ID: 1088162699

View in Genome Browser
Species Human (GRCh38)
Location 11:106892616-106892638
Sequence CATTCTTTGTTGAAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 318
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 290}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088162699 Original CRISPR CATTCTTTGTTGAAGGAGGA AGG (reversed) Intronic
902670528 1:17970170-17970192 CATTCATTCTTAATGGAGGAGGG + Intergenic
902753794 1:18536181-18536203 GAATGTTTATTGAAGGAGGAAGG + Intergenic
904487296 1:30835221-30835243 CATCCTTTGTTGAAGGGGCTAGG - Intergenic
905146991 1:35894426-35894448 CATACTTTGTTGGTGGAGAAGGG + Intronic
906403808 1:45525424-45525446 CTTTCTTTCTTGCAGGAGCAAGG + Intergenic
906863482 1:49389162-49389184 CATTCTTAGCTGAAGGAAGGAGG - Intronic
907393557 1:54174400-54174422 CCTACTATGTAGAAGGAGGATGG - Exonic
907662762 1:56408199-56408221 CACTTTTTGTTGAAGGTGCAGGG + Intergenic
907984796 1:59520054-59520076 AATTCTTTGTTGCAGGGGGTTGG - Intronic
908222387 1:62020481-62020503 CTTTCTTTATGGAAGGAGGAGGG - Intronic
908494540 1:64681088-64681110 CATGTTTTTTTAAAGGAGGAGGG - Intronic
909061822 1:70887473-70887495 CATTTTTGGTGGAATGAGGAAGG + Intronic
910062575 1:83111482-83111504 GTTTCTTTGTTGGAGGAGGATGG + Intergenic
910066160 1:83153609-83153631 CATTCTTTTTTGAGGTAGGGTGG - Intergenic
911205533 1:95088545-95088567 CTTACTTTGTTAAAGGAAGATGG + Intergenic
911491407 1:98572620-98572642 CATTCTTTTTTGTAGCAGGATGG - Intergenic
911981188 1:104568807-104568829 CTTTCTTTCTGGAAGGGGGAGGG + Intergenic
912995874 1:114532017-114532039 CATTCTTTTTTTCAGGGGGAGGG + Intergenic
917608723 1:176664368-176664390 CAGGCTTTGAAGAAGGAGGAAGG - Intronic
917787591 1:178475394-178475416 TGTCCTTTGTTGAAGGAGGAGGG + Intronic
921152810 1:212415078-212415100 CTCTCTTTGTTGGAGGGGGAGGG + Intergenic
921316910 1:213900680-213900702 CATTCTCTATTGATGGACGAGGG - Intergenic
921791524 1:219295895-219295917 CATTCATTGGAGAAGGTGGAAGG - Intergenic
922973251 1:229760852-229760874 CATTCTTTATTGACGGGGGCTGG + Intergenic
923258175 1:232240398-232240420 GAGTCATTATTGAAGGAGGAGGG - Intergenic
923531742 1:234817530-234817552 CACTCTTTGATGATGGAGGGTGG + Intergenic
923794761 1:237142995-237143017 CCTTCTTTTTTCAAGGAAGAAGG - Intronic
1063617713 10:7616035-7616057 CATTCTTGGGTAAAGGAGGAAGG + Exonic
1063802532 10:9596385-9596407 CATTCTTTGATCAAAGAGGATGG - Intergenic
1064206924 10:13332341-13332363 CATTCTTGGTTGCCAGAGGATGG + Intronic
1064336033 10:14442244-14442266 CATGCTTTGAGGATGGAGGAAGG + Intronic
1064358316 10:14639843-14639865 CAGTGTTAGCTGAAGGAGGAAGG - Intronic
1064695153 10:17957517-17957539 AATTCTTTGTTTAAGAAGAATGG - Intronic
1066394799 10:35009083-35009105 AATTGTATGTTGAGGGAGGAGGG + Exonic
1067966710 10:50921609-50921631 TATTCTTTGTGGAAGGATGGTGG + Intergenic
