ID: 1088172555

View in Genome Browser
Species Human (GRCh38)
Location 11:107015810-107015832
Sequence TTACGCTGCCTGGGAAATAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 80}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088172552_1088172555 30 Left 1088172552 11:107015757-107015779 CCTGTTGTAAATAAATATTTTCA 0: 1
1: 0
2: 4
3: 74
4: 665
Right 1088172555 11:107015810-107015832 TTACGCTGCCTGGGAAATATTGG 0: 1
1: 0
2: 0
3: 2
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088172555 Original CRISPR TTACGCTGCCTGGGAAATAT TGG Intronic
905227926 1:36492205-36492227 TAATGCAGCCTGGGAAATCTGGG - Intergenic
905371602 1:37485425-37485447 TGAGGCTGCCTGGAAAAAATAGG + Intergenic
906249128 1:44297733-44297755 TTACCCTGGCTGGGAATTAGAGG + Intronic
907510487 1:54954407-54954429 TAACTCTGCCTGGGAAAGGTGGG + Intergenic
909320776 1:74282821-74282843 TTTCTCTGCCTGTGAAATTTTGG - Intronic
909348740 1:74623783-74623805 TTATGTTGCCTGGGGAATGTTGG - Intronic
913166662 1:116193485-116193507 TTAAGCTGCTAGGAAAATATGGG + Intergenic
918929828 1:190840355-190840377 TTACACTGTCTTGGAAATAAAGG + Intergenic
921548811 1:216507617-216507639 TTCCCCTGTTTGGGAAATATTGG - Intronic
924794674 1:247284747-247284769 TTAGGCTGCTGGGGAAATGTTGG - Intergenic
1070918001 10:80167166-80167188 TGAAACTGCCTGGGAAATAGGGG + Intronic
1082717234 11:56629050-56629072 TCACCCTGACTGGGAAATTTGGG + Intergenic
1082768296 11:57185769-57185791 TCACTCTGCCTGGGAAGTAAAGG - Intronic
1088172555 11:107015810-107015832 TTACGCTGCCTGGGAAATATTGG + Intronic
1088592815 11:111417900-111417922 TTACACTGCCTGGGAACTTAGGG + Intronic
1088944945 11:114502224-114502246 TTATGCTGCCTGGGACTCATTGG + Intergenic
1091994461 12:4982325-4982347 TTAAGCCTCCTGGGAAAAATTGG + Intergenic
1092697643 12:11191165-11191187 TGAGGCTGCCTGGGAAATTGGGG - Intergenic
1095628325 12:44344128-44344150 CTACTATGCCAGGGAAATATAGG + Intronic
1100823171 12:98450807-98450829 TTACGTTGCCTGGTAACTCTAGG - Intergenic
1106632927 13:31495862-31495884 TTACCCTGACTGGGAAAGCTGGG - Intergenic
1106681664 13:32014643-32014665 TTATGCATCCTGAGAAATATCGG + Intergenic
1111510754 13:89259164-89259186 TTATGCTGACGTGGAAATATGGG + Intergenic
1118919566 14:70137835-70137857 TTTGGCTCCCTGGGAAAAATGGG + Intronic
1122959270 14:105087211-105087233 TTTCCCTGCCTGGGAAACAAAGG - Intergenic
1126655490 15:50972710-50972732 TTACTCTGGCTGGGAAGCATGGG + Intronic
1130907119 15:88248398-88248420 TTACCCTGGCTGGGATATAAGGG - Intronic
1134617827 16:15665217-15665239 TCACACTGCCTGGCACATATAGG - Intronic
1135880157 16:26247858-26247880 GAACACTGCCTGGGAAAAATAGG + Intergenic
1136922724 16:34345493-34345515 TTACCCTGCCTGGGAGCTGTTGG - Intergenic
1136981849 16:35066313-35066335 TTACCCTGCCTGGGAGCTGTTGG + Intergenic
1139525390 16:67512641-67512663 TTGCCCAGCCTGGGAAACATAGG + Intergenic
1156439082 18:37166007-37166029 TTACACTGATTGGGAGATATTGG + Intronic
1156486804 18:37471567-37471589 TCACACTGCCTGGGCAAGATCGG - Intronic
1163241552 19:16067005-16067027 TTTCTCTGCCTAGGAAATGTAGG - Intronic
938838372 2:135131793-135131815 TGACACTGCCTGGCATATATGGG + Intronic
941047297 2:160691004-160691026 TTCCTCTTCCTGTGAAATATAGG + Intergenic
