergenic
1158196903 18:54897567-54897589 CAAAATGATGATTTTTTCATGGG - Intergenic
1159095659 18:63898732-63898754 AAAAATGATTAAATTGTAATTGG + Intronic
1159527662 18:69613805-69613827 TATAATGAGGATATTTTTATAGG + Intronic
1159612512 18:70541827-70541849 AAGAATGATGGTATTTTGATGGG + Intergenic
1160082880 18:75746233-75746255 AACAATGATGATATTGGTTGTGG + Intergenic
1160368008 18:78345622-78345644 AAAAATGGTAAACTTGTTATAGG + Intergenic
1161762727 19:6186338-6186360 AAAAATTATGATATTCATATTGG - Intronic
1162250310 19:9437007-9437029 AAAGATTATGATCTTGATATTGG - Intergenic
1162645353 19:12045686-12045708 AAAAAAGATAATATTGATACAGG + Intronic
1162657977 19:12146401-12146423 AAGAAAGATAATATTGATATAGG + Intronic
1164025904 19:21352247-21352269 AAGAATGATGTTATTCTGATGGG + Intergenic
1164781014 19:30892871-30892893 AAAAAAGAGAATATTCTTATTGG + Intergenic
1167202713 19:48077548-48077570 AAAAATGATAGTATTTTGATAGG - Intronic
1167202837 19:48078824-48078846 AAAAATGATAGTATTTTGATGGG - Intronic
1167226964 19:48251513-48251535 AGAAATGGTGAAATTGGTATTGG - Intronic
1168363376 19:55762625-55762647 AGAAATGATGAGATAGTTGTTGG - Exonic
1168364331 19:55772629-55772651 AGAAATGATGAGATAGTTGTTGG - Exonic
1168431316 19:56283245-56283267 AATAATGATGATAATAGTATTGG - Intronic
1168702307 19:58448257-58448279 CAAAATGCTGATAATGATATGGG + Intergenic
925110656 2:1333399-1333421 AAGAATTATGATATTTTGATGGG - Intronic
925835039 2:7936240-7936262 ATAAATGAAGATATTTTCATGGG + Intergenic
926177840 2:10612350-10612372 AAAAATGATGGCATTTGTATTGG - Intronic
927331013 2:21864159-21864181 AACATTGTTGATATTGTTTTTGG - Intergenic
928305008 2:30162239-30162261 AAAAATGATGGAAATGTGATGGG + Intergenic
928363623 2:30685349-30685371 AAAAATGATGACATTTGCATTGG + Intergenic
928590986 2:32815034-32815056 CACAATGATGACATTGTTATAGG - Intronic
928711801 2:34015620-34015642 AAGAATGATGGTATTTTGATGGG - Intergenic
928713235 2:34031110-34031132 AAAAGTGCTTATATTATTATAGG - Intergenic
928720014 2:34109535-34109557 AAATATGATGACATTGATAAAGG - Intergenic
929229493 2:39544755-39544777 AAGAATGAAGATATTCTAATTGG + Intergenic
929545170 2:42850990-42851012 AGAAATGAAAATATTGTCATGGG + Intergenic
930335593 2:50041293-50041315 AAAAACTATGATTTTTTTATAGG - Intronic
930540514 2:52700411-52700433 AAAAATGAAAATATTTTCATGGG + Intergenic
930939890 2:57000050-57000072 CAAAATGCTGATAGTGATATGGG - Intergenic
930952243 2:57156868-57156890 AAAAATGCTGATAGAGATATGGG - Intergenic
931002218 2:57798483-57798505 AGAAATGATAATATATTTATAGG + Intergenic
931598114 2:63972975-63972997 AAAGATAATGACATTGTTAGTGG - Intronic
932505177 2:72222392-72222414 TATAATGATTATATTTTTATAGG + Intronic
933130605 2:78668686-78668708 AAAAATGATGTTAGTTTGATAGG - Intergenic
933296735 2:80499378-80499400 AAAAATGTTCATATTTTCATGGG + Intronic
933386788 2:81621014-81621036 AAAAATGATGAATTTGTCAATGG - Intergenic
933411642 2:81933141-81933163 AAAAATTATGATATAGTATTTGG - Intergenic
933553038 2:83798550-83798572 AAAAAAAATGAAATTTTTATAGG + Intergenic
934197065 2:89846499-89846521 CAAAATAATGATTTTGTTTTGGG - Intergenic
934760863 2:96856142-96856164 AAAAATGAGGAAATTGTTTGCGG + Intronic
935886385 2:107624043-107624065 ATAAATGAGCATATTGTTAGTGG - Intergenic
936776449 2:115979787-115979809 AATGATGCTGATATTTTTATGGG + Intergenic
936850889 2:116896334-116896356 AAAAATGCTGATAGTGATATAGG - Intergenic
936902546 2:117498744-117498766 GAAAAAGATGATATCTTTATAGG - Intergenic
936940785 2:117882293-117882315 CAAAATGCTGATAGTGATATGGG + Intergenic
936980990 2:118265162-118265184 AATAATGATGCTGTTTTTATGGG + Intergenic
937793583 2:125989534-125989556 AATGATGATGATATTTTGATGGG + Intergenic
938510045 2:131931919-131931941 AAAAAGGGAGGTATTGTTATTGG - Intergenic
939708939 2:145490873-145490895 AAAAAAAATGAAATTGTTCTGGG - Intergenic
939789687 2:146556418-146556440 GTAAATGATTATATTGCTATTGG + Intergenic
939811346 2:146836586-146836608 AAAAAAAATCAAATTGTTATTGG + Intergenic
939862242 2:147434270-147434292 AAAAATGATGAATTTGGTCTAGG - Intergenic
940125913 2:150324150-150324172 AAGAATGATGGTATTCTGATGGG + Intergenic
940170614 2:150826071-150826093 TTAAATGATTATATTGTTAGCGG + Intergenic
940288836 2:152058427-152058449 CAAAATGCTGATAGTGATATGGG + Intronic
940386332 2:153077286-153077308 AAAAAAAATGGTATTTTTATTGG + Intergenic
940613063 2:156014626-156014648 AAAAATGATGTAATTTTTTTTGG - Intergenic
940784276 2:157965560-157965582 AAGAACGATGGTATTTTTATGGG + Intronic
940802628 2:158149864-158149886 AAGAATGATGGTATTTTGATGGG - Intergenic
941329040 2:164154459-164154481 AAAATAAATGATATTGTTTTTGG + Intergenic
941373260 2:164694573-164694595 AAAACTGATGATGATGTCATCGG - Exonic
941419411 2:165263750-165263772 AATAATGGTGGTATTTTTATGGG + Intronic
941578647 2:167267894-167267916 CAAAATGCTGATAATGATATGGG + Intergenic