1068628816 10:59278511-59278533 AATTCTTTGATGAGGGAGAAGGG + Intronic
1068865031 10:61885977-61885999 AATTCTTTATAGAAGGAGGTGGG + Intergenic
1069537756 10:69267602-69267624 CATGCTTTGTTGATGGAATAAGG + Intergenic
1070324585 10:75379855-75379877 GATTCTTTGTTGCAGGAGAGAGG + Intergenic
1070963800 10:80517192-80517214 TAGTCTTCCTTGAAGGAGGAAGG - Intronic
1071095091 10:81963789-81963811 CATGCTTTGTTGCTGAAGGAAGG + Intronic
1071132347 10:82409519-82409541 CATTCTTTCATGAAGGACGTGGG + Intronic
1072695546 10:97600351-97600373 CCTTGTTGGCTGAAGGAGGATGG + Intronic
1072844284 10:98812209-98812231 TATTCTTTGTGGATTGAGGATGG - Intronic
1076119641 10:127925336-127925358 CATTCTTTCCTGAAGGAATAAGG - Intronic
1078112703 11:8411418-8411440 CATTATTTAGGGAAGGAGGAAGG + Intronic
1078439821 11:11355214-11355236 CAGTCTTTGTTGTAGGAGATGGG + Intronic
1079134713 11:17769997-17770019 CATTCTGTGTTGAGGGAAGCTGG - Intronic
1079339135 11:19597756-19597778 CATTTTTAGCTGAAGGAGGTGGG + Intronic
1080258503 11:30320760-30320782 AGTTCTTTGTTGTTGGAGGAGGG + Intergenic
1080504819 11:32902133-32902155 CATTCTTGGGTGAAGGAGTCGGG + Intronic
1081197195 11:40176114-40176136 TATTCTCTGGTGGAGGAGGATGG + Intronic
1082283018 11:50290995-50291017 CATACTTTGTAGAGGGAGGTAGG + Intergenic
1082966479 11:58971284-58971306 CATTCTTTGTTGATGGCTGTGGG + Intronic
1083704449 11:64504419-64504441 CATATTTGGTTGAAAGAGGAGGG - Intergenic
1085759292 11:79227983-79228005 CATTCTTTATTGAGAGAAGAAGG + Intronic
1088162699 11:106892616-106892638 CATTCTTTGTTGAAGGAGGAAGG - Intronic
1089914846 11:122143785-122143807 CATTCTTTGCTGGATGAAGAAGG + Intergenic
1090369057 11:126234486-126234508 CATTCTCTGTTGTTGGACGATGG - Intronic
1091067568 11:132530531-132530553 CATTCTGGGGTGAAGGAGTAAGG - Intronic
1091297642 11:134485313-134485335 AATTCTTTGGGGAAGAAGGAAGG - Intergenic
1091701504 12:2666439-2666461 CATGCTATGTTCAAGGTGGAAGG - Intronic
1093059928 12:14591164-14591186 CAGTCTGTGATGAAGGATGAAGG - Intergenic
1094097547 12:26724114-26724136 CATTCTTTTTTGAAAAAGGTGGG + Intronic
1095401562 12:41820153-41820175 AAATCTTTGATGAAGGAAGAAGG + Intergenic
1096370803 12:51067519-51067541 CTTACTCTGTTGACGGAGGAGGG + Intronic
1097541246 12:60946307-60946329 CATTCTTTGGAGAGGGAGAAGGG + Intergenic
1098102465 12:67032574-67032596 AATTCTTTGTTGATGGGGAAAGG + Intergenic
1098190399 12:67942156-67942178 GATGCTTTGTTGAAGGAGGGAGG - Intergenic
1102657957 12:114499184-114499206 GATTCTTTGTTGGGGGAGGTTGG - Intergenic
1102658686 12:114505780-114505802 CATTGAGTGGTGAAGGAGGAAGG + Intergenic
1103680677 12:122691138-122691160 AATTCTTTGTTGACTGAGGCTGG - Intergenic
1104003711 12:124877475-124877497 CCTTCTTTCTTGAAGGCAGAGGG + Intronic
1104208649 12:126665457-126665479 CATTCTTCGTGGAAGGGGCATGG - Intergenic
1104559895 12:129834140-129834162 CATTCTGAGATGAAGAAGGAAGG - Intronic
