ID: 1088172907

View in Genome Browser
Species Human (GRCh38)
Location 11:107018097-107018119
Sequence GACGCGAGCGGCGGCGGAGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 697
Summary {0: 1, 1: 0, 2: 4, 3: 68, 4: 624}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088172896_1088172907 14 Left 1088172896 11:107018060-107018082 CCGGCGGAGCTGCAGCGGCCGAG 0: 1
1: 0
2: 2
3: 18
4: 181
Right 1088172907 11:107018097-107018119 GACGCGAGCGGCGGCGGAGGCGG 0: 1
1: 0
2: 4
3: 68
4: 624
1088172902_1088172907 -4 Left 1088172902 11:107018078-107018100 CCGAGGCGGTGGCGGCGAGGACG 0: 1
1: 1
2: 2
3: 13
4: 182
Right 1088172907 11:107018097-107018119 GACGCGAGCGGCGGCGGAGGCGG 0: 1
1: 0
2: 4
3: 68
4: 624
1088172893_1088172907 30 Left 1088172893 11:107018044-107018066 CCTTCGAGACATGCTGCCGGCGG 0: 1
1: 0
2: 0
3: 0
4: 22
Right 1088172907 11:107018097-107018119 GACGCGAGCGGCGGCGGAGGCGG 0: 1
1: 0
2: 4
3: 68
4: 624

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088172907 Original CRISPR GACGCGAGCGGCGGCGGAGG CGG Exonic
900096402 1:941842-941864 GACCCGAGCGGCGGGGGAAGCGG - Intronic
900102851 1:970213-970235 GATGCGAGCGGAGGGGGTGGGGG + Intronic
900119148 1:1041120-1041142 GGCGGGAGCGGGGGCGGGGGCGG + Intronic
900284093 1:1891018-1891040 GACGGAGGCGGCGGCGGCGGCGG - Exonic
900349400 1:2227675-2227697 GGCGCGGGCGGAGGCGGAGGCGG - Intergenic
900349747 1:2228689-2228711 GGCGCGCGGGGCGGCGGCGGGGG + Exonic
900511509 1:3063116-3063138 GACCCCAGGGGCGGCGGAGTCGG + Intergenic
901007791 1:6180106-6180128 GGCGCGCGCGGCGGGCGAGGCGG + Exonic
901433880 1:9234721-9234743 GGCGCGCGCGGCGGGGGCGGGGG - Intergenic
901673043 1:10867106-10867128 GCCTCGAGCGGCTGCGGGGGCGG - Intergenic
902600893 1:17539700-17539722 GTCGCGCACGGCGGCGGCGGCGG + Intergenic
902823238 1:18956232-18956254 GGCGGGGGCGGCGGCGGCGGCGG - Exonic
903034021 1:20483469-20483491 GAGGCGAGAGGAGGAGGAGGAGG - Exonic
903115533 1:21176305-21176327 CACCGGAGCGGCGGCGGCGGCGG - Exonic
903115633 1:21176588-21176610 GGCGGCGGCGGCGGCGGAGGCGG - Intronic
903263427 1:22143137-22143159 GGCGGCGGCGGCGGCGGAGGCGG + Intronic
903750210 1:25616797-25616819 AGCCCGAGCGGCGGCGGCGGCGG + Intergenic
904618195 1:31761029-31761051 CGCGCGGGCGGCGGGGGAGGGGG + Intronic
904719958 1:32500485-32500507 GTAGCGGGCGGCGGCGGCGGCGG + Intronic
904822949 1:33256820-33256842 GCCCAGAGCGGCGGCGGCGGCGG + Intronic
905414215 1:37793773-37793795 GGCGGGGGCGGGGGCGGAGGCGG - Intergenic
905449223 1:38046412-38046434 GACGACGGCGGCGGCGGCGGAGG - Exonic
906640805 1:47439315-47439337 GACGCGGGCGGTGGTGCAGGCGG + Exonic
907126625 1:52056281-52056303 GACGGCGGCGGCGGCGGCGGCGG - Exonic
907126626 1:52056284-52056306 GACGACGGCGGCGGCGGCGGCGG - Exonic
907126685 1:52056494-52056516 GCGGCGAGCGGGGGCGGAGGCGG + Intronic
907278109 1:53328023-53328045 GGCGGCAGCGGCGGCGGCGGCGG - Intronic
908355701 1:63323398-63323420 GGCGCGAGCGGCGGCGGGCCTGG + Exonic
909170023 1:72282907-72282929 AGGGCGAGCGGCGGCGGCGGCGG + Intergenic
910277558 1:85465064-85465086 GGCGGCGGCGGCGGCGGAGGCGG + Exonic
910449066 1:87328776-87328798 GAGGAAGGCGGCGGCGGAGGAGG + Exonic
910981244 1:92961547-92961569 GGCGCGCGCCGCGGCGGGGGCGG - Intergenic
