ID: 1088159815

View in Genome Browser
Species Human (GRCh38)
Location 11:106855336-106855358
Sequence TGGCCTGGCCAGGATCGGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 108}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088159815_1088159823 13 Left 1088159815 11:106855336-106855358 CCAAACCGATCCTGGCCAGGCCA 0: 1
1: 0
2: 1
3: 16
4: 108
Right 1088159823 11:106855372-106855394 CCTCTCACTCTATGCCTCAGAGG 0: 1
1: 0
2: 1
3: 18
4: 194
1088159815_1088159824 14 Left 1088159815 11:106855336-106855358 CCAAACCGATCCTGGCCAGGCCA 0: 1
1: 0
2: 1
3: 16
4: 108
Right 1088159824 11:106855373-106855395 CTCTCACTCTATGCCTCAGAGGG 0: 1
1: 0
2: 0
3: 18
4: 216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088159815 Original CRISPR TGGCCTGGCCAGGATCGGTT TGG (reversed) Intronic
901745282 1:11368827-11368849 GGGTCTGGCCAGGATCGGACTGG - Intergenic
904990650 1:34590084-34590106 TGGGCTGGTGAGGATTGGTTTGG - Intergenic
905645743 1:39624073-39624095 TGGCCTGGCCAGGATGGCTGTGG + Intergenic
905938097 1:41840720-41840742 TGGCACGGCCAGGATCTGATGGG - Intronic
907046675 1:51303808-51303830 TGGCCTGGCCAGGAGGGTTGCGG - Intronic
911059480 1:93735198-93735220 TGGCCTGGTCAGAATTGGCTTGG + Intronic
912416205 1:109509652-109509674 AGGCCTGGCGCGGATCGGTGCGG + Exonic
921509176 1:216009680-216009702 TGGCCTGGCGAGGAGCAGTCTGG - Intronic
1065877041 10:30006508-30006530 TGACCTGGCCAGGTGAGGTTAGG - Intergenic
1069842530 10:71348708-71348730 TGGCCTGGACAGGAGCTGTTGGG - Intronic
1071928563 10:90439505-90439527 TGGCCAGGTCAGGATCAGTAGGG - Intergenic
1073026482 10:100490626-100490648 TGGCATGGCCAGCATGGATTTGG - Intronic
1073639118 10:105231083-105231105 CTGCTTGGCCAGGATCGGCTAGG - Intronic
1073706425 10:105989507-105989529 CAGCCTGGCCAGGATTGGCTGGG + Intergenic
1075554428 10:123420097-123420119 TGGCATGGCCAGAATCAGTGTGG + Intergenic
1075861389 10:125679641-125679663 CTGCCTGGCCGGGATCGGCTGGG - Intronic
1076138077 10:128058562-128058584 TGGCCTGGCAAGGATCAATGGGG + Intronic
1077190547 11:1254390-1254412 CGGCCTGCCCAGGTGCGGTTGGG - Intronic
1077327940 11:1971709-1971731 TGGCCCGGCCAGGCTGGGTGTGG - Intronic
1078856057 11:15207060-15207082 GGGCCAGGCCAGGATGGGGTTGG + Intronic
1081560094 11:44205738-44205760 TGGAGTGGCCAGGAGCGCTTTGG + Intronic
1081988598 11:47325434-47325456 CGGCCTGGCCAGGGTCTGTGGGG - Intronic
1083660977 11:64251628-64251650 TGGCCCGGCCAGGGGCGGGTCGG - Exonic
1084732346 11:71081710-71081732 TGGCCTGGCAAGGTTCTGTTTGG - Intronic
1085417236 11:76327598-76327620 TGGACTGGCCAGGGTCGTCTTGG - Intergenic
1088159815 11:106855336-106855358 TGGCCTGGCCAGGATCGGTTTGG - Intronic
1089329613 11:117680401-117680423 TGGCCTAGCCAGGATCTGAGGGG - Intronic
1090268868 11:125371631-125371653 AGGCCTGGCCAGGTGCGGGTGGG + Intronic
1090398782 11:126435430-126435452 TGGGCTAGCCTGGATCTGTTGGG - Intronic
1202810919 11_KI270721v1_random:26889-26911 TGGCCTGGCCAGGCTGGGTGTGG - Intergenic
1093080293 12:14803145-14803167 TGGCATCGCCCGGGTCGGTTGGG - Intronic
1095875620 12:47077766-47077788 TTGCGTGGCCAGTATCGTTTTGG - Exonic
1101889104 12:108696126-108696148 TGCTCTGGCCAGGATAGGATGGG - Intronic
1202837645 14_GL000009v2_random:90458-90480 TGGCCTGGTCAGCATGGGCTGGG + Intergenic