1106588093 13:31074455-31074477 TACTGTTTGTTGAAGGAGAAAGG + Intergenic
1107580808 13:41782955-41782977 CTTTCTTTTTTAAAGGAGGAGGG - Intronic
1107740865 13:43449026-43449048 CAATGTTTGTTGAATGAAGATGG + Intronic
1109330994 13:60929604-60929626 AATTCTTTGTTGAGGGTGGCAGG + Intergenic
1110548080 13:76779226-76779248 GATTCTATGATGAAGGTGGAAGG - Intergenic
1110769274 13:79319356-79319378 CATTCTTTGTAGAATGGGGGTGG - Exonic
1112111834 13:96309213-96309235 CATACATTTTTGAAGAAGGAGGG + Intronic
1112856649 13:103778888-103778910 CATTCGTAATTCAAGGAGGAAGG - Intergenic
1113267220 13:108633062-108633084 CATTGTTTGCAGCAGGAGGAAGG + Intronic
1113510456 13:110850469-110850491 TTTTCTTTCTTGAAGAAGGAGGG - Intergenic
1115008922 14:28521216-28521238 TATGCTTTGTTGAAGGAGCCAGG - Intergenic
1115377056 14:32688354-32688376 GATCCTTTGTTGAAGGAGATAGG - Intronic
1115507625 14:34108114-34108136 CATTCTTCTTTGAAGGCAGAAGG + Intronic
1115546121 14:34466201-34466223 GAGTCTATGTTGGAGGAGGAGGG + Intergenic
1115819314 14:37197271-37197293 CATTCTTAGTTCACGGAGGTAGG + Intergenic
1116861086 14:49996149-49996171 CATCCTTTGTTGGAGGGAGAAGG + Intronic
1116943127 14:50810585-50810607 TATTTTTGTTTGAAGGAGGATGG - Intronic
1117276485 14:54199078-54199100 CATTATTTGATGGAGAAGGAAGG + Intergenic
1117428941 14:55632237-55632259 CATCTTTTGTTGAAGGTGAAAGG + Intronic
1117942721 14:60985835-60985857 CATTCATTGTGGAAGGTGAAGGG + Intronic
1118172043 14:63396794-63396816 CATTTTTTGAGGAAGGAAGAAGG - Intronic
1118312850 14:64705766-64705788 CATCCTTTGTTGGACAAGGATGG + Intronic
1119655213 14:76412591-76412613 CCTTCTTTGTTGGGGGAGGATGG - Intronic
1119960065 14:78845546-78845568 CATTCTTTCTATAAGCAGGAAGG - Intronic
1121073564 14:91047480-91047502 CATTCTTTGTAGAAGTAGAATGG - Intronic
1123916565 15:25035474-25035496 AATTCATTGTCCAAGGAGGATGG - Intergenic
1127217175 15:56835564-56835586 CATTTGTTGTTGAAGAAGCAGGG - Intronic
1127737537 15:61858174-61858196 CATTCTAGGTGGAAGGAGAACGG - Intronic
1128708071 15:69851764-69851786 AATTCTTTCTGGGAGGAGGAAGG + Intergenic
1133427014 16:5701449-5701471 CATCCTTTGTACATGGAGGAAGG - Intergenic
1133604084 16:7368923-7368945 CATTTTTTGTGGAATGAGAAGGG + Intronic
1135747543 16:25029991-25030013 CATTCTCTGGAGGAGGAGGATGG - Intergenic
1137308764 16:47232356-47232378 TTTTCTTTTTTGAAGTAGGAGGG + Intronic
1137645469 16:50069617-50069639 AATTCTTTGTTGGGGAAGGAAGG - Intronic
1138592973 16:58012675-58012697 CACTCTCTGTGGAAGGGGGAAGG - Intronic
1138692031 16:58777188-58777210 CAAGCTTTGTTTAAAGAGGAGGG + Intergenic
1138862934 16:60780860-60780882 TATTTTTTGTTGGTGGAGGATGG + Intergenic
1140513807 16:75528078-75528100 CAGTCTTTGTTCAGGGATGATGG + Intergenic
1140906964 16:79417403-79417425 CATTCTATTTTGAAGGTGGAGGG + Intergenic
1142152003 16:88516789-88516811 CTCTCTTTGTAGAAGGAGAAGGG + Intronic
