ID: 1088162233

View in Genome Browser
Species Human (GRCh38)
Location 11:106886269-106886291
Sequence ATGCATTCCAATTAACAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 187}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088162233_1088162235 9 Left 1088162233 11:106886269-106886291 CCTTCCTGTTAATTGGAATGCAT 0: 1
1: 0
2: 0
3: 15
4: 187
Right 1088162235 11:106886301-106886323 TGAAACTCAAGCAGACATCCTGG 0: 1
1: 0
2: 1
3: 23
4: 276
1088162233_1088162241 30 Left 1088162233 11:106886269-106886291 CCTTCCTGTTAATTGGAATGCAT 0: 1
1: 0
2: 0
3: 15
4: 187
Right 1088162241 11:106886322-106886344 GGGCAATGGGGAAAAGTTACAGG 0: 1
1: 0
2: 3
3: 42
4: 251
1088162233_1088162239 18 Left 1088162233 11:106886269-106886291 CCTTCCTGTTAATTGGAATGCAT 0: 1
1: 0
2: 0
3: 15
4: 187
Right 1088162239 11:106886310-106886332 AGCAGACATCCTGGGCAATGGGG 0: 1
1: 1
2: 4
3: 34
4: 305
1088162233_1088162238 17 Left 1088162233 11:106886269-106886291 CCTTCCTGTTAATTGGAATGCAT 0: 1
1: 0
2: 0
3: 15
4: 187
Right 1088162238 11:106886309-106886331 AAGCAGACATCCTGGGCAATGGG 0: 1
1: 0
2: 3
3: 15
4: 183
1088162233_1088162237 16 Left 1088162233 11:106886269-106886291 CCTTCCTGTTAATTGGAATGCAT 0: 1
1: 0
2: 0
3: 15
4: 187
Right 1088162237 11:106886308-106886330 CAAGCAGACATCCTGGGCAATGG 0: 1
1: 0
2: 1
3: 23
4: 228
1088162233_1088162236 10 Left 1088162233 11:106886269-106886291 CCTTCCTGTTAATTGGAATGCAT 0: 1
1: 0
2: 0
3: 15
4: 187
Right 1088162236 11:106886302-106886324 GAAACTCAAGCAGACATCCTGGG 0: 1
1: 0
2: 0
3: 14
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088162233 Original CRISPR ATGCATTCCAATTAACAGGA AGG (reversed) Intronic
903711285 1:25326647-25326669 AGGCATTCCAAGCAAGAGGAGGG + Intronic
903715663 1:25364782-25364804 AGGCATTCCAAGCAAGAGGAGGG - Intronic
905238697 1:36568122-36568144 GTCCATTCCATTTAACAGGGTGG - Intergenic
907428950 1:54399646-54399668 ATGCATTCCAGGCAAGAGGAAGG + Intronic
908487153 1:64605998-64606020 ATTCCTTCCACTTAACAGGTAGG - Intronic
911540435 1:99151317-99151339 ATCGATTGCAATAAACAGGAAGG - Intergenic
912444205 1:109722170-109722192 CTGCATTCCAAACAACAGGAGGG + Intronic
914522755 1:148433082-148433104 TTGCATGCCAATTAAGAGGTAGG + Intergenic
917271001 1:173274079-173274101 AGGCAATCTAATTAACAGGTTGG + Intergenic
921648220 1:217645165-217645187 ATACATTGCAATTAAAAGGAAGG - Intronic
922811544 1:228417928-228417950 AGACATTCCAAGTCACAGGATGG - Intergenic
1062942093 10:1430531-1430553 ATGGATTGAAATTAAAAGGATGG + Intronic
1064161363 10:12949376-12949398 CTGCATTCCAGCCAACAGGAAGG - Intronic
1066060625 10:31720719-31720741 CTGCATTCCAGTCAACAGGAAGG - Intergenic