941757175 2:169199799-169199821 AATAATGTTGAAATTATTATAGG + Intronic
942060818 2:172227202-172227224 AAAAACAATGATAAAGTTATTGG - Intergenic
942338995 2:174923124-174923146 AAAAAAAATTATATTGTTAAAGG - Intronic
942628526 2:177930137-177930159 AAATATAATGATATTGTGAGAGG - Intronic
942929749 2:181475439-181475461 AAAAATAATGCTATTGCAATTGG - Intronic
943069839 2:183127566-183127588 AATAATGATGAACTTTTTATGGG + Intronic
943127863 2:183818199-183818221 AATGATGATGGTATTTTTATGGG + Intergenic
943224602 2:185154542-185154564 AAAAATTATGATATTTCTCTTGG + Intergenic
943304904 2:186248964-186248986 AAAAAGGAGTATATTGTGATTGG + Intergenic
943447110 2:188000630-188000652 AAAAGTGCTGATATTTTGATAGG - Intergenic
943668954 2:190640104-190640126 AGAAATGCTCATAATGTTATGGG - Intergenic
943686707 2:190825838-190825860 AAAAATGAAGGTAGTATTATGGG + Intergenic
943862438 2:192885372-192885394 AAAAATGTTGATAATTTAATAGG - Intergenic
944438683 2:199719559-199719581 AAAAATGATGGTAATTTGATAGG + Intergenic
944508026 2:200434801-200434823 AAATATGATGAGATTTTCATTGG - Intronic
944561698 2:200945568-200945590 AAAAATTATGATATTATTTGTGG + Intronic
944603377 2:201326778-201326800 AATAATGTTGATATTTTGATGGG - Intronic
944704614 2:202276350-202276372 AAAAAAGATGACACTGTTTTAGG + Intronic
944745055 2:202646745-202646767 AATAATGATGATATCCTTAGGGG - Intronic
944748165 2:202679031-202679053 TATTATTATGATATTGTTATAGG - Intronic
945147245 2:206751553-206751575 CAAAATGAGGATATTGTAAGAGG + Intronic
945315649 2:208368239-208368261 GAAAATGATGGGATTGTTGTGGG + Intronic
945460988 2:210108269-210108291 AAACATAATGATATTCTTAAAGG + Intronic
945515967 2:210763542-210763564 CAAAATGCTGATAGTGATATGGG - Intergenic
946928224 2:224646781-224646803 GAAAATGATTTTCTTGTTATCGG - Intergenic
947443079 2:230140392-230140414 CAAAATGCTGATAGTGATATGGG + Intergenic
948303343 2:236926204-236926226 AACAATGAAAATATTTTTATGGG - Intergenic
1169858170 20:10125591-10125613 AATAATGATGATACATTTATTGG - Intergenic
1170477990 20:16735543-16735565 AAAGAAGATGGTAATGTTATTGG - Intronic
1170720659 20:18875230-18875252 AAGAATGATGGTATTTTCATGGG + Intergenic
1170865731 20:20154878-20154900 AATGATGATGGTATTTTTATGGG - Intronic
1171748897 20:29028082-29028104 AACAATAATGATATGGTTTTAGG + Intergenic
1173218109 20:41106435-41106457 AAAACTGTTGAGATTTTTATTGG + Intronic
1174022932 20:47546127-47546149 GAAAATGATGAGATTGGTTTGGG - Intronic
1174682963 20:52425651-52425673 AAAAATACTGATATTCTTCTTGG - Intergenic
1174775094 20:53335980-53336002 AAAACTGATGAAAATATTATAGG - Intronic
1174844534 20:53930414-53930436 AAATATGATGAAACTGTTAGTGG - Intergenic
1175501236 20:59452713-59452735 GAAAATGATGAGATTGGTGTGGG + Intergenic
1175564955 20:59966990-59967012 AAAAAAAATAATAATGTTATGGG + Intronic
1175596839 20:60241400-60241422 TAAAATGAAGAAATTGTTACGGG + Intergenic
1175596936 20:60242812-60242834 TAAAATGATCATCTTGATATTGG + Intergenic
1175655583 20:60766978-60767000 AGAAATGTGGATATTGTTAATGG - Intergenic
1176657789 21:9603282-9603304 CAAAATGCTGATAATGATATGGG - Intergenic
1176884870 21:14243554-14243576 AATATTGAGGATATTGTTATTGG + Intergenic
1177394180 21:20511550-20511572 TAAAATGCTGATAGTGATATGGG - Intergenic
1177512259 21:22103748-22103770 AAAAATTATGGTATTTTGATGGG + Intergenic
1177581424 21:23027519-23027541 AAAAATGTTTGTATTGTTTTTGG + Intergenic
1177604195 21:23357632-23357654 AAAAGTGATGAGATTGTGCTTGG - Intergenic
1177628697 21:23699757-23699779 CAAAATGCTGATAGTGATATGGG + Intergenic
1177907433 21:26988966-26988988 AAAAATGAAGAACATGTTATTGG - Intergenic
1178009084 21:28262043-28262065 AGATATTATGATATTGCTATAGG - Intergenic
1178061607 21:28859112-28859134 AATAATGAAGATAATATTATAGG - Intergenic
1178105499 21:29314670-29314692 AAAAATGATGACATTGTTAGAGG - Intronic
1179402729 21:41099097-41099119 AGAAATGAGGATCTTGTTATCGG - Intergenic
1179777956 21:43679670-43679692 AATGATGATGGTATTTTTATGGG + Intronic
1181657541 22:24316086-24316108 AAGAATAAGGATGTTGTTATAGG - Intronic
1182653812 22:31873773-31873795 AAAAAAGAAGAAGTTGTTATGGG - Intronic
1182680778 22:32077965-32077987 AAATATGAAAATATTGGTATTGG - Intronic
1183212415 22:36459044-36459066 AAAAATGACCATATCCTTATAGG + Intergenic
1183257827 22:36774257-36774279 ATAAATGATAATATTTTTAATGG - Intronic
949115573 3:317192-317214 AAAAGTGATGATGTCATTATGGG + Intronic
949149859 3:753572-753594 AAGAATGATGGTATTTTGATAGG + Intergenic
949328936 3:2899867-2899889 AACAATGATGATAGTCTTAAAGG + Intronic
950849197 3:16045877-16045899 AAAAATGCTGATAATGTATTTGG - Intergenic
950972369 3:17202083-17202105 CAAAATGCTGATAGTGATATAGG + Intronic
951031605 3:17888298-17888320 AAAATTAAAGATATTTTTATTGG - Intronic
951517401 3:23576398-23576420 AAACATAATTATTTTGTTATTGG - Intronic
952177535 3:30881703-30881725 AAAAATGATAAATTTGTTAAGGG + Intronic
952732866 3:36657785-36657807 AAAAATGATGGTATTTTGATGGG - Intergenic