1142620197 17:1160758-1160780 CATTCTCTGTTGAAGAAGTGGGG + Intronic
1146961003 17:36978887-36978909 AATTCTTTGTTGAAGAAGTTAGG + Intronic
1147341893 17:39757353-39757375 GAATCTCTGTTGAGGGAGGAAGG + Intergenic
1147772835 17:42879517-42879539 GCTTCTTTCTTGAAGGTGGAAGG - Intergenic
1147819093 17:43231293-43231315 CCTGCTTTGTTGAGGGAGGGAGG - Intergenic
1147832376 17:43305998-43306020 CCTGCTTTGTTGAGGGAGGGAGG - Intergenic
1149329306 17:55565092-55565114 CATTTTATTTTGGAGGAGGAGGG + Intergenic
1149634836 17:58158020-58158042 CAATCTTTGTGAAAGGAGAAGGG - Intergenic
1151233614 17:72702452-72702474 AATTCTTTGTTGTAGGCGGGGGG - Intronic
1151322529 17:73360416-73360438 CATTCTTGGCTGAAGGGGGTGGG + Intronic
1151481924 17:74374707-74374729 TATTCTTTGCTTAAGGAGGAGGG + Intergenic
1151897040 17:76987443-76987465 CACTCTCTGATGAAGGAAGATGG + Intergenic
1153482727 18:5563717-5563739 CATTTTTTGATAAAGGAGAAGGG + Intronic
1155467843 18:26158567-26158589 AATTCTTTGTTAAAAGAAGAAGG - Intronic
1157534491 18:48448364-48448386 CAGTCATGGTGGAAGGAGGAGGG - Intergenic
1157611568 18:48959893-48959915 CAGTGTTTGTTGTATGAGGAAGG - Intergenic
1157799109 18:50604253-50604275 CATGCTTTGTTTAATGAGGCAGG + Intronic
1158378381 18:56900361-56900383 CATTCATTCTTGAAGGGAGATGG + Intronic
1160329058 18:77975853-77975875 CATTCTTAGTTGAAATAGAAGGG + Intergenic
1167188715 19:47967314-47967336 CATTCTTTGTTATAGGAGACTGG + Intergenic
1168313446 19:55473185-55473207 CATTTTAGGTTGAAGGCGGAGGG - Intergenic
1168448279 19:56442416-56442438 AATTCTCTGATGAAGTAGGATGG + Exonic
1168472528 19:56651050-56651072 CTTTCTTTTTTGAAAGAGGGTGG - Intronic
1168679717 19:58305664-58305686 CATTCTGTGTTGGAGGCAGAAGG + Intronic
925757312 2:7146231-7146253 CATTCTTTTTTGAGGGGAGATGG + Intergenic
925940526 2:8813327-8813349 CATTTTTTGTTTAGGGAGGATGG - Exonic
927203062 2:20590421-20590443 CCTTCTCTGTAGAAGGATGATGG + Intronic
927657264 2:24959775-24959797 CATTCTGTTTTGCAGGAGTAGGG - Intronic
927723464 2:25402918-25402940 CTTTCTTAGTAGAAGGAAGAAGG + Intronic
928255463 2:29718484-29718506 CCTTTTTTGTTAAAGAAGGAAGG + Intronic
928400980 2:30978573-30978595 AATTCTCTGTTGAGCGAGGATGG + Intronic
928415848 2:31091032-31091054 CCTTCACTGCTGAAGGAGGAAGG - Intronic
928570091 2:32598299-32598321 CAATCTTTGCTCAAGGATGATGG - Intronic
928722762 2:34139584-34139606 TGTTCTTTTTTAAAGGAGGAAGG - Intergenic
929043115 2:37765277-37765299 CATTCTTTGTTAAAGAAAGGGGG + Intergenic
929803693 2:45126397-45126419 CCTTCCTTGTTGAAAGTGGAAGG + Intergenic
929862070 2:45687423-45687445 CATTTATTGTTGAAGGTGGAGGG + Intronic
929899174 2:45986625-45986647 AAGTCTTTTTTGAAGTAGGAGGG + Intronic
932670237 2:73731195-73731217 CATTCATTTTGGAGGGAGGAGGG - Intronic
932765594 2:74467443-74467465 CTTTCTTTTTTAAAGGGGGAGGG + Intergenic
932953572 2:76323781-76323803 GATTCTTTGGGGAGGGAGGAGGG - Intergenic