1066286279 10:33969147-33969169 CTGCATTCCAAGCATCAGGAAGG - Intergenic
1067932576 10:50577551-50577573 TTGCATTAAAATTAAGAGGAAGG - Intronic
1068475517 10:57518863-57518885 ATGCATTGCAGTTGTCAGGATGG - Intergenic
1069136028 10:64766868-64766890 TTGCATTTCAGTTAACTGGAAGG + Intergenic
1071085524 10:81864402-81864424 ATGCATTTTAACAAACAGGAAGG - Intergenic
1072583345 10:96759527-96759549 CTGTATTCCAGTCAACAGGAAGG + Intergenic
1073459365 10:103657778-103657800 ATGAATTCCCATTAGCTGGAAGG + Intronic
1074968871 10:118519213-118519235 ATCCCTTCCCATTTACAGGAAGG + Intergenic
1079947964 11:26767038-26767060 AGGCATTCTAAGTCACAGGACGG + Intergenic
1087861659 11:103165520-103165542 ATGCATTCTAATTAATAAAAGGG - Intronic
1088100578 11:106150603-106150625 ATGCATTCTAACTAATGGGAAGG - Intergenic
1088162233 11:106886269-106886291 ATGCATTCCAATTAACAGGAAGG - Intronic
1089472763 11:118734140-118734162 AGGCATTCTAAATCACAGGATGG - Intergenic
1095588349 12:43874203-43874225 TTGCATTACAATAAATAGGAAGG + Intronic
1096721414 12:53525752-53525774 GTGCATCCCAACTAACAGAAAGG - Intronic
1098251345 12:68572840-68572862 CTGCATTCCAAGCAGCAGGAAGG - Intergenic
1099070208 12:78036825-78036847 ATGAAGTCCAATTGAAAGGAAGG + Intronic
1101155233 12:101921342-101921364 ATGCATCCCAATAATCAGGGTGG - Exonic
1103042459 12:117706842-117706864 ATACATTGTAATAAACAGGAGGG + Intronic
1103056097 12:117821923-117821945 AGGCATTCTAAGTCACAGGATGG + Intronic
1103113827 12:118308034-118308056 AGGCATTCTAAGTCACAGGATGG + Intronic
1103163320 12:118749303-118749325 AGGCATTCTAAGTCACAGGATGG - Intergenic
1103431929 12:120895025-120895047 ATGCATTCCAAGGAAAAGCAGGG + Intronic
1104004570 12:124882975-124882997 ATGCAATTAAATCAACAGGAGGG + Intergenic
1104800670 12:131553564-131553586 AGGCATTCTAAGTCACAGGATGG - Intergenic
1106261001 13:28066716-28066738 AAGCATTCCAATTAACATAGAGG + Intronic
1106665923 13:31850839-31850861 ATGTATTCTAACCAACAGGAGGG - Intergenic
1107702782 13:43064778-43064800 ATGCATTCCAGCCAGCAGGAAGG + Intronic
1108235788 13:48403640-48403662 ATGCATCAAAATTACCAGGAGGG + Intronic
1108948486 13:56055752-56055774 ATGCATTTGAATTAACATTAGGG + Intergenic
1110238997 13:73246060-73246082 ATGCATTTCAGTTAACAGGTTGG - Intergenic
1111484998 13:88886434-88886456 ATGCATTGCAATTTTCAGCAAGG + Intergenic
1113236197 13:108277912-108277934 AGGCATTCTAAGTCACAGGATGG - Intronic
1115464484 14:33699860-33699882 ATATATTCCAAATAACAGGGGGG + Intronic
1116514816 14:45792688-45792710 ATTTATTCCCATTAACAGGCAGG - Intergenic
1120362413 14:83522024-83522046 ATGCACTCCCTATAACAGGAGGG - Intergenic
1120692577 14:87609152-87609174 ATGTATTCCAAATTACTGGAGGG + Intergenic
1120701006 14:87698734-87698756 ATGCATTCTAATCACCAGAAAGG + Intergenic