954478807 3:50777449-50777471 AATGATGATGATATTTTGATGGG + Intronic
955099146 3:55830465-55830487 AAAAATGATAATATTGTCTTGGG + Intronic
955149310 3:56351082-56351104 AAAAAGGATGATACTATTAATGG + Intronic
955150150 3:56359131-56359153 AGGCATGATGATATTGTGATGGG - Intronic
955241668 3:57183417-57183439 AAAAATAGTGCTATTGCTATGGG - Intergenic
955885559 3:63594741-63594763 GATAATGATGATAGTGTTAATGG - Intronic
956199098 3:66687826-66687848 AAAAATAATTATTTTGTTGTAGG + Intergenic
956209045 3:66784540-66784562 AAAAGTGAGGAAAATGTTATTGG - Intergenic
956686160 3:71829910-71829932 AAACAAGATGATATTGTTGCTGG - Intergenic
957270572 3:78025157-78025179 AAAAATGATCATTTTGCTGTAGG + Intergenic
957337437 3:78849403-78849425 AAAAATGGTCAAATTTTTATAGG + Intronic
957355498 3:79080056-79080078 AAACAAGATGATAATGTTAGTGG + Intronic
957418124 3:79931943-79931965 AAATATGTTGAAAGTGTTATAGG - Intergenic
957954449 3:87166398-87166420 AAAACTGCTGAGATTGTTACAGG + Intergenic
958137192 3:89509908-89509930 AAATATAATGATTTTCTTATTGG + Intergenic
958152470 3:89708196-89708218 AATGATGATGATATTTTGATTGG - Intergenic
958175210 3:89988865-89988887 CAAAATGCTGATAGTGATATGGG + Intergenic
958266576 3:91444725-91444747 AAAAAAGATGATTTTGTAACAGG + Intergenic
959124169 3:102270245-102270267 TATAATGCTGATAATGTTATTGG + Intronic
959188035 3:103072171-103072193 AAAAATTATTTTATTATTATTGG + Intergenic
959188037 3:103072237-103072259 AAAAATTATTTTATTATTATTGG + Intergenic
959188039 3:103072301-103072323 AAAAATTATTTTATTATTATTGG + Intergenic
959229615 3:103631667-103631689 CAAAATGCTGATAGTGATATGGG + Intergenic
959666121 3:108923688-108923710 AAAAATGGTGGTATTTTGATGGG + Intronic
960128767 3:114029990-114030012 AAAACTGGTGATATTCTCATAGG + Intronic
960264432 3:115604162-115604184 AAAACTAATGAAATTATTATTGG + Intergenic
960285427 3:115823095-115823117 AAAAATGCTTAAATTGTCATTGG + Intronic
960711993 3:120539790-120539812 AATGATGATGGTATTTTTATGGG + Intergenic
961264348 3:125628903-125628925 AAGAATGATGGTATTTTGATGGG + Intergenic
961425748 3:126846151-126846173 AAAAATAATGACATTTTTCTGGG - Intronic
961872018 3:129995567-129995589 AAAAATGATGATAAGCTTAAGGG - Intergenic
962213361 3:133498295-133498317 CAAAATGTTGAGATTGTAATTGG - Intergenic
962946354 3:140174337-140174359 CAAAATGCTGATAGTGATATGGG - Intronic
963023230 3:140892808-140892830 AATGATGATGGTATTTTTATGGG + Intergenic
963181841 3:142365907-142365929 AAAATTCATGGTATTGTCATAGG - Intronic
963365632 3:144330621-144330643 GAAAAAGAAGACATTGTTATTGG + Intergenic
963408486 3:144899995-144900017 AAAAATTTTTAAATTGTTATGGG + Intergenic
963539566 3:146567790-146567812 CAAAATGATGATAGTGATATGGG - Intergenic
963823315 3:149923794-149923816 AAAAATGGTGATACTGTCCTGGG + Intronic
964006031 3:151830177-151830199 AATAATGATGGTATTTTGATGGG - Intergenic
964080244 3:152745545-152745567 AAAAATGCTGATATTCTGAAGGG - Intergenic
964219445 3:154326967-154326989 GAAAATGGTGAGAGTGTTATGGG + Intergenic
964332074 3:155614251-155614273 AAAAATGATGGTATTTTGATGGG - Intronic
965060682 3:163781800-163781822 AAGAACGATGATATTTTGATGGG + Intergenic
966546513 3:181155422-181155444 AAAAAAGATAACATTATTATTGG + Intergenic
966741890 3:183241868-183241890 CAAAATGCTGATAGTGATATGGG + Intronic
966969288 3:185028017-185028039 AAAAATGGAAATATTTTTATTGG - Intronic
967443846 3:189541654-189541676 AAAAATTAAGATTATGTTATAGG + Intergenic
967650927 3:191985586-191985608 CAAAATGATAATATATTTATTGG - Intergenic
967727720 3:192877455-192877477 AAAAATTCAGATATTGTTAAAGG - Intronic
969152176 4:5178814-5178836 CAAAATGCTGATAGTGATATGGG - Intronic
970197362 4:13565129-13565151 AAAATTAATGATATTCTTAATGG - Intergenic
970344116 4:15136635-15136657 CAAAATGCTGATAGTGATATGGG - Intergenic
970352498 4:15217074-15217096 GGAAATAATGATATTTTTATAGG + Intergenic
970505138 4:16721503-16721525 AAAAATGATGCTAATTTTAATGG - Intronic
970659329 4:18266179-18266201 CAAAATGCTGATAGTGATATTGG - Intergenic
970698613 4:18708698-18708720 AGAAATGAGGAAGTTGTTATCGG - Intergenic
971052704 4:22879106-22879128 AAAGACAATGATATTGTTCTTGG + Intergenic
971080687 4:23207414-23207436 AATGATGATGATATTTTGATGGG + Intergenic
971112883 4:23608859-23608881 AAAGAAGTTGATATTTTTATTGG - Intergenic
971445961 4:26749071-26749093 AAAAAAGATGAAATAGTTTTTGG - Intronic
971533179 4:27715048-27715070 AAAAATGATTAAATTGGTAAAGG + Intergenic
971546205 4:27890522-27890544 CAAAATGTTGATAGTGATATGGG + Intergenic
971879103 4:32345646-32345668 AAAAATAATGAGATAGATATAGG + Intergenic
972087478 4:35237873-35237895 AAAGATGATGATGTTATTACTGG - Intergenic
972616938 4:40707983-40708005 GAAATAGATGATATTTTTATAGG - Intergenic
972978967 4:44672292-44672314 AAAAATGAGGATCATTTTATTGG + Intronic
973542180 4:51945708-51945730 CAAAATGCTGATAGTGATATGGG + Intergenic