1202907032 14_GL000194v1_random:80588-80610 TGGCCTGGTCAGCATGGGCTGGG + Intergenic
1128778601 15:70342832-70342854 TGGCCTGGCCAAGATAGGCCAGG + Intergenic
1129974650 15:79812115-79812137 TGCCCTGGCCAGGATCTGGTGGG + Intergenic
1131447649 15:92513158-92513180 TGGCCTGGCGAGGAGCGGGGAGG - Intergenic
1131684094 15:94752414-94752436 TGGCCTGGCTAGGAGCAGTCTGG - Intergenic
1132642679 16:984930-984952 AGGCCTGGCCCGGCTCGGGTGGG - Exonic
1133998101 16:10762782-10762804 TGGCCTGGCCAGGAGAGGGTGGG + Intronic
1136125345 16:28175398-28175420 AGGCCAGGCCAGGAAGGGTTGGG - Intronic
1136582957 16:31165288-31165310 TAGCCTGGCCAGGATCATCTTGG + Intergenic
1137397170 16:48124358-48124380 TGGCCTGACCAGCATAGTTTGGG - Intronic
1140768047 16:78178175-78178197 TGGCCTGGCCTGGCTGGGTTTGG + Intronic
1144176728 17:12714876-12714898 TGACTTGCCCAGGATCAGTTAGG - Intronic
1146642179 17:34549841-34549863 TGGCCTGGCCAGGCCCCCTTAGG - Intergenic
1152670315 17:81600290-81600312 GGGCGTGGCCAGGCTCTGTTGGG - Intronic
1154380840 18:13848581-13848603 TGCCCTGGCCAGCATGGGTGGGG - Intergenic
1155218505 18:23663541-23663563 CTGCCTGCCCAGGATTGGTTTGG + Intergenic
1158705292 18:59787094-59787116 TGGCCTGGCAAGGATCACATGGG - Intergenic
1163944540 19:20523123-20523145 TGGCCTGGCGAGGAGCAGCTTGG + Intergenic
1164966761 19:32491426-32491448 AGGCCAAGGCAGGATCGGTTGGG + Intergenic
1166140059 19:40800659-40800681 TGGCCGGGCCAGGATGGGAGTGG + Exonic
1168094527 19:54107062-54107084 TGGGCTGGCCAGGGTCGGGTAGG + Exonic
1202635000 1_KI270706v1_random:36894-36916 TGGCCTGGTCAGCATGGGTTGGG - Intergenic
1202650219 1_KI270706v1_random:173211-173233 TGGCCTGGTCAGCATGGGCTGGG + Intergenic
1202650538 1_KI270707v1_random:156-178 TGGCCTGGTCAGCATGGGCTGGG + Intergenic
928059850 2:28100831-28100853 GGGCCTGGCCAGGAGCGAGTAGG + Intronic
929684624 2:44023104-44023126 TGGCCTGGCCAGGAGCAGCCTGG + Intergenic
934504671 2:94880775-94880797 TGGCCTGGGGAGCATCCGTTTGG - Intergenic
934841629 2:97627631-97627653 TGGCCTGGCCAGGGTCCCTCAGG + Intergenic
937345514 2:121123206-121123228 TTGCCTGGCGAGGCTCAGTTAGG - Intergenic
938279431 2:130053640-130053662 TGGCCTGGTCAGCATGGGCTGGG - Intergenic
938330379 2:130444354-130444376 TGGCCTGGTCAGCATGGGCTGGG - Intergenic
938359566 2:130677149-130677171 TGGCCTGGTCAGCATGGGCTGGG + Intergenic
938435965 2:131283795-131283817 TGGCCTGGTCAGCATGGGCTGGG + Intronic
946172296 2:217902653-217902675 CGGCCTGGCCAGACTCTGTTTGG - Intronic
948364896 2:237448478-237448500 TGGCCTGGCAAGGAGCAGCTTGG - Intergenic
948548709 2:238753012-238753034 TGGCCTGGCCAGGGTTGGCCAGG + Intergenic
1169292689 20:4366185-4366207 TGGGCTGGCCTGGATTGCTTTGG + Intergenic
1171881158 20:30618078-30618100 TGGCCTGGTCAGCATGGGCTGGG - Intergenic
1173548429 20:43915970-43915992 TGGCCCAGCCTGGATGGGTTGGG + Intronic
1175315751 20:58045415-58045437 TGGCCTGGCGAGGAGGGGTAGGG - Intergenic
1176241102 20:64076372-64076394 TGTCCTGTCCAGGGTCTGTTGGG - Intronic
1176601594 21:8799340-8799362 TGGCCTGGTCAGCATGGGCTGGG - Intergenic
1179792724 21:43764736-43764758 GGGCCTGGCCAGCATCCGGTAGG + Intergenic
1179878732 21:44284722-44284744 TGACCTGGCCAGCATGGATTAGG - Intergenic
1180343879 22:11690891-11690913 TGGCCTGGTCAGCATGGGCTGGG - Intergenic
1180365704 22:11936334-11936356 TGGCCTGGTCAGCATGGGCTGGG + Intergenic
