ID: 1088162214

View in Genome Browser
Species Human (GRCh38)
Location 11:106886092-106886114
Sequence GAGAGCCACCACTATTAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 98}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088162210_1088162214 -6 Left 1088162210 11:106886075-106886097 CCCCTTCTTGATCACAAGAGAGC 0: 1
1: 0
2: 0
3: 16
4: 129
Right 1088162214 11:106886092-106886114 GAGAGCCACCACTATTAAGTGGG 0: 1
1: 0
2: 0
3: 8
4: 98
1088162209_1088162214 1 Left 1088162209 11:106886068-106886090 CCTTCTTCCCCTTCTTGATCACA 0: 1
1: 0
2: 1
3: 39
4: 446
Right 1088162214 11:106886092-106886114 GAGAGCCACCACTATTAAGTGGG 0: 1
1: 0
2: 0
3: 8
4: 98
1088162211_1088162214 -7 Left 1088162211 11:106886076-106886098 CCCTTCTTGATCACAAGAGAGCC 0: 1
1: 0
2: 0
3: 12
4: 101
Right 1088162214 11:106886092-106886114 GAGAGCCACCACTATTAAGTGGG 0: 1
1: 0
2: 0
3: 8
4: 98
1088162212_1088162214 -8 Left 1088162212 11:106886077-106886099 CCTTCTTGATCACAAGAGAGCCA 0: 1
1: 0
2: 0
3: 9
4: 113
Right 1088162214 11:106886092-106886114 GAGAGCCACCACTATTAAGTGGG 0: 1
1: 0
2: 0
3: 8
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088162214 Original CRISPR GAGAGCCACCACTATTAAGT GGG Intronic
900008638 1:85730-85752 GGGAGCCAACATTATTCAGTGGG + Intergenic
900036872 1:419741-419763 GGGAGCCAACATTATTCAGTGGG + Intergenic
900058499 1:655480-655502 GGGAGCCAACATTATTCAGTGGG + Intergenic
901697160 1:11016916-11016938 GAGACCCAACACTATTAAATCGG - Exonic
907007938 1:50934109-50934131 GAGAACAACCACTAATAAATAGG - Intronic
908433579 1:64082685-64082707 GCGAGCCTCCTCTAGTAAGTAGG + Intronic
910359725 1:86403675-86403697 GAGAGCCACCACTGAAAAGTTGG + Intergenic
912380751 1:109247038-109247060 CAGAGCCTCCACTGTGAAGTGGG + Intergenic
913606280 1:120469347-120469369 GAGGCCCACCCCTATTAAGGAGG + Intergenic
914210155 1:145570802-145570824 GAGGCCCACCCCTATTAAGGAGG - Intergenic
914269073 1:146063168-146063190 GAGGCCCACCCCTATTAAGGAGG - Intergenic
914368023 1:146997698-146997720 GAGGCCCACCCCTATTAAGGAGG + Intergenic
914484957 1:148100508-148100530 GAGGCCCACCCCTATTAAGGAGG - Intergenic
914584919 1:149052495-149052517 GAGGCCCACCCCTATTAAGGAGG - Intergenic
915165226 1:153944588-153944610 GAGTGCCAGGACCATTAAGTGGG - Intronic
917152714 1:171961988-171962010 GAGAGCCCCCACCAGTAAGAAGG - Intronic
919901804 1:202049278-202049300 GAGAACTACCCCTATTACGTAGG + Intergenic
920858248 1:209681946-209681968 GAGAACTAGCACTATTAAGCAGG + Intergenic
1063149390 10:3322705-3322727 GAGAGCCCCCACCAGTAAGAGGG + Intergenic
1068180406 10:53511402-53511424 GAGGGCCACCAATATTAGGGAGG - Intergenic
1071274425 10:84039975-84039997 GTGAGCCACCACTACTCAGGAGG + Intergenic
1072579637 10:96729540-96729562 CAGAGGCAGCACTATTAACTGGG - Intergenic
1074227712 10:111503661-111503683 GTGAGCCACCATCATTAACTGGG - Intergenic
1082674785 11:56083528-56083550 GAGAGTCACTACCATTAGGTGGG - Intergenic