973589082 4:52422197-52422219 ACAAATGCTGAAATTGTGATTGG - Intergenic
974471084 4:62318622-62318644 AAAACTGTTGATTTTTTTATAGG + Intergenic
974533936 4:63150143-63150165 AATGATGATGATATTTTGATGGG + Intergenic
974676660 4:65099330-65099352 ACAAATGGTGATATTTATATTGG - Intergenic
974702562 4:65470919-65470941 CAAAATTCAGATATTGTTATAGG - Intronic
974816250 4:67007634-67007656 TAAAGTGATGATATTTTGATTGG - Intergenic
975155888 4:71072616-71072638 AATTATGTTGATATTTTTATTGG + Intergenic
975267811 4:72391785-72391807 AATATTGAAAATATTGTTATTGG + Intronic
975620503 4:76291538-76291560 AAAAAAGTAGATATTGATATTGG - Intronic
977378230 4:96236707-96236729 CAAAATGCTGATAGTGATATGGG + Intergenic
977576565 4:98681221-98681243 AAAAATGAAGGCATTGTTATGGG + Intergenic
977865351 4:102019185-102019207 AAAAATAATCACATTTTTATTGG - Intronic
977936039 4:102805653-102805675 AAAAATGCTGGTATTCTTATAGG + Intronic
978044381 4:104107961-104107983 AAAAATGATGGTATTTTGATAGG - Intergenic
978835683 4:113146981-113147003 AGAAATGATGACATTGTTTCAGG - Intronic
978948008 4:114522411-114522433 AATAATGATGATATTTTGATGGG + Intergenic
979043270 4:115828006-115828028 AAAAATGCTGATATTTTAATTGG - Intergenic
979051718 4:115943539-115943561 GAAAATGATTATATTGTGACAGG - Intergenic
979101999 4:116629695-116629717 AAAAATGGTGAATTTTTTATTGG - Intergenic
979184171 4:117767541-117767563 AAAAATGAAGATATTGGTACTGG - Intergenic
979263676 4:118676670-118676692 AAAAATTATGGTATTTGTATTGG + Intergenic
979326555 4:119386533-119386555 AAGAGTGATGATATTTTGATAGG + Intergenic
979506638 4:121504622-121504644 AATAATGATGGTATTTTGATGGG + Intergenic
979541247 4:121885773-121885795 AAAAAAGATGAATCTGTTATTGG - Intronic
979682022 4:123471443-123471465 AAAAATAATGATTTTATTTTAGG - Intergenic
979748941 4:124252111-124252133 ACAAATTATGTTATTGCTATGGG + Intergenic
980049534 4:128025176-128025198 AAAAAAGTTCATATTTTTATTGG - Intronic
980785473 4:137548519-137548541 ACAAATGATCATATTAATATAGG - Intergenic
980840064 4:138248169-138248191 AAAAATGTTTATATTTTTAAAGG - Intergenic
981048031 4:140283442-140283464 AAAAATGCTTGTAGTGTTATAGG - Intronic
981167226 4:141575397-141575419 AAGAAGGTTGATATTATTATAGG - Intergenic
981177360 4:141697547-141697569 AATAATGATGGTATTTTGATGGG + Intronic
981343249 4:143647051-143647073 TAAAATGTTGATAGTGATATGGG + Intronic
981487210 4:145300083-145300105 AAAGATGATGATGTTTTTGTTGG - Intergenic
981491526 4:145345493-145345515 AATCATGATGATATTCTTAGAGG - Intergenic
981629010 4:146796243-146796265 AAAACTAATGAAATTATTATGGG - Intronic
981666115 4:147228884-147228906 AAAAATCATAATATTCTAATGGG + Intergenic
981842887 4:149132918-149132940 TAAAATGCTGATAGTGATATGGG + Intergenic
982293131 4:153799395-153799417 AAAAATGTTGTTACTGTTGTTGG + Intergenic
982424615 4:155243900-155243922 AAAACTGATGAATTTGTTAAAGG - Intergenic
982596205 4:157387519-157387541 AAAAATAATTATACTGTCATTGG - Intergenic
982645331 4:158016924-158016946 AAAAATGATGACATAATTTTTGG - Intergenic
982686120 4:158491354-158491376 ACTAATTATGATATTGGTATGGG + Intronic
982857571 4:160404870-160404892 AAAAATGAGGGGATTGTTAATGG - Intergenic
983006153 4:162487505-162487527 AAAAAAGATGAAATTGTATTAGG - Intergenic
983013244 4:162576610-162576632 AAAAATGTTGATAGTGGTAGAGG + Intergenic
983119008 4:163857174-163857196 AGAAAAGAACATATTGTTATTGG - Intronic
983277844 4:165640146-165640168 AAGAATGATGGTATTTTGATGGG - Intergenic
983320427 4:166190070-166190092 GAAAATGCTGATAATGATATGGG + Intergenic
983329937 4:166312820-166312842 AAAAATGCTGTTATTTTTATCGG - Intergenic
983340302 4:166452848-166452870 AAAAATTAAGACATTTTTATTGG - Intergenic
983395265 4:167186037-167186059 AAAGTAGATGATATTGATATTGG + Intronic
983536624 4:168864044-168864066 AAATATGATGAAATTGTTAAAGG - Intronic
983554941 4:169051520-169051542 AGAAAGGATGATAATGTAATTGG - Intergenic
983569649 4:169191498-169191520 AATAATGATGGTATTTTGATGGG - Intronic
983660360 4:170125563-170125585 TAAAATGCTGATAATGATATTGG + Intergenic
983766276 4:171488843-171488865 CAAAATGCTGATAGTGATATGGG + Intergenic
983976203 4:173937122-173937144 AAAAATGATGAAAGAGTTATGGG - Intergenic
984273005 4:177571000-177571022 ATAAATTATGATTTTGATATGGG + Intergenic
984520290 4:180794466-180794488 AAAAATGATGTAATTTTAATAGG - Intergenic
984722101 4:182982823-182982845 AATGATGATGATATTTTGATGGG - Intergenic
984937864 4:184905026-184905048 AAAAAGAATGAAATTGTAATGGG + Intergenic
985027582 4:185753569-185753591 AAAAAAGATAATTTTGTTTTGGG + Intronic
985417621 4:189752804-189752826 CAAAATGCTGATAATGATATGGG + Intergenic
985428922 4:189858789-189858811 AAATAGGATCATATTGTTACTGG - Intergenic
986160104 5:5219848-5219870 ACTGATGATGATATTGTTAAAGG - Intronic
987804544 5:22746302-22746324 AAAATTGTTGTTATTGTTGTGGG - Intronic
987859048 5:23460216-23460238 AAAAATATTAAAATTGTTATAGG - Intergenic