1180416890 22:12776240-12776262 TGGCCTGGTCAGCATGGGCTGGG + Intergenic
1183102249 22:35591186-35591208 TGGCCTGGCCAGCACCTGTTGGG + Intergenic
949865032 3:8540564-8540586 TGGCCTGGCCTGGATTGGTAGGG - Intronic
954993500 3:54861213-54861235 TGACCTGGCCAGGCTAGGTCAGG - Intronic
955771625 3:62390409-62390431 TTGCCTGGCCAGGCTGGATTTGG - Intergenic
960940287 3:122928871-122928893 AGGCCTGGCCAGGATGAGCTGGG - Intronic
961302066 3:125928493-125928515 AGGCCAGGCCAGGATCAGATGGG + Intergenic
961440325 3:126948963-126948985 TGGCCTGGGTAGCATGGGTTTGG - Intronic
968995577 4:3943352-3943374 AGGCCAGGCCAGGATCAGATGGG - Intergenic
973364919 4:49201146-49201168 TGGCCTGGTCAGCATGGGCTGGG - Intergenic
981079840 4:140628484-140628506 AGGCCTGGCCAGGACCTGTTTGG + Intronic
982067349 4:151665975-151665997 TGGCCTGGGCAGGAAAGGTGAGG + Intergenic
982302918 4:153898580-153898602 TGGCCTAGCCAGGATAACTTAGG - Intergenic
983779475 4:171650687-171650709 GGGCCTGGCCAGGAGCAGCTGGG + Intergenic
985577758 5:681631-681653 GGGCCTGGCCAGGACCTGCTTGG + Intronic
985592685 5:773730-773752 GGGCCTGGCCAGGAACTGCTTGG + Intergenic
992394575 5:76359023-76359045 TGGCCTGGCGAGGAGCGGCCTGG - Intergenic
992704774 5:79380094-79380116 CGGCTTGGCCAGGATTGGTGGGG + Intronic
993431892 5:87841908-87841930 TGTCCTGGCCAGGGTTGGCTGGG - Intergenic
995323034 5:110858700-110858722 TGGTATGGCCAGGACTGGTTTGG + Intergenic
996124589 5:119709016-119709038 CTGCCTGGCCAGGATTGGCTGGG - Intergenic
1002718634 5:181244849-181244871 TGGCCTAGGCAGGAACGGATTGG - Intronic
1010606340 6:77893052-77893074 CAGCCTGGCCAGGATTGGCTTGG - Intronic
1016899893 6:149091010-149091032 TGGCCTGGCCAGGAACTGCTAGG + Intergenic
1022801327 7:33780078-33780100 TGGCCTGGCCAGGCTACGGTGGG + Intergenic
1024637761 7:51304341-51304363 TGGGCTGGACAGGGTGGGTTGGG - Intronic
1035381550 7:158444236-158444258 TGGCCTCTCCAGGACCTGTTAGG - Intronic
1037081565 8:14793749-14793771 TGGCCTGGGCAGGGTAGGTGGGG - Intronic
1039934556 8:42030328-42030350 TGGCCTGGCTGGGATTGGCTTGG - Intronic
1044613390 8:94116184-94116206 AGGCCTGGGCAGGACCGGTTAGG + Intergenic
1045569319 8:103353179-103353201 TGGCCTGGTCAGGTTTGTTTAGG - Intergenic
1047536661 8:125726412-125726434 TGGCCTGTCCAGGAAAGGCTGGG + Intergenic
1049423350 8:142526453-142526475 TGGCGTAGCCAGCATCGGTCCGG + Intronic
1049688897 8:143950209-143950231 TGGCCTGGCCAGGGTCCGCTGGG + Exonic
1056121610 9:83493861-83493883 TGGCCTGGCCAGGAGGGGATGGG - Intronic
1056558266 9:87707375-87707397 TGGCTTGGGCAGGGTCTGTTTGG + Exonic
1058868825 9:109185444-109185466 GGGCCTGGCCAGGAGAGGTGAGG - Intronic
1060518218 9:124279080-124279102 TGGCCTGGCCTGGAGAGGATGGG + Intronic
1060898848 9:127239379-127239401 AGGCCTGGCCAGGCTTGATTTGG - Intronic
1062326597 9:136015383-136015405 TGCCCTGGCCAGGAGGGGTAGGG - Intronic
1062483462 9:136763094-136763116 TGGCCTGGCCAGGACCGGGTGGG - Intronic
1203749550 Un_GL000218v1:65803-65825 TGGCCTGGTCAGCATGGGCTGGG + Intergenic
1203708311 Un_KI270742v1:72287-72309 TGGCCTGGTCAGCATGGGCTGGG + Intergenic
1189412360 X:40783941-40783963 GGGCCAGGCCAGGATCTGTGTGG - Intergenic
1192224166 X:69217038-69217060 TGGTCTGGCCAGGCTAGGCTGGG + Intergenic
1201162917 Y:11180818-11180840 TGGCCTGGTCAGCATGGGCTGGG + Intergenic