1121321983 14:92997074-92997096 AGGCATTCCAGGTAACGGGAGGG + Intronic
1121705903 14:95993509-95993531 AGGCATTCTAAGTCACAGGATGG - Intergenic
1121939005 14:98050076-98050098 ATACATTCCAATTAATAGGCAGG + Intergenic
1122051219 14:99061695-99061717 ATCCCTTCCAACTAACACGAGGG - Intergenic
1122061328 14:99138564-99138586 ATGCTTGCAGATTAACAGGAGGG - Intergenic
1123156451 14:106231954-106231976 ATGCAGTCCAAATAAAGGGATGG + Intergenic
1124664201 15:31578176-31578198 CTGCATTCCAAAAAAGAGGAGGG - Intronic
1124806935 15:32893664-32893686 ATGCATTTCACTCAACAAGAGGG - Intronic
1125312653 15:38397488-38397510 CTGAATTCCAACTAACAGAAAGG + Intergenic
1133805711 16:9124727-9124749 CAGGATTCCAATTAATAGGATGG - Intergenic
1134280021 16:12809016-12809038 ACGCATTCTAAGTCACAGGATGG + Intergenic
1134370101 16:13615360-13615382 CTGCATTCCAGTTAGCAGGAAGG - Intergenic
1135069810 16:19341986-19342008 CTGCATGCCAAGTAGCAGGAAGG - Intergenic
1137042591 16:35626993-35627015 AGGCATTCCTAGTCACAGGAAGG + Intergenic
1137263516 16:46850241-46850263 AGGCATTCTAAGTCACAGGATGG - Intergenic
1140105637 16:71957494-71957516 ATGAATTGAAATTAAAAGGATGG + Intronic
1145331485 17:21876139-21876161 ATGGATTACAATCAAAAGGAAGG + Intergenic
1149254305 17:54807491-54807513 AGGCATTCTAAGTCACAGGATGG - Intergenic
1149685006 17:58530307-58530329 GTGCATCCCAAGTCACAGGATGG + Intronic
1151128562 17:71871975-71871997 ATGCATTACAAATAAAATGATGG + Intergenic
1152383636 17:79955608-79955630 ATGCATTGGAACTAAAAGGATGG + Intronic
1152647599 17:81476832-81476854 CTACATTCCAACTAGCAGGAAGG - Intergenic
1153446436 18:5178187-5178209 ATGCATATCAATAAGCAGGAGGG - Intronic
1155222380 18:23697344-23697366 ATGCATTGCAATTTTCTGGAGGG + Intronic
1158377760 18:56890699-56890721 ATTCATTCCAAGTGCCAGGATGG - Intronic
1158461729 18:57652029-57652051 CTGCATTTCAATTTACAGGTTGG - Exonic
1158846568 18:61449245-61449267 ATGCTTTCTACTTATCAGGAAGG - Intronic
1159676113 18:71286139-71286161 AGGCATTCTAAGTCACAGGATGG - Intergenic
925202443 2:1979478-1979500 ATGCATCCCCATTAACAGTTTGG - Intronic
926494851 2:13573454-13573476 TTGCATTTCAATAAAAAGGAAGG - Intergenic
928737454 2:34308681-34308703 TTGCATTCCAAGCAACATGATGG - Intergenic
930500087 2:52203822-52203844 ATGCATGTCAAATAAAAGGATGG - Intergenic
931187168 2:59964398-59964420 TTGCATTCCAGGCAACAGGAAGG + Intergenic
931988598 2:67766286-67766308 AGTCATTCCAATGAACAGGTAGG - Intergenic
932407741 2:71525034-71525056 GTGCATTCCAATTAAAATGCAGG - Intronic
933123312 2:78570906-78570928 ATGCATTTGAATAAACAGCAAGG - Intergenic
937683296 2:124667626-124667648 ATTGAGTCCAATTAAGAGGATGG + Intronic
938591427 2:132740261-132740283 ATGCATGCCAATTAATAAGATGG - Intronic