987984352 5:25126888-25126910 ACAAATGATAATATTGTGATGGG + Intergenic
988135593 5:27166525-27166547 AAAAATGATGCCATTGCTTTTGG - Intergenic
988268671 5:28985725-28985747 GCAAATGATGAGATGGTTATTGG - Intergenic
988300306 5:29416505-29416527 AAAATTTATGATATTGGTCTTGG + Intergenic
988344966 5:30025292-30025314 AACAATGATGGTATTTTGATGGG - Intergenic
988401919 5:30773721-30773743 AAAAATGATGGAATTTTGATTGG + Intergenic
989711163 5:44399138-44399160 AAAAATGATGAAAATGAAATTGG - Intergenic
990108844 5:52297651-52297673 AAAAGTGATTATATTTGTATAGG + Intergenic
990385320 5:55254831-55254853 AAAAAGAATGATATTTTTAAAGG - Intergenic
990484143 5:56241635-56241657 CAAAATGCTGATAGTGATATGGG + Intergenic
990712457 5:58600376-58600398 AATAATGGTGATATTTTTATGGG + Intronic
990935593 5:61145325-61145347 AACAATGATGAGCTTGTTAAAGG + Intronic
991593567 5:68279282-68279304 AAAAATAATGCCTTTGTTATGGG - Intronic
991917591 5:71620380-71620402 AAAAATTATTATATTTTTAATGG + Intronic
991924252 5:71688518-71688540 AAGAATGATGGTATTTTGATGGG - Intergenic
992183742 5:74223461-74223483 AAAAATTTTGATATAGCTATAGG - Intergenic
992384127 5:76267411-76267433 AAAAATCATCATATTGTACTTGG - Intronic
992688885 5:79224060-79224082 AGAAATGCTGTTATTGTTCTAGG + Intronic
993001036 5:82380593-82380615 CAAAATGCTGATAATGATATGGG - Intronic
993198813 5:84785452-84785474 ACAAATGATAATATTGTTACTGG + Intergenic
993507656 5:88730982-88731004 TAAGATGAAGATAATGTTATGGG - Intronic
993562138 5:89423217-89423239 AATGATGATGGTATTTTTATTGG - Intergenic
993636484 5:90350736-90350758 AAAAATGATTATATAATTTTTGG + Intergenic
993828830 5:92727883-92727905 AAAAATGATGCTTTGGTCATAGG + Intergenic
994283608 5:97937540-97937562 CAAAATGCTGATAGTGATATGGG + Intergenic
994442845 5:99831977-99831999 AAAATTCATAATATGGTTATAGG - Intergenic
994468612 5:100171938-100171960 AAGAATGATGATATTGTTAAAGG + Intergenic
994563457 5:101408758-101408780 AAAAATGATGGTATTTTGATGGG - Intergenic
994636411 5:102349951-102349973 AATAATGATGGTATTTTGATGGG - Intergenic
994679568 5:102868725-102868747 TAAAATAATGATATTCTTGTGGG - Intronic
994762100 5:103867204-103867226 TAAAATGAAGTTATTTTTATGGG - Intergenic
995187547 5:109287936-109287958 AAAAATGTTGGTATTTTAATAGG - Intergenic
995591386 5:113703947-113703969 CAAAATGAAGATATTGAAATGGG - Intergenic
996271571 5:121611227-121611249 AATAATGGTGGTATTGTGATGGG + Intergenic
996326644 5:122282300-122282322 AATAATGATGGTATTTTGATAGG + Intergenic
996427134 5:123326158-123326180 AATGATGATGGTATTTTTATGGG + Intergenic
996580907 5:125031165-125031187 AAATATGATGTTACTGTTACAGG - Intergenic
996779307 5:127167970-127167992 AAATCTGATTATATTCTTATTGG - Intergenic
996990227 5:129621118-129621140 AAAAGTGAAGATTTTGTTAGAGG - Intronic
997058487 5:130472942-130472964 AATGATGATGATATTTTGATGGG + Intergenic
998613676 5:143716580-143716602 AAAAATGATCATTTTGTTTTAGG + Intergenic
1000365824 5:160490023-160490045 AAAAATGATCTTTTTGCTATAGG - Intergenic
1000396541 5:160780945-160780967 GAAAATGATGAAATTGTCAAAGG + Intronic
1000442145 5:161276757-161276779 AGAAATTATGAAATTGGTATTGG + Intergenic
1000497938 5:162009335-162009357 AATAACGATGGTATTGTGATGGG + Intergenic
1000772311 5:165370589-165370611 AAAAATGATGGTAGAATTATTGG - Intergenic
1003203568 6:3986879-3986901 AATAAAGATGATTTTGGTATAGG - Intergenic
1003768646 6:9270797-9270819 AAAAATGATGATATGTCTACTGG + Intergenic
1005179390 6:23087294-23087316 AATAATGTTGAAATTTTTATGGG + Intergenic
1006097967 6:31667817-31667839 AAAGATGAGGATTTTGATATGGG + Intronic
1006657132 6:35605370-35605392 AAAAAAAAAGATATTGTCATAGG - Intronic
1006667283 6:35704695-35704717 AAAAAAAATCATATTGTCATTGG - Intronic
1007529166 6:42525687-42525709 CAAAATGTTAATATTGTTGTTGG - Intergenic
1007541387 6:42648644-42648666 AAAAATGAATACATTGTCATTGG - Intronic
1007639238 6:43324048-43324070 AAAAATCTTGAAATTGTGATAGG - Intronic
1008432764 6:51438569-51438591 ATAAAAGATGACATTTTTATAGG + Intergenic
1008988638 6:57576896-57576918 AAAAAAGATGATTTTGTAACAGG - Intronic
1009177240 6:60475455-60475477 AAAAAAGATGATTTTGTAACAGG - Intergenic
1009405393 6:63306099-63306121 TAAAATGTTAATATTTTTATAGG - Intronic
1009485016 6:64210498-64210520 CAAAATGATGCTATTAGTATGGG - Intronic
1009638849 6:66303880-66303902 AAAATTGCTGATAATATTATAGG + Intergenic
1009732082 6:67621728-67621750 AAAAATACTGATAATGATATGGG + Intergenic
1010134174 6:72531223-72531245 CAAAATGCTGATATTGTAACTGG + Intergenic
1010200596 6:73278593-73278615 ACAAATGTTGATGTTTTTATGGG + Intronic
1010429994 6:75767903-75767925 AAAAATGGTGAAAGTGTTTTGGG - Intronic
1010631899 6:78208182-78208204 CAAAATGCTGATAGTGATATGGG - Intergenic
1010738968 6:79476998-79477020 AAACATGATGAATTTGTTGTGGG - Intergenic
1011013398 6:82727233-82727255 AAAAATGATGATTCAGTTCTGGG + Intergenic
1011135098 6:84091691-84091713 AAAAATGATGATATAGTCATGGG - Intergenic