1088162214 11:106886092-106886114 GAGAGCCACCACTATTAAGTGGG + Intronic
1111451119 13:88418319-88418341 TAGTGCTACCACTATAAAGTGGG - Intergenic
1112208924 13:97353906-97353928 CAGAGCTACCACTTTAAAGTAGG - Intronic
1113920585 13:113906535-113906557 GATAACCACTACTATGAAGTGGG + Intergenic
1114166552 14:20224491-20224513 TAGAGACACCACCATTAGGTGGG - Exonic
1114213887 14:20640933-20640955 GAGGGTCACCACTATCAAGTGGG + Exonic
1114333807 14:21665807-21665829 GAGGGCAACCACCATGAAGTGGG - Exonic
1116506939 14:45695035-45695057 GAGAGCCACCACTACTGTGGTGG + Intergenic
1117177727 14:53162384-53162406 GAAGGCCAGTACTATTAAGTAGG - Intergenic
1117767326 14:59096747-59096769 AAGAGACACTTCTATTAAGTTGG + Intergenic
1118531035 14:66705457-66705479 GTTATCCACCATTATTAAGTTGG + Intronic
1121835517 14:97088697-97088719 GGGTGCCACCACTATTCTGTAGG + Intergenic
1122799976 14:104224638-104224660 GGGAGCCCCCACTGTGAAGTGGG - Intergenic
1122816948 14:104318690-104318712 GAGAGGCATCCCTGTTAAGTCGG + Intergenic
1127628342 15:60802105-60802127 AACAGGCACCACTGTTAAGTAGG + Intronic
1138354881 16:56369450-56369472 GGGAGCCACCTTTATTCAGTAGG + Intronic
1139055422 16:63177528-63177550 GTGAGCCAGCTCAATTAAGTAGG - Intergenic
1146349689 17:32084073-32084095 GAGAGCCCCCTCTATTACGAGGG + Intergenic
1153337638 18:3941040-3941062 GAGAGCCACGAATATAAAATGGG + Intronic
1153548014 18:6229739-6229761 GGGAGCCAAGACTATTCAGTGGG - Intronic
1153791351 18:8582573-8582595 TAGGGCCACCAGTTTTAAGTGGG - Intergenic
1155889792 18:31253292-31253314 GAGAGGAACCACCATTCAGTGGG + Intergenic
1157636563 18:49162353-49162375 GAGAGTCACCACTAGCAAGAAGG - Intronic
1159253703 18:65916985-65917007 GAGAGACACTACTATAAAGAAGG - Intergenic
1159403806 18:67973983-67974005 CAAATCCACCACTATGAAGTAGG - Intergenic
1160640401 19:127290-127312 GGGAGCCAACATTATTCAGTGGG + Intergenic
1162982588 19:14248944-14248966 GAGAGCCCCCTCTATTACGAGGG - Intergenic
933211673 2:79577739-79577761 AAGAGACAGCACTATTGAGTTGG - Intronic
937068319 2:119037895-119037917 GAGAGCTACCATAAATAAGTAGG + Intergenic
937879495 2:126854740-126854762 GAGAGGCACCAGTATTTAGAGGG + Intergenic
942826781 2:180187282-180187304 GAGAGTCACCATTATGCAGTTGG + Intergenic
946013809 2:216588071-216588093 GGTAGCCACCACTATGGAGTTGG - Intergenic
946505227 2:220293073-220293095 GAGAACCTGCACTATTAAATTGG - Intergenic
946665026 2:222040054-222040076 GAGAGCCAGCAATATCAGGTGGG - Intergenic
948477886 2:238232180-238232202 GAGACCCAACACTATTAAATCGG - Intergenic
1170031000 20:11944007-11944029 GAGAGCCGCCTGTACTAAGTAGG - Intergenic
1170262987 20:14432570-14432592 GAAAGTAACAACTATTAAGTGGG - Intronic
1170299093 20:14861820-14861842 GAGAGCCACTGATATTAAGAAGG - Intronic
1171402368 20:24883111-24883133 AAAAGCAACCACTTTTAAGTGGG + Intergenic
1178180258 21:30152123-30152145 GAGAATCACCACGATAAAGTTGG + Intergenic
1179325928 21:40345378-40345400 GAGAGACACCAAAATCAAGTTGG - Intronic