1170613298 20:17930735-17930757 TCACGCAGCCTGGGCAACATAGG - Intergenic
1173854753 20:46242996-46243018 TGAAGCTGCCTGGGAGATTTGGG - Intronic
1177131239 21:17258577-17258599 TGACTCAGCCTGAGAAATATGGG - Intergenic
953484029 3:43277733-43277755 TTATGGAGCCTGGGCAATATAGG + Intergenic
955519496 3:59761299-59761321 TTACTCTGACTGGGCAATGTGGG - Intronic
955570446 3:60299539-60299561 TTTGCCTGCCTGGGAAACATTGG + Intronic
958947869 3:100384263-100384285 TTACTCTACCTGGAGAATATTGG - Intronic
962290981 3:134136145-134136167 CTACGCTGCCTGGCAAAAACTGG + Intronic
962500994 3:135992221-135992243 TTACTTTGCCTGGAAAACATAGG - Intronic
967540896 3:190666552-190666574 TAATTCTGCCTGGGAAACATTGG - Intergenic
973093725 4:46170943-46170965 TTAATCTGCATGGTAAATATAGG + Intergenic
975192014 4:71475503-71475525 TTACACAGCCTGGGAAAAACTGG - Intronic
976911279 4:90309237-90309259 TTATGTCTCCTGGGAAATATAGG + Exonic
980629163 4:135410940-135410962 TTAGGGTGCCTGGGACATCTTGG + Intergenic
985487724 5:161232-161254 TGAGGCTGCCTGGGAAAGATGGG - Intronic
988165667 5:27586451-27586473 TGACTCTGTCTGGGAATTATTGG + Intergenic
993549690 5:89258319-89258341 TTTCTCTGCCTTGGAAACATAGG + Intergenic
998511920 5:142720867-142720889 TTACGAGGACTGGGAAATAAGGG + Intergenic
999714037 5:154344740-154344762 TCATGCTGCCTGGGAAAACTCGG - Intronic
1004493463 6:16140665-16140687 TTCCTCTCCCTGGGAAATCTAGG - Intronic
1007711018 6:43824304-43824326 TTGAGCTGCCAGGGAAACATGGG + Intergenic
1008420360 6:51292152-51292174 TTACCCTTGCTGGGAAAGATTGG + Intergenic
1009819315 6:68779408-68779430 TGATGCTGCCTGGGCAACATGGG + Intronic
1011583116 6:88894237-88894259 TTTCCCTCCCTGGGAAATATGGG + Intronic
1016270722 6:142286880-142286902 TTATGCAGCCTGGCAAAAATAGG - Intergenic
1017218847 6:151942856-151942878 TTATGCTGTCTGATAAATATTGG + Intronic
1020790470 7:12621376-12621398 TTAAGATGCCTGGCTAATATGGG + Intronic
1023900684 7:44476171-44476193 TCACACTGCCTGAGAAATTTGGG - Intronic
1027056384 7:75052707-75052729 TTACCCTCCATGGGAAATACTGG + Exonic
1030570646 7:111218496-111218518 TTACGTTGCCTGGGGTTTATTGG - Intronic
1030687857 7:112505036-112505058 TTACCCTGCCTGGCAAGTCTTGG + Intergenic
1032457103 7:132081469-132081491 TAACTCTGCCTGGGAATTCTGGG - Intergenic
1032642688 7:133787402-133787424 TGACACAGCCTGGGCAATATAGG - Intronic
1032710516 7:134456726-134456748 TCACAGTGCCTGGCAAATATAGG - Intronic
1035212543 7:157338769-157338791 TTACGCAGGCTGTGAAATTTGGG + Intronic
1040025810 8:42781169-42781191 ATTCCCAGCCTGGGAAATATAGG + Intronic
1042389221 8:68214005-68214027 TTACCCCACCTGGAAAATATAGG - Intronic
1042443010 8:68849495-68849517 TTGCCCAGCCTGGGAAACATAGG - Intergenic
1044363413 8:91315033-91315055 TTGCCCTGCCTGGGAAAAAAAGG - Intronic
1045218930 8:100178066-100178088 TTCAGCTGGCTGGGAACTATCGG + Intronic
1057978259 9:99629964-99629986 TGATTCTACCTGGGAAATATTGG + Intergenic
1059687624 9:116652512-116652534 TTGGGCTGCATGGAAAATATAGG - Intronic
1061053850 9:128211384-128211406 TTACAGTGCGTGGGAAAAATAGG + Intronic
1189792418 X:44616622-44616644 TGAGGCTGCCTGGGCAATAGAGG - Intergenic
1194000114 X:88417941-88417963 ATACTCTGCCTCTGAAATATAGG - Intergenic
1194684199 X:96891861-96891883 TTTCACTGGCTTGGAAATATTGG - Intronic