933474383 2:82770776-82770798 CTTTCTCTCTTGGAGGAGGAGGG - Intergenic
935096633 2:99951120-99951142 CATTCTTTGCTTAAGGGTGAAGG - Intronic
935111831 2:100101432-100101454 AAAACTTTTTTGAAGGAGGAAGG - Intronic
935392132 2:102564282-102564304 AAGTGTTTGTTAAAGGAGGACGG + Intergenic
935849305 2:107201177-107201199 GATGCTTTGGTGAAGGAGAAGGG - Intergenic
935891106 2:107679371-107679393 GATTCTTTCTGGAAGCAGGAAGG + Intergenic
936123135 2:109763721-109763743 AAAACTTTTTTGAAGGAGGAAGG + Intergenic
936221548 2:110607743-110607765 AAAACTTTTTTGAAGGAGGAAGG - Intergenic
937117945 2:119422345-119422367 CATTCTTGGTGGAAGGTGAAGGG + Intergenic
937536140 2:122889993-122890015 CATTGCTTTTTTAAGGAGGAAGG - Intergenic
938835894 2:135103714-135103736 AATTCTTTGTTGGCGGGGGAGGG + Intronic
939138016 2:138320060-138320082 AATACATTTTTGAAGGAGGAAGG - Intergenic
941484033 2:166056415-166056437 CATTCTTTGTCCAATCAGGAGGG + Exonic
941807022 2:169719604-169719626 ATTTCTTTGGTGGAGGAGGATGG + Intronic
942420591 2:175803088-175803110 CAACCTCTGTTGAAGAAGGAAGG + Intergenic
944277378 2:197854192-197854214 AAGTATTTGTTGAAGAAGGAGGG + Intronic
944939132 2:204604252-204604274 CATGCTTTGTTAGAGAAGGAAGG + Intronic
945317031 2:208380530-208380552 AAGTCTTTGTTGAAATAGGAAGG - Intronic
946447129 2:219749551-219749573 AATTCTTTGTTGCAGGTGAAGGG - Intergenic
946960992 2:224985747-224985769 CAAGATTTGTTGAAGAAGGATGG - Intronic
947104679 2:226656120-226656142 CCTTCTTTTGTGAAGGAGGTTGG - Intergenic
1169040855 20:2494136-2494158 CCGTGTTTGTTGAATGAGGAGGG - Intronic
1169557338 20:6765424-6765446 CATTCTAAGTTGCAGGTGGAAGG + Intergenic
1169582505 20:7040044-7040066 CATTTTTTGTTGGGGGAGGTGGG + Intergenic
1172482366 20:35278315-35278337 CATTCTTTGACTAAGGTGGATGG - Intergenic
1173461618 20:43247664-43247686 CACTCTCTGTGGAAGGAGGCAGG + Intergenic
1173622696 20:44448816-44448838 CATTTTGTGTTGAAGAATGATGG - Intergenic
1174785469 20:53428563-53428585 CAATCATTGTTGAAGGATGAGGG + Intronic
1174980012 20:55383193-55383215 AATCCTCTGTTGAAGGAGAAAGG - Intergenic
1180942556 22:19668881-19668903 CAGTCTTTGTGGAAGGTGAACGG + Intergenic
1181452701 22:23034527-23034549 CATTCTCTTTGGAAAGAGGAGGG + Intergenic
1182309579 22:29395072-29395094 CATTCATTGTGGAGGGAGGATGG - Intronic
1183915519 22:41115340-41115362 AATTCTTTGTTGTGGGTGGAGGG - Intronic
951000786 3:17557022-17557044 TATTTTGTGTTGAGGGAGGAAGG - Intronic
951414567 3:22408281-22408303 CATTCTCTTTTAAAGGAAGAAGG + Intergenic
952303687 3:32126711-32126733 TATTCTTTTGTGAGGGAGGAGGG + Intronic
952692001 3:36219679-36219701 CATTGCTTCTTGGAGGAGGATGG + Intergenic
953382910 3:42487489-42487511 CATTCTTGGTTGAATGTGGGAGG - Intergenic
954989235 3:54825255-54825277 CCTTCTGTGTAGAAGGAAGAAGG - Intronic
956407067 3:68939096-68939118 AAATATTTGTTGGAGGAGGAAGG - Intergenic
956953072 3:74304614-74304636 CTTTGTTTCTTGAAGGAGTAAGG + Intronic