911073180 1:93847890-93847912 GAGAAGAGCGGCGGCGGCGGCGG + Intergenic
912305202 1:108560105-108560127 GGCGGCAGCGGCGGCGGAGGCGG + Exonic
912305239 1:108560254-108560276 GCCGCGAGAGGCGGCGGCAGCGG + Exonic
913565558 1:120069421-120069443 GGCGGCGGCGGCGGCGGAGGAGG - Exonic
913632573 1:120724135-120724157 GGCGGCGGCGGCGGCGGAGGAGG + Intergenic
914255320 1:145957752-145957774 GACAGGAGCAGCGGCGGCGGGGG + Exonic
914619323 1:149390815-149390837 GGCGGCGGCGGCGGCGGAGGAGG + Intergenic
914889770 1:151612292-151612314 GCCGGGAACGGCGGCGGGGGAGG + Exonic
915393153 1:155562419-155562441 GGCGGGAGCGGCGGCGGCGGCGG + Exonic
915603705 1:156938067-156938089 CACTGGAGCGGCGGCTGAGGTGG + Intronic
916507966 1:165445154-165445176 GACGGCGGCGGCGGCGGCGGCGG - Exonic
916792540 1:168136795-168136817 GAAGGAAGCGGCGGCGGCGGTGG - Intronic
917565384 1:176207278-176207300 CGCGCGAGCGGCGGAAGAGGCGG + Exonic
918015858 1:180632064-180632086 GACCTCGGCGGCGGCGGAGGAGG + Exonic
918275765 1:182952872-182952894 CACGGGAGAGGCGGCGGCGGCGG - Exonic
919712283 1:200739614-200739636 CCCGGGAGCGGCGGCGGCGGCGG + Exonic
919916966 1:202144764-202144786 GGCGGCGGCGGCGGCGGAGGAGG - Intergenic
921023765 1:211259435-211259457 GACGGCGGCGGCGGCGGAGGAGG - Exonic
921217738 1:212951478-212951500 GGCGGCAGCGGCGGCGGCGGCGG - Exonic
921432847 1:215083196-215083218 GACGCGGGAGGGGGCGGGGGGGG - Intronic
921603982 1:217135521-217135543 CGCGCGCGCGGCGGCGGCGGCGG + Intronic
922116319 1:222617946-222617968 GACGGGGGCGGGGGCGGGGGCGG - Intergenic
922558195 1:226548931-226548953 GACGGCGGCGGCGGCGGCGGCGG + Exonic
922811153 1:228416415-228416437 GACGCGGCGGCCGGCGGAGGCGG + Intronic
922958624 1:229626019-229626041 GCCCAGAGCGGCGGCGGGGGCGG - Exonic
924289664 1:242524527-242524549 GGCGGGGGCGGGGGCGGAGGGGG + Intronic
924754751 1:246931391-246931413 GGGGCGAGCGGTGGCGGTGGCGG - Exonic
1062774713 10:135516-135538 GCCGGGCGCGGCGGCGGCGGCGG + Intronic
1064208969 10:13347774-13347796 GCCCCGCGCGGCGGCGGCGGCGG + Intronic
1064209073 10:13348105-13348127 GCCGCGCCCGGCGGCGGCGGCGG + Exonic
1064443184 10:15371311-15371333 GGCGCGGGCAGCGGCGGCGGCGG - Intergenic
1065520572 10:26567288-26567310 GGCGCGGGCGGCGGCGGCGGCGG - Exonic
1065712732 10:28533154-28533176 GGCACCAGCGGCGGCGGCGGCGG + Intronic
1065883824 10:30059509-30059531 GGCCGGAGCGGCGGCGGTGGCGG - Exonic
1069698327 10:70404213-70404235 GGATCGAGCGGCGGCGGCGGCGG + Intergenic
1070328206 10:75401349-75401371 GGCGGCGGCGGCGGCGGAGGCGG - Exonic
1070610088 10:77926860-77926882 GGCGCGCGCGGAGGCTGAGGGGG - Intergenic
1071544883 10:86521665-86521687 GGCGGAAGCGGCGGCGCAGGAGG - Exonic
1071966580 10:90858068-90858090 CAGGGGAGCGGCGGCGGCGGCGG - Intergenic
1072263244 10:93702532-93702554 GTTGCGGGCGGCGGCGGCGGCGG - Exonic
1072719462 10:97771812-97771834 CATGCGGGCGGCGGCGGCGGGGG - Exonic
1074995550 10:118754632-118754654 GACGAGGGGGGCGGCGGAGGTGG + Exonic
1075207075 10:120457174-120457196 GCCGCGGGCGGGGGCGGAGGCGG - Exonic
1075438461 10:122461627-122461649 GACTCTGGCGGCGGCGGCGGTGG - Exonic
1075802010 10:125159911-125159933 GAGGGCAGCGGCGGCGGCGGCGG - Intronic
1076372496 10:129964393-129964415 GGCGAGCGCGGCGGCGGCGGCGG - Intergenic