938846217 2:135212085-135212107 TTGCATTCCTATTAAGAGTAAGG + Intronic
939472968 2:142648300-142648322 ATGCATTGTAATTACCTGGAGGG - Intergenic
939865663 2:147469657-147469679 TTACATTCCAAATAACAGCAGGG - Intergenic
941601512 2:167548522-167548544 ATGCATTCCAGGCAGCAGGAGGG - Intergenic
942468472 2:176233713-176233735 GTGCATTGCAGCTAACAGGAAGG + Intergenic
944026648 2:195178059-195178081 GTACATTCCTATTAACAGGATGG + Intergenic
945412657 2:209530175-209530197 ATGCATCCCAGATAGCAGGAGGG + Intronic
945785357 2:214228097-214228119 ATGCATTCCAATTAGTAGAGTGG + Intronic
946681415 2:222221105-222221127 ATGTATTACAATTAACAACATGG + Intronic
947678585 2:232008496-232008518 AACCCTTCCAATTAACAGGTAGG + Intronic
948094357 2:235321646-235321668 AGGCATTCTAAGTCACAGGATGG + Intergenic
948438767 2:237971908-237971930 ATACAGTAAAATTAACAGGAAGG - Intronic
1170163397 20:13338440-13338462 AGGCATTCTAAGTCACAGGATGG - Intergenic
1170967917 20:21092629-21092651 ATTCTTTTCAATTAACAGAATGG + Intergenic
1171047411 20:21823462-21823484 CTGCATTCCAGACAACAGGAAGG + Intergenic
1172052077 20:32125558-32125580 ATGCATGGAAATTACCAGGAGGG - Intronic
1173128754 20:40366633-40366655 AGGCATTCCTATTAACATGAGGG - Intergenic
1174085098 20:48001919-48001941 TTGCATTCCCATCAACAGCATGG + Intergenic
1174676366 20:52360793-52360815 ATGCATACCAAAAAATAGGATGG - Intergenic
1176750063 21:10684074-10684096 ATGGATTCGAATAAAAAGGATGG - Intergenic
1177500313 21:21946468-21946490 CAGCATTCCAACTAACAGGAGGG + Intergenic
1178608654 21:34060765-34060787 ATGCATTCTAATTCCCAAGATGG - Intergenic
1179341494 21:40514342-40514364 ATGTAGTCCAATTAATAAGATGG - Intronic
1179673851 21:42968487-42968509 AGGCATTCAAAGTCACAGGATGG - Intergenic
1182632754 22:31699973-31699995 ATTCATTCCAATATACAGAAAGG - Intronic
1182638415 22:31748046-31748068 ATGCATTGGAATTAAAGGGAGGG - Intronic
951425670 3:22542420-22542442 ATGCAAGCCAATTATCAGGGAGG - Intergenic
952171033 3:30807334-30807356 ATACATTCCATTAAAAAGGAAGG - Intronic
952711850 3:36439587-36439609 ATACATTAAAATGAACAGGAAGG - Intronic
952722733 3:36549912-36549934 ATTCACTCCCATTAAGAGGAAGG + Intergenic
954099055 3:48355509-48355531 ATGAACTTCAATTCACAGGATGG - Intergenic
958752348 3:98206720-98206742 ATGCATTTGAATCAACTGGAGGG + Intergenic
960504728 3:118478907-118478929 AGGCATTCTAAGTCACAGGAGGG + Intergenic
962770495 3:138606810-138606832 ACACATTCATATTAACAGGATGG - Intergenic
962828140 3:139117937-139117959 AAGCTTTCCAATGACCAGGATGG - Intronic
963210385 3:142683194-142683216 ATGCATGGCGATTAAGAGGATGG + Intronic
963486649 3:145942559-145942581 TTGCAATCTAATTAACTGGATGG - Intergenic