1011565922 6:88671557-88671579 AATGATGATGGTATTTTTATGGG - Intronic
1011568114 6:88702169-88702191 AAAAATGATGGTAGTTTGATAGG - Intronic
1011575563 6:88794221-88794243 AAAACTCATGTTATTGTTTTAGG + Intronic
1011607865 6:89121726-89121748 AAAAATGAGGCTTTTGTTATGGG - Intergenic
1011660479 6:89590061-89590083 AAAAATGATAATAGTTGTATTGG + Intronic
1012186654 6:96225304-96225326 AAAAATGATTATATAGGTTTTGG - Intergenic
1012357157 6:98328951-98328973 AATGATGATGATATTTTGATGGG + Intergenic
1012378715 6:98593367-98593389 AAATAGGATGTTATTTTTATGGG + Intergenic
1012579925 6:100854786-100854808 CAAAATGATGGTTTTATTATAGG - Intronic
1012633357 6:101502132-101502154 AAAATTAATGAAATTGATATAGG + Intronic
1013381462 6:109576207-109576229 AATAATGATGGTATTTTGATGGG + Intronic
1013890608 6:115021850-115021872 CAAAATGCTGATAATGATATGGG - Intergenic
1014061469 6:117076900-117076922 AACAATGATGACATTTTTAATGG - Intergenic
1014591998 6:123285145-123285167 AATAATGATGGTATTTTGATGGG - Intronic
1014658575 6:124137463-124137485 AATAATGATGGTATTTTGATAGG - Intronic
1014700503 6:124681326-124681348 AAAGAAGATGATATTCTTAGTGG - Intronic
1014880644 6:126720134-126720156 AAAGATGAAGATAGGGTTATAGG - Intergenic
1015182504 6:130375835-130375857 TGTAATGATGATATTGGTATTGG + Intronic
1015398116 6:132757980-132758002 AAAAATGATGATAAAGTAAAAGG - Exonic
1016009808 6:139127592-139127614 AAATATGCTGTAATTGTTATAGG - Intergenic
1016156812 6:140820858-140820880 AAAAATGATAATATTGACCTAGG + Intergenic
1017148325 6:151255106-151255128 AAAAATGAAGTTACAGTTATAGG + Intronic
1018103372 6:160461090-160461112 AAAAATAATTATATTATTTTAGG - Intergenic
1018622615 6:165746229-165746251 AAAAATGAACAAATTGTTTTTGG - Intronic
1018780591 6:167060581-167060603 AAAAATGAATATTTTGTTTTTGG - Intergenic
1019098759 6:169610087-169610109 CAAAATGCTGATAGTGATATGGG - Intronic
1019865177 7:3701746-3701768 AAAAACTGTGATATTGTTGTAGG + Intronic
1020865339 7:13553869-13553891 AAAAATTATGGTAATTTTATTGG + Intergenic
1020950676 7:14672587-14672609 AATAATGAAGTTATTCTTATGGG - Intronic
1021226184 7:18029149-18029171 AAAAATGATGATTTGGTTTTAGG - Intergenic
1021330729 7:19335899-19335921 AAAATTGAGAATATTGTCATTGG - Intergenic
1021912919 7:25404446-25404468 ATAAATGATGATATTATCAATGG - Intergenic
1022201021 7:28117590-28117612 GATAATGATGAAATTTTTATTGG - Intronic
1022564385 7:31383150-31383172 AAAAATGTTGGTATTGTTCATGG + Intergenic
1023677074 7:42642109-42642131 AAGAATAATGATATAGTTTTGGG - Intergenic
1024616307 7:51116511-51116533 AAAAATTATAATATTGTCTTTGG - Intronic
1024663841 7:51525985-51526007 AAAAATATTGATATTTTCATAGG - Intergenic
1024749831 7:52452624-52452646 AGAGATAATGATATTGTTCTGGG + Intergenic
1025069563 7:55887105-55887127 TATAATGATGATGATGTTATTGG - Intergenic
1025773661 7:64538188-64538210 AAAAAACATGACATTGGTATTGG + Intronic
1026113262 7:67475336-67475358 AAAAATGATGATGATGTTCATGG + Intergenic
1026453661 7:70552390-70552412 AAACATGCTGATTTTGTTACAGG - Intronic
1027333917 7:77127960-77127982 AGAAATGATAATATAGTCATTGG - Intronic
1028360360 7:89960215-89960237 AAAAATGGTAATAATCTTATGGG - Intergenic
1028928601 7:96387985-96388007 AAATATGATGATATTGAAAAGGG - Intergenic
1028968640 7:96831316-96831338 ACAGATGAGGATATTTTTATGGG - Intergenic
1029096971 7:98093655-98093677 ATACAAGAGGATATTGTTATTGG + Intergenic
1029200055 7:98833413-98833435 AATAATGATGATAATGATGTTGG - Intergenic
1030416840 7:109255283-109255305 AAAAATGATGATTTTATTGTTGG - Intergenic
1030660611 7:112214966-112214988 AAAAATGATGTTGATATTATTGG + Intronic
1030664890 7:112265678-112265700 AAAAATCATCATAATGTTAATGG + Intronic
1030763009 7:113374340-113374362 TAAAAATATGATATTGTCATTGG - Intergenic
1030897789 7:115083435-115083457 AAACATGATTCTATTGCTATAGG - Intergenic
1031109153 7:117584706-117584728 AATTATGATGATATTTTGATGGG + Intronic
1031226421 7:119043281-119043303 AAAAATCATGATAATTATATTGG - Intergenic
1031241999 7:119257794-119257816 AAAAATGTTGGTATTGTTATGGG + Intergenic
1031287355 7:119886618-119886640 CAAAATGCTGATAGTGATATGGG - Intergenic
1031904741 7:127447734-127447756 AAAAATAATAATATTATTATAGG + Intergenic
1032337207 7:131036521-131036543 AAGAGTAATGATATTCTTATGGG - Intergenic
1032449212 7:132014560-132014582 AAGAATGATGATATTTTGATGGG + Intergenic
1032660239 7:133975255-133975277 ATAAATGATGACACTGATATGGG + Intronic
1033018449 7:137696725-137696747 AAAAATAATCATGCTGTTATGGG + Intronic
1033161506 7:139001174-139001196 AAAAATAATGATAGTGTCAGAGG + Intergenic
1033662896 7:143414934-143414956 GGAAATGATGATAATGTTGTTGG + Intergenic
1033669139 7:143473141-143473163 AAAATTGTTGATAGTTTTATGGG - Intergenic
1033803124 7:144924309-144924331 AAAAATTATCATATAATTATGGG - Intergenic
1033864411 7:145671408-145671430 AATAATAATAAAATTGTTATAGG + Intergenic