958027079 3:88060225-88060247 CATTATATATTGAAGGATGAGGG - Intronic
958680217 3:97320547-97320569 ATTTCTCTGTGGAAGGAGGAAGG - Intronic
958852616 3:99347279-99347301 CCTTCATAGTTGAAAGAGGAGGG + Intergenic
960048688 3:113220847-113220869 CATTCTTTTTTGAGAGAGGAAGG + Intronic
963053683 3:141164853-141164875 CTTTTTTTTTTTAAGGAGGAGGG + Intergenic
965419192 3:168436175-168436197 CATTCATTTTTTAAGAAGGAAGG + Intergenic
966555364 3:181253262-181253284 CAACATTTGTTGAAGGGGGAGGG + Intergenic
966591459 3:181688102-181688124 CATTTTTTCTTTAAGTAGGATGG - Intergenic
967056689 3:185835432-185835454 CCCTCTTAGTTGAAGGAGGTAGG + Intergenic
969249701 4:5958935-5958957 AATTCTTTGCTGTAGGAGGCTGG + Exonic
969706635 4:8795955-8795977 TATCCTTTGTTGAAAGAGGGAGG + Intergenic
970105369 4:12576757-12576779 CGTTCTTTGTTGAAAGGGGAAGG + Intergenic
974292168 4:59947411-59947433 CATTTTCTGGGGAAGGAGGAGGG - Intergenic
974576640 4:63733018-63733040 CATTCCTGGTTGAAGAAGGAAGG - Intergenic
974923319 4:68269306-68269328 CAATCTTGGTGGAAGGAGAAGGG + Intergenic
975492061 4:75000062-75000084 CTTGCTTTGTTGAAGGATGTGGG + Intronic
976140682 4:81988496-81988518 CATTCTTTTTTGGAGGATGTAGG - Intronic
977613466 4:99061139-99061161 TTTTGTTTGTTGAAGGCGGATGG + Exonic
979586949 4:122431658-122431680 CATTCTTTGTTCAAGGATAAAGG + Intergenic
980229026 4:130024163-130024185 GACTCTTTGTTGCTGGAGGAGGG - Intergenic
983884805 4:172968505-172968527 CTTTTTTTGTAGAGGGAGGAGGG - Intronic
984406045 4:179331400-179331422 CATTTATTCTTGAAGGAGCAAGG - Intergenic
985043507 4:185916774-185916796 AATTCTTTGTTGGGGGAGGTGGG - Intronic
985478708 5:93957-93979 CATTCTGTTTGGAAGGAGGGAGG - Intergenic
987598647 5:20035984-20036006 CATTTTTTGTTGAAGTTTGAGGG + Intronic
988594658 5:32580749-32580771 CAATCATGGTTGAAGGAGAAGGG + Intronic
990945642 5:61246162-61246184 CACTCTTTGGTGTAGGAGAATGG - Intergenic
991254844 5:64602501-64602523 CATTATATGTTGGATGAGGATGG - Intronic
992697652 5:79306128-79306150 TTCTCTTTTTTGAAGGAGGAGGG - Intronic
992841993 5:80704255-80704277 CATTCTTTGGTGACTGAGCAGGG - Intronic
993231957 5:85247889-85247911 CTTTCTTGGTTGTAGGGGGATGG + Intergenic
996033938 5:118737282-118737304 CATTCATTGTTCAGTGAGGATGG - Intergenic
997043678 5:130287898-130287920 CATTCTTTGATGCAGGACCAAGG + Intergenic
999011368 5:148044625-148044647 CCTTCTTTGCTGTATGAGGATGG - Intronic
999361842 5:150992287-150992309 AATTCCTTGTGGAAGGAGGTGGG + Intergenic
999655087 5:153803461-153803483 CATTCTTTGTGGAAGGTGAAAGG - Intronic
1000512582 5:162202055-162202077 CATTTTTTCTTGATGGAGAATGG + Intergenic
1000922670 5:167157165-167157187 CATTCTTTGTACAAGGTAGAAGG - Intergenic
1001997029 5:176170341-176170363 GATGCTTTTTGGAAGGAGGATGG - Intergenic
1003328962 6:5113583-5113605 CAGTTTTTGTTGAAGAATGAAGG + Intronic