963497772 3:146089357-146089379 ATACATTCCAATCCACAAGATGG + Intronic
965214058 3:165837400-165837422 GTGCAGTCCAATTTACAGGCTGG - Exonic
967393998 3:188986785-188986807 ATTCATGCCAAGTACCAGGAAGG - Intronic
969095802 4:4731777-4731799 ATGTAATCCAATTTACATGAAGG - Intergenic
970754614 4:19410199-19410221 ATGCTTTCAAAATAATAGGAAGG - Intergenic
971297035 4:25404316-25404338 ATTTATTCCAATTAACAACATGG - Intronic
972442304 4:39106602-39106624 ATGAATTTGAATTAACAGGGGGG + Intronic
974192844 4:58530036-58530058 ATGCATACCAATTCACAATAAGG + Intergenic
975651876 4:76601464-76601486 AATAATTTCAATTAACAGGATGG - Intronic
976083532 4:81383261-81383283 ATGCATTCCAATCAACAGTGAGG - Intergenic
977612546 4:99051060-99051082 ATGCATTCCCTTTCACAGAATGG + Intronic
977778202 4:100948303-100948325 ATGCATTAGAATTACCTGGAGGG + Intergenic
978508782 4:109492749-109492771 CTGCACTCCAATAAACATGAAGG - Intronic
978539513 4:109802235-109802257 AGTCATTGCAATTAACAGGGTGG - Intergenic
979598463 4:122559789-122559811 CTGCATTCCAAGCAACAGGAAGG - Intergenic
982576918 4:157124003-157124025 ATTCCTTCCAACTATCAGGAAGG + Intronic
983250544 4:165340785-165340807 ATGTCTTCCAATCAACAGAAAGG - Intronic
984174893 4:176405151-176405173 ATTAATTCCAATCAACAGGGAGG - Intergenic
984533792 4:180946457-180946479 ACGCATTTCATTTAACAGAATGG - Intergenic
984650127 4:182262368-182262390 AGGCATTCTAAGTTACAGGATGG + Intronic
985051069 4:185991765-185991787 ATACATTGAAATTAACATGATGG + Intergenic
988439786 5:31219684-31219706 ATGGATTCCAAGTTCCAGGAGGG + Intronic
988720886 5:33878046-33878068 CTACATTCAAATTCACAGGATGG - Intronic
992425710 5:76655194-76655216 ATCCCTTCCATTTAATAGGAAGG - Intronic
992607044 5:78468478-78468500 AGCCATACCAATTAACAGAAGGG - Intronic
993881039 5:93361408-93361430 ATGCCTTCCAAGCAATAGGATGG - Intergenic
995848333 5:116518358-116518380 CTGCAATCCAATTATCAGGAGGG + Intronic
998011623 5:138699850-138699872 CTGCCTTCCTTTTAACAGGATGG + Intronic
1004149592 6:13103183-13103205 AAGCAATGCAATTAACAGCATGG - Intronic
1006174616 6:32114417-32114439 GTGCATTCTAATTAGGAGGAAGG - Intronic
1009293458 6:61913427-61913449 ATGCATTCCAAAGGGCAGGAAGG + Intronic
1010329622 6:74607967-74607989 ATGCACTCAAATAAATAGGATGG + Intergenic
1010437810 6:75855456-75855478 ATGAATTCCAAATATCAGCAAGG - Intronic
1011139628 6:84138553-84138575 AGGTATTCCAATTAAAAGGCAGG + Intronic
1013866279 6:114700576-114700598 ATGCATACCAAGAAACAGGAAGG - Intergenic
1016158492 6:140845069-140845091 ATGCAATTTAATTAACAAGATGG - Intergenic
1016966570 6:149723475-149723497 TATCATTCCTATTAACAGGATGG + Intergenic
1017984737 6:159433988-159434010 CTGCATTCCAATGAACAAGCTGG - Intergenic