1184428945 22:44429929-44429951 GAGGGCCAGCACTATCAAGAGGG + Intergenic
953336981 3:42101815-42101837 GAGAACCACCTCTTTTTAGTTGG + Intronic
958505357 3:94970144-94970166 GAGAGCCATCAATGTTATGTGGG - Intergenic
958535775 3:95400830-95400852 GAGAGTCACAGCTAGTAAGTAGG + Intergenic
959181930 3:102992480-102992502 GTGAGCCACCATTATCAATTGGG - Intergenic
961208511 3:125107225-125107247 GAGAGCCACAGCTAGTAATTGGG - Intronic
963579003 3:147100270-147100292 GAGATGCACCACTATAAATTGGG - Intergenic
963782630 3:149502179-149502201 GAAAGCCACCACTAACAAGTAGG - Intronic
967831733 3:193925752-193925774 GAAGGCCACCAGTTTTAAGTAGG + Intergenic
971470009 4:27013526-27013548 GAGAGGCAGCAATATAAAGTAGG + Intronic
973877334 4:55232973-55232995 AAAAGCCACCACGATCAAGTTGG - Intergenic
974720909 4:65736991-65737013 TAAAGCCACCAATTTTAAGTGGG - Intergenic
977237803 4:94529252-94529274 CAGCGCCACCACTATTGAGTTGG - Intronic
979808638 4:125006981-125007003 GAAAGCCTCCAGTATTAATTGGG + Intergenic
979994980 4:127420855-127420877 GAGAGCCAGGACCATTAAGTTGG + Intergenic
982758148 4:159249104-159249126 GAGAGCCACCAGTATTCACAAGG - Intronic
983554723 4:169049846-169049868 GTGAGCCACCACTTTTAAAACGG - Intergenic
983808027 4:172018813-172018835 GGCAGCCAGCACAATTAAGTAGG - Intronic
986417423 5:7543628-7543650 GATATGCACCTCTATTAAGTTGG - Intronic
993230501 5:85229278-85229300 GTTATCCACCACAATTAAGTTGG - Intergenic
1002736949 5:181399125-181399147 GGGAGCCAACATTATTCAGTGGG - Intergenic
1002747750 6:75693-75715 GGGAGCCAACATTATTCAGTGGG + Intergenic
1018136281 6:160781026-160781048 GTGACACACCACTATTAAGTGGG - Intergenic
1019242046 6:170674659-170674681 GGGAGCCAACATTATTCAGTGGG - Intergenic
1022491539 7:30824186-30824208 GAGAGCCCCCACTAGCAAGAAGG - Intronic
1024241282 7:47438509-47438531 GAGAGGCACCACCATCAAATGGG + Intronic
1026500332 7:70938255-70938277 GAGAGTCCCCACTAGTAAGAAGG - Intergenic
1029334077 7:99885694-99885716 GTAATCCACCACTATCAAGTAGG + Intronic
1030113796 7:106048353-106048375 ATGAGCCACCACTCTTTAGTTGG + Intergenic
1035506071 8:133442-133464 GGGAGCCAACATTATTCAGTGGG + Intergenic
1038353708 8:26806564-26806586 GAGGGCCACCATTAATTAGTGGG + Intronic
1049136369 8:140904346-140904368 CATATCCACCACTATCAAGTCGG - Intronic
1053334478 9:37252918-37252940 TAGAGTCAGAACTATTAAGTGGG - Intronic
1058462037 9:105191645-105191667 GAGAGACTCCTCTATTAGGTTGG + Intergenic
1203602237 Un_KI270748v1:23893-23915 GGGAGCCAACATTATTCAGTGGG - Intergenic
1186401029 X:9260042-9260064 GAGAGTCAATACAATTAAGTTGG - Intergenic
1194163134 X:90480471-90480493 GTGAGCCACCACAATCATGTGGG - Intergenic
1194830308 X:98615619-98615641 TTTATCCACCACTATTAAGTAGG - Intergenic
1195139690 X:101946968-101946990 CAGAGCCAATATTATTAAGTAGG + Intergenic
1196043904 X:111235799-111235821 GAGTGCCAACACTATTCAATGGG + Intergenic
1200509408 Y:4058193-4058215 GTGAGCCACCACAATCATGTGGG - Intergenic
1200771740 Y:7132156-7132178 CTGATCCACCACAATTAAGTTGG - Intergenic