1034354235 7:150439205-150439227 TAAAAAGATGATATTGTATTAGG + Intergenic
1034510823 7:151533198-151533220 CAAAATGCTGATAATGATATGGG - Intergenic
1034828685 7:154290205-154290227 GAAAATGATCAAATTGTAATTGG + Intronic
1034940921 7:155229672-155229694 AAAGATGATGAGATTTTAATGGG - Intergenic
1035090477 7:156306004-156306026 AAAAATGAAAAAATTGTTAGTGG - Intergenic
1037031394 8:14110495-14110517 AAAAATGATTATTTTTATATTGG - Intronic
1037184934 8:16051223-16051245 AAAAATGATGATTTTTTTTAAGG - Intergenic
1037233121 8:16684487-16684509 AAAACTGGTGCTATAGTTATTGG - Intergenic
1037375496 8:18223046-18223068 ATATATGATGACATTTTTATAGG - Exonic
1038370049 8:26979902-26979924 ATGAATGTTGATTTTGTTATAGG - Intergenic
1038712407 8:29959988-29960010 AAAAATAATTATCTTGTTCTTGG + Intergenic
1039345085 8:36694462-36694484 AAAAAACATGATATTCTTAGGGG + Intergenic
1039743264 8:40401312-40401334 AAAAAGGATGAAATTGATAGAGG - Intergenic
1039822938 8:41149821-41149843 ACAAATGATGATAGTGGAATAGG + Intergenic
1040656153 8:49511277-49511299 AAAAATCATGATAATCTTATAGG + Intergenic
1040938726 8:52810586-52810608 AAAAATCATAACATTGTTCTTGG - Intergenic
1041057295 8:53999575-53999597 AAAATTGATGATATGGATAAAGG + Intronic
1041169304 8:55124837-55124859 AAAAATGAGGATATTGACTTTGG - Intronic
1041180429 8:55241934-55241956 AATAATAATAATAATGTTATGGG + Intronic
1041476137 8:58268554-58268576 AAAAGTGATGATAGTTTGATAGG - Intergenic
1041885097 8:62799188-62799210 AAACATGATGAAATTATTTTGGG - Intronic
1041897491 8:62942480-62942502 AATGATGATGGTATTGTGATGGG - Intronic
1042115346 8:65425708-65425730 AAGGATGATGATATTTTGATGGG + Intergenic
1042392093 8:68247764-68247786 AATGATGATGGTATTTTTATGGG + Intergenic
1042408870 8:68439037-68439059 AAAAATGAAGAAAATTTTATTGG - Intronic
1043047282 8:75342652-75342674 AAGACTGATGATTTTGTAATTGG - Intergenic
1043324200 8:79029750-79029772 AAAAATGATACTATTTTTCTAGG + Intergenic
1043677606 8:82977733-82977755 AAAAATGTTAACATTTTTATAGG + Intergenic
1043717237 8:83502821-83502843 AATAATGATGGTATTTTGATGGG + Intergenic
1044006066 8:86938238-86938260 CAAAATGCTGATAGTGATATGGG - Intronic
1044113838 8:88309601-88309623 AAAAATGAGGCTTTTATTATAGG - Intronic
1044364361 8:91325781-91325803 AAAAATCATGAGATAGTCATTGG + Intronic
1044419122 8:91971210-91971232 AAAAATTATAATAATGATATAGG - Intronic
1044734120 8:95260311-95260333 AACACTGAAGATATTGCTATTGG + Intronic
1044912053 8:97070317-97070339 ACAAACTATGATATTGTTCTTGG + Intronic
1044929405 8:97237578-97237600 GAAAATGAGGACATTGTTATTGG - Intergenic
1045306366 8:100960054-100960076 AAAACTCATGATATTTTAATGGG + Intergenic
1045530426 8:102979970-102979992 AAAAATGCAGCTATTGTTACAGG + Intergenic
1045749557 8:105466855-105466877 AAAAATTCTGATATTATAATAGG + Intronic
1045986726 8:108257734-108257756 AAAAGTAATAATAATGTTATAGG - Intronic
1046052208 8:109037433-109037455 AAAAATGAGAATATTGATAATGG - Intergenic
1046448980 8:114362633-114362655 AATAATGATGATATTTTGATGGG - Intergenic
1046734069 8:117757295-117757317 CAAAGTGATGATGTTGTTGTAGG - Intergenic
1047119783 8:121888580-121888602 AAAAATGATCATCTTGATAGAGG - Intergenic
1047652130 8:126934131-126934153 AAAAATTAGAATATAGTTATTGG - Intergenic
1047915375 8:129578149-129578171 AAATATGAAGATATTTTTCTAGG - Intergenic
1048699932 8:137077441-137077463 CAAAATGTTGATAATGATATGGG + Intergenic
1050890625 9:10819845-10819867 AAAAATGCTGAGAGTGATATGGG - Intergenic
1050897368 9:10900201-10900223 CAAAATGATGATAGTGATATGGG - Intergenic
1051789232 9:20781492-20781514 AAAATTGATGATACTCTTTTAGG - Intronic
1051970677 9:22883662-22883684 ATAAATGATGATAGTGGTTTTGG + Intergenic
1051994312 9:23196018-23196040 AAGCATGCTAATATTGTTATAGG - Intergenic
1052220715 9:26018288-26018310 TAAAATGCTGATAATGATATGGG - Intergenic
1052248547 9:26369050-26369072 AAACATAATGATGTTGGTATTGG + Intergenic
1052248932 9:26373957-26373979 TAAAATGATAAAATTTTTATTGG - Intergenic
1052364435 9:27596155-27596177 AAAAATACTGATACTGTTATGGG - Intergenic
1052803637 9:32992896-32992918 TCAAATGATGATGGTGTTATGGG + Intronic
1053258054 9:36636124-36636146 AAAAATGTGGATATTACTATAGG + Intronic
1054745384 9:68848952-68848974 AATATTGATGATACTGGTATTGG + Intronic
1054768840 9:69066298-69066320 AAAAATGATGTCAATGTTAGGGG - Intronic
1055309999 9:74968918-74968940 AATGATGATGATATTTTTATGGG - Intergenic
1055783314 9:79843471-79843493 AAAATTGTTAATATTGTTAATGG + Intergenic
1056312589 9:85355384-85355406 AAGAATGATGTTATTTTGATGGG + Intergenic
1057079938 9:92166292-92166314 AAAAATAATTATATAGTAATGGG + Intergenic
1057779129 9:98035526-98035548 AAAAATGATGCTTATGTTACAGG + Intergenic
1057873787 9:98737687-98737709 AATGATGGTGATATTTTTATGGG - Intronic
1058558340 9:106195817-106195839 AAAAATGATGGTAGTTTGATAGG + Intergenic
1059077899 9:111214211-111214233 AAAAATCATGGTATTTTGATGGG + Intergenic