1018209430 6:161466635-161466657 CTGCACTCAAAGTAACAGGAGGG + Intronic
1021142565 7:17045504-17045526 CTGCATTCCAGGTAGCAGGATGG - Intergenic
1023326572 7:39066300-39066322 AAGCATTCCAATTAAAATCAAGG + Intronic
1026800199 7:73395602-73395624 AGGCATTCTAAGTCACAGGATGG - Intergenic
1028601002 7:92600392-92600414 ATGCAATCCAAGGAGCAGGAGGG + Intergenic
1028958298 7:96719329-96719351 ACACATTCCAATCAAAAGGAAGG - Intergenic
1030756405 7:113292106-113292128 CTGCATTGCAAGTAACAAGAAGG + Intergenic
1032317558 7:130853810-130853832 ATGCTGTCCATTAAACAGGAAGG + Intergenic
1034016823 7:147596755-147596777 AGGCATTCTAAGTCACAGGATGG + Intronic
1035291497 7:157842103-157842125 ATCCATTTTAAATAACAGGAAGG + Intronic
1039835972 8:41256619-41256641 ATACATTGCAATTTACAGGCTGG + Intergenic
1042743804 8:72081845-72081867 ATAGATTAAAATTAACAGGATGG - Intronic
1043184597 8:77130820-77130842 TTTCATTCTAATTAACAGTAGGG + Intergenic
1043247433 8:78022650-78022672 CTGCATTCCAATTAGGAGTAAGG - Intergenic
1044698617 8:94947945-94947967 ATGTATTTCAATTACCAGGCTGG + Intronic
1046355318 8:113076723-113076745 ATGGATTCCAAATAGAAGGATGG + Intronic
1047634762 8:126748923-126748945 ATGCTTCACAAGTAACAGGATGG + Intergenic
1048810531 8:138281686-138281708 AGGCATGCCAATTTACAGGGAGG - Intronic
1048933731 8:139338364-139338386 ATGCATTCCAATTACCAGCCTGG - Intergenic
1048935655 8:139354263-139354285 AGGCACTCTAATTAAAAGGAAGG + Intergenic
1051375747 9:16400672-16400694 ATGCAATCACATTAACAGGTGGG - Intergenic
1052384339 9:27806710-27806732 ATGCAGTTAAGTTAACAGGAAGG + Intergenic
1057400849 9:94721816-94721838 CTGCATTTCAATCAAAAGGAAGG + Intergenic
1059961799 9:119572603-119572625 ATTAATACCAATTAACAGGTCGG - Intergenic
1060066738 9:120508649-120508671 ATGCATTCCTGGTAGCAGGAAGG - Intronic
1185755057 X:2646539-2646561 AGGCATTCCAGGTGACAGGAAGG - Intergenic
1186396871 X:9218299-9218321 TTGCATCCTAATCAACAGGATGG + Intergenic
1187361824 X:18635491-18635513 ATGCATTCGAATTCAAATGAGGG + Intronic
1191636624 X:63384673-63384695 AGGCATTCTAAGTCACAGGATGG - Intergenic
1193588182 X:83353487-83353509 ATGTACACCAATTAACTGGAAGG + Intergenic
1195175361 X:102310181-102310203 ATGCATGTCAATTAACGGGCAGG + Intronic
1195183503 X:102376912-102376934 ATGCATGTCAATTAACGGGCAGG - Intronic
1195729367 X:107950370-107950392 AAGCATTCCCATTAAATGGAAGG - Intergenic
1196205838 X:112938200-112938222 GTGGATTGCAATTAACAGTATGG - Intergenic
1196837975 X:119831028-119831050 ATGCATTGCAGTTTGCAGGAGGG - Intergenic
1197645673 X:129013850-129013872 ATGGATTCCAATCTAAAGGAAGG + Intergenic
1199778658 X:151038182-151038204 ATTCCTTCCAATTAACAGATGGG - Intergenic
1201255826 Y:12107435-12107457 AGGCATTCTAAGTCACAGGATGG - Intergenic