1003501591 6:6707721-6707743 TTTTCTTTGGTGATGGAGGATGG - Intergenic
1005089746 6:22043818-22043840 CATGCTGTGCTGATGGAGGAGGG + Intergenic
1007565206 6:42844877-42844899 GATTCTTTGTAGACAGAGGAGGG + Intronic
1009835461 6:68995624-68995646 CTTCCTTTGATGAAGTAGGATGG - Intronic
1011489456 6:87875421-87875443 CATTCTATGTGGGAGGAGGAAGG - Intergenic
1012023877 6:93962986-93963008 CATTCTATGTAGCAGGAGCAAGG + Intergenic
1012647857 6:101710761-101710783 CATGCTTTGTTGAAGCACCAGGG + Intronic
1012764745 6:103352641-103352663 CATTCCTGGTGGAAGGTGGAAGG + Intergenic
1013445308 6:110220418-110220440 CAATCATTGATGAAGGAGAAAGG + Intronic
1015186369 6:130421000-130421022 GATTCTTTTTGGAAGGTGGAAGG - Intronic
1015301257 6:131655355-131655377 CATTCTTTGTAAAATGAGGATGG - Intronic
1016040316 6:139426041-139426063 CATTCTTTATTTCAGAAGGAAGG - Intergenic
1017702549 6:157089471-157089493 CATTCTTTGGAGAAGCAGAATGG + Intronic
1019094656 6:169569034-169569056 CGTTCTCTGTTGATGGAAGAGGG - Intronic
1019343860 7:520356-520378 CAGTCTTTGGGGAAGGAGGGGGG + Intergenic
1020155618 7:5721643-5721665 CATGCATTGCTGATGGAGGAAGG - Intronic
1020415168 7:7937283-7937305 TTTTTTTTTTTGAAGGAGGACGG + Intronic
1023036860 7:36138776-36138798 CATTCTTGGTTGTAGGGGGTTGG - Intergenic
1023574745 7:41615194-41615216 CATACTCTGCTGAAGGAGGTAGG - Intergenic
1024910883 7:54445339-54445361 CTTTCTTTGTTGGATGAGAAAGG + Intergenic
1027277951 7:76581170-76581192 CATTCTTTTTTGAGGTAGGGTGG + Intergenic
1029916792 7:104218485-104218507 CATACTTTTTTGTAGGGGGAGGG - Intergenic
1030507619 7:110444819-110444841 TTTTCTTTTTTGAAGGGGGATGG - Intergenic
1030845573 7:114405067-114405089 CAATTTTTGTTAAAGTAGGATGG + Intronic
1030981053 7:116185930-116185952 CATTCTTTCTGGACGCAGGACGG - Intergenic
1031173495 7:118320312-118320334 CATTCTAAGTTGCAGGATGATGG - Intergenic
1031476964 7:122235073-122235095 CATTCTCTGTTTTAGGTGGAGGG - Intergenic
1031486301 7:122330265-122330287 CAATATTTGTTAAATGAGGAAGG + Intronic
1033056004 7:138055025-138055047 TGATCTTTGTTGAAGGAGCAAGG + Intronic
1033059424 7:138091352-138091374 CTTTCCCTGATGAAGGAGGAGGG + Intronic
1033595744 7:142856598-142856620 CACTCTAGGTAGAAGGAGGATGG + Intronic
1034954255 7:155324452-155324474 CATTCTTAGTTGAAGGTAAATGG + Intergenic
1035006679 7:155668344-155668366 CAATTTTTGTTGAAGAAGCAAGG + Intronic
1037647462 8:20805510-20805532 CCTTGTTTGTTGAACGTGGAGGG + Intergenic
1038503507 8:28064451-28064473 CATTCTTTGTTGCTTGAGAAAGG + Intronic
1039231981 8:35458473-35458495 GATTCTTTGTTGAAGGGAAAAGG - Intronic
1039813157 8:41067901-41067923 CATTCTTTTTTGAATGACAATGG + Intergenic
1040850002 8:51890501-51890523 CAGTCTTTGTTTTAGAAGGATGG - Intronic
1040948276 8:52908035-52908057 TATACTCTGTTGTAGGAGGAAGG - Intergenic
1044850433 8:96421979-96422001 CATGCTGTGTTGAAGGAGCTTGG + Intergenic
1046015815 8:108603798-108603820 AAATCTTTGTGGAAGGAGGCAGG + Intergenic