1059581816 9:115557151-115557173 CAAAATGCTGATAGTGATATGGG - Intergenic
1059611698 9:115904370-115904392 ATAAATAATGAGATTGTTACAGG - Intergenic
1060318953 9:122537577-122537599 AAAAATGATGGTAATTTGATAGG + Intergenic
1061490754 9:130942790-130942812 AAATAAGATGGTATTGTTAATGG - Intergenic
1062222886 9:135428128-135428150 AAAAATGAAGTAAATGTTATAGG + Intergenic
1203635517 Un_KI270750v1:106856-106878 CAAAATGCTGATAATGATATGGG - Intergenic
1186310332 X:8310802-8310824 TTAGATGATGATTTTGTTATCGG + Intergenic
1186398468 X:9234409-9234431 AAAAATGATGATAATATAGTTGG - Intergenic
1186616505 X:11194003-11194025 TAGGATGATGATATTGATATTGG - Intronic
1186748981 X:12602107-12602129 CAAAATGATGATATTGTGTGTGG - Intronic
1187007579 X:15247631-15247653 AAAAATTAAGATATTTTTATGGG + Intronic
1187637327 X:21244334-21244356 AAAAATGATGCTACTTTGATAGG + Intergenic
1187639228 X:21269602-21269624 AATAATGCTGATATTTTGATAGG + Intergenic
1187782938 X:22849371-22849393 AAAAATAATGAAATTGGTATGGG - Intergenic
1187803376 X:23090431-23090453 AAAATTGTTGAAATTTTTATTGG + Intergenic
1188454210 X:30343725-30343747 AAATAAGATGATATAGATATTGG + Intergenic
1188697422 X:33212859-33212881 AAAAATGAAAAAATTGTTTTGGG + Intronic
1188772759 X:34174597-34174619 AAAGATAATGAGATTATTATAGG + Intergenic
1188825231 X:34823914-34823936 AATAATGATGATATTTTGATGGG - Intergenic
1189297382 X:39928704-39928726 AAAAAAGATGATGATGCTATGGG + Intergenic
1189637292 X:43024275-43024297 CAAAATGCTGATAATGATATGGG - Intergenic
1189800489 X:44687863-44687885 AAAAATGATGAAATTATGATTGG - Intergenic
1189951918 X:46241009-46241031 AAAAATTATGTTATTGATTTGGG - Intergenic
1190567819 X:51748719-51748741 CAAAATCATGATATTGTGAAAGG - Intergenic
1190941198 X:55042801-55042823 AATGATGATGGTATTTTTATGGG - Intergenic
1191052379 X:56207635-56207657 CAAAATGCTGATAGTGATATGGG - Intergenic
1192242516 X:69344892-69344914 AAAAATAATGCTATTTTGATAGG + Intergenic
1192296725 X:69857404-69857426 AATGATGAAGGTATTGTTATGGG + Intronic
1192296737 X:69857585-69857607 AATGATGAAGGTATTGTTATGGG + Intronic
1192412657 X:70948204-70948226 CAAAATGCTGATAGTGATATGGG + Intergenic
1192901177 X:75498739-75498761 AATGATGATGATATTTTAATGGG - Intronic
1192934990 X:75849954-75849976 AAAAATGCTGATAATGATATGGG - Intergenic
1193273263 X:79554184-79554206 CAAAATGCTGATAGTGATATGGG + Intergenic
1193460416 X:81785176-81785198 AAAAATGTTGGTATTTTAATGGG + Intergenic
1193479169 X:82005844-82005866 AATGATGATGATATTTTGATAGG + Intergenic
1193724571 X:85024260-85024282 AAAAATGATTATCTAGTTCTTGG - Intronic
1193924802 X:87471198-87471220 AATAATGATGGTATTTTTATGGG - Intergenic
1194079285 X:89438529-89438551 AAAAATGATGTTATTTTAAAAGG + Intergenic
1194611163 X:96047564-96047586 AAAATTGCTGATATTTGTATTGG - Intergenic
1194873093 X:99157306-99157328 AAATATGTTGATATTTTGATAGG - Intergenic
1195230773 X:102844747-102844769 CTAAATGATGATATTATTATAGG + Intergenic
1195293192 X:103449041-103449063 AAAAATGTTGATATTTTGATGGG + Intergenic
1195509524 X:105698173-105698195 AATAATGATGATAATGATAGTGG - Intronic
1195642824 X:107195844-107195866 ATAAATTATAATATTATTATAGG + Intronic
1195913035 X:109907974-109907996 AATGATGGTGATATTTTTATGGG + Intergenic
1195972393 X:110487387-110487409 AAGAATGATGGTATTTTGATGGG + Intergenic
1196519001 X:116650490-116650512 AAGAATGATGGTATTTTGATGGG + Intergenic
1196623618 X:117852651-117852673 AGAAATGATGATTTTTTAATTGG - Intergenic
1196911004 X:120484382-120484404 GAAAATGCTAATATTGTAATGGG + Intergenic
1197102857 X:122677118-122677140 AAAAATGGTGGTATTTTGATGGG - Intergenic
1197597606 X:128485134-128485156 AAAAATGATGGTATTTTGATAGG - Intergenic
1197660449 X:129165425-129165447 GATAATGATGATAAAGTTATAGG + Intergenic
1197797613 X:130315199-130315221 AAAAATTATGAAATTGATAGTGG - Intergenic
1197952212 X:131909750-131909772 AAAAAAGAATTTATTGTTATGGG - Intergenic
1198411740 X:136376428-136376450 AAGAATGATGATATTTTGGTGGG + Intronic
1198471962 X:136955419-136955441 ATAAATTATGATTTTCTTATAGG + Intergenic
1199048924 X:143211929-143211951 AAAAATGATTGTATTTTGATGGG + Intergenic
1199808235 X:151323587-151323609 AAAAATGATGACATGGTAACTGG + Intergenic
1200431903 Y:3093834-3093856 AAAAATGATGTTATTTTAAAAGG + Intergenic
1200842095 Y:7792728-7792750 AGAAATGATGTTATTTTTAGGGG + Intergenic
1201468596 Y:14311294-14311316 AAAAATTATGTTTTTGTGATTGG - Intergenic
1201568800 Y:15392677-15392699 AAAAATTATGATTTTCTGATTGG + Intergenic
1201793882 Y:17873553-17873575 AAAAAAGATTATATAGTCATTGG + Intergenic
1201807672 Y:18032433-18032455 AAAAAAGATTATATAGTCATTGG - Intergenic
1202339730 Y:23850581-23850603 AAAAAAGATTATATAGTTATTGG + Intergenic
1202355265 Y:24041370-24041392 AAAAAAGATTATATAGTCATTGG + Intergenic
1202515513 Y:25628739-25628761 AAAAAAGATTATATAGTCATTGG - Intergenic
1202531036 Y:25819501-25819523 AAAAAAGATTATATAGTTATTGG - Intergenic