1047038800 8:120969945-120969967 CTTTCTTTTTCAAAGGAGGAAGG + Intergenic
1048598716 8:135895549-135895571 CATTCCAAGTAGAAGGAGGAAGG - Intergenic
1050721574 9:8597438-8597460 AATTCTTTGTGGAACAAGGAGGG - Intronic
1051008287 9:12377099-12377121 GATTCTTTGTGGGAAGAGGAAGG - Intergenic
1051062392 9:13059360-13059382 GTTTCTATGTTGAAGGAGGCTGG - Intergenic
1052873647 9:33534417-33534439 TATATTTTGTTGAAGCAGGAGGG - Exonic
1053502444 9:38610341-38610363 TATATTTTGTTGAAGCAGGAGGG + Intergenic
1054877817 9:70114832-70114854 CTTTCTTTTTTGATGGAGGAAGG - Intronic
1055398018 9:75893378-75893400 CATGCCATGATGAAGGAGGAAGG + Intronic
1056525013 9:87435054-87435076 CATTCATGGTAGCAGGAGGAAGG + Intergenic
1058088212 9:100774037-100774059 CATTCTGAGATGAAGGAGAAAGG - Intergenic
1059238143 9:112779720-112779742 CATTCATTGCTGAAGGGTGAGGG + Intronic
1059759880 9:117327732-117327754 AAATATTTGTTGAAGGAGGGAGG - Intronic
1059811781 9:117863033-117863055 CAATCTTGGTGGAAGGAGAAGGG - Intergenic
1059952651 9:119482907-119482929 CATGCTTGGTGGCAGGAGGAGGG - Intergenic
1060418938 9:123453784-123453806 CATTCTATGTTGTAGGACAATGG + Intronic
1060546334 9:124463073-124463095 CATTCTTTGTCTTAGAAGGAAGG + Intronic
1061458863 9:130720074-130720096 AAATGTTTGTTGAAGGAAGAAGG - Intronic
1062091335 9:134680137-134680159 CATTCCTTGCTGAAGAATGAAGG - Intronic
1186186635 X:7026752-7026774 CATTCTTTGCTGTGGGAGGGGGG - Intergenic
1186204612 X:7188303-7188325 CATGCTTTGTTGATTGAGGGCGG + Intergenic
1188464541 X:30464868-30464890 CTTTTTTTTTTGAAGGAGGTAGG - Intergenic
1189851354 X:45179177-45179199 CATTCTTTGTTGGGGGAAGGAGG - Intronic
1190952873 X:55163051-55163073 CATTCTCTGAGGAAGGTGGAGGG + Intronic
1192390465 X:70721381-70721403 AATTCTTTTTGGAAGAAGGAAGG + Intronic
1192590312 X:72354190-72354212 CATTCTTTGCTGAAGCAGGCTGG + Intronic
1193210161 X:78797817-78797839 CACTCTTTGATGAGGCAGGAAGG + Intergenic
1194733072 X:97478978-97479000 CATTTTCTGTTAAAGGAGAAAGG + Intronic
1196637270 X:118017047-118017069 GATTATTTGGGGAAGGAGGACGG - Intronic
1197255160 X:124255085-124255107 AATTCTTTGTGGTATGAGGAAGG + Intronic
1198397960 X:136241699-136241721 AATTCTTTGTAGAATGAGGCAGG + Intronic
1198562096 X:137861428-137861450 CATTCTATGAGGAAGGATGAAGG + Intergenic
1199074206 X:143511055-143511077 CATTCCTTGAGGAAGGAGGTAGG - Intronic
1199093208 X:143714323-143714345 AATTCCTTGTGGAAGGAGGTTGG - Intronic
1200344905 X:155438438-155438460 CATTCATTGTGGAAGGGGAAGGG - Intergenic
1200937272 Y:8749195-8749217 CATGTTTTGCTGGAGGAGGAGGG + Intergenic
1201389039 Y:13477352-13477374 CATTCTTTGGAGAAGGTGGAAGG - Intronic
1201577281 Y:15474716-15474738 CATTCTTTGTTGATTGAGGGTGG + Intergenic
1202345374 Y:23917804-23917826 AATTATTTTCTGAAGGAGGAGGG - Intergenic
1202525396 Y:25752285-25752307 AATTATTTTCTGAAGGAGGAGGG + Intergenic