1076777703 10:132707251-132707273 GGCGCCATCGGGGGCGGAGGTGG - Intronic
1077043671 11:535299-535321 GGCGTAAGCGGCGGCGGCGGCGG - Intronic
1077214582 11:1390113-1390135 GACGCGGGGGGCGGCGGCGCGGG + Intronic
1077492757 11:2869778-2869800 GCCGCGAGCAGCGGCGGGGCCGG + Intergenic
1077916080 11:6612219-6612241 GGCGCGAGCGGAAGCGGAAGCGG - Exonic
1078057417 11:8019278-8019300 GCCCCGAGCGGAGCCGGAGGCGG + Intronic
1079035206 11:17014448-17014470 GGCGCGGGCAGGGGCGGAGGCGG + Intergenic
1079995783 11:27293624-27293646 GAGGGGAGGGGAGGCGGAGGGGG + Intergenic
1080503770 11:32893165-32893187 GGCGCGGGCGGCGGCGGCGGCGG - Exonic
1080802007 11:35618329-35618351 GCGGGGAGCGGAGGCGGAGGAGG + Intergenic
1081831913 11:46121544-46121566 GGCGCGCACGGCGGCGGCGGCGG - Intergenic
1083171092 11:60924496-60924518 GGGGCGGGCGGCGGCGGCGGCGG + Exonic
1083246223 11:61429986-61430008 GACGCCGGCGGCGGGGGGGGCGG - Intronic
1083329614 11:61891466-61891488 GCAGCGGGCGGCGGCGGAGGCGG - Exonic
1083430681 11:62612472-62612494 GCTCCGAGCGGCGGCGGCGGAGG + Exonic
1083753667 11:64777986-64778008 GGCCCGGCCGGCGGCGGAGGAGG - Exonic
1083753728 11:64778160-64778182 GGAGGGGGCGGCGGCGGAGGCGG + Exonic
1084146156 11:67266438-67266460 CGCGCGGGCGGCGGCGGCGGCGG + Exonic
1084284178 11:68120984-68121006 AGCGGCAGCGGCGGCGGAGGGGG + Exonic
1084284260 11:68121304-68121326 GGCGCGCGGGGCGGCGGCGGCGG + Intronic
1084310229 11:68312517-68312539 GGCGCGGGTGGCGGCGGCGGGGG + Intergenic
1085011105 11:73142248-73142270 GCCGGGAGCGGCGGCGCAGGCGG - Exonic
1085165816 11:74398452-74398474 GGGGCGGGCGGCGGCGGCGGCGG - Exonic
1085561140 11:77473760-77473782 GACGCGGGCGGGGGGGGAAGGGG + Exonic
1087241807 11:95789494-95789516 GGAGCGGGCGGCGGCGGAGGAGG - Exonic
1088172907 11:107018097-107018119 GACGCGAGCGGCGGCGGAGGCGG + Exonic
1088893393 11:114060960-114060982 GGCGAGAGCGGCAGGGGAGGCGG - Intronic
1089432775 11:118436912-118436934 GGGGAGAGCGGCGGGGGAGGCGG + Exonic
1089525611 11:119094766-119094788 GACGGGAGCGGGGGCGGGCGGGG + Exonic
1089993426 11:122882896-122882918 GGCCCGGGCGGCGGCGGCGGCGG + Exonic
1091740743 12:2959225-2959247 GGGGCGGGCGGCGGGGGAGGGGG - Intergenic
1091786704 12:3247302-3247324 GACGCGGGTGGCGGGGGGGGGGG - Intronic
1093685069 12:22046162-22046184 ACCGCGAGGGGCGGGGGAGGGGG + Exonic
1095261663 12:40105624-40105646 GGCGCGGGCGGCGGCGGCGTCGG - Exonic
1096078489 12:48818889-48818911 GGAGCGAGCGGCGCCGGGGGCGG - Exonic
1096241383 12:49961944-49961966 GTCGCAGGCGGCGGAGGAGGTGG - Exonic
1096784415 12:54009057-54009079 GGCGCGGGCGGCGGCGGCGGCGG - Intronic
1096789029 12:54033909-54033931 GCCGCAAGCGCCGGCGGAGCCGG - Intronic
1096796780 12:54082634-54082656 GGCGGGAGGGGAGGCGGAGGCGG + Intergenic
1096863834 12:54549599-54549621 GCAGCGCGCGGCGGCGGCGGCGG + Exonic
1097046247 12:56189519-56189541 GAGGCGGGCGGAGGAGGAGGCGG - Exonic
1097078701 12:56413585-56413607 GACGCCAGCTGCGGCTGGGGAGG - Intergenic
1097107673 12:56634960-56634982 GCCGCAGGCGGCGGCGGCGGCGG + Intronic
1097264695 12:57738390-57738412 GGCGCAAGCGGAGGCGGCGGAGG - Intronic
1098161043 12:67648657-67648679 GGGGCCTGCGGCGGCGGAGGAGG + Intronic
1098426063 12:70366542-70366564 GACGCCCCCGGCGGCGGCGGCGG - Exonic
1099713719 12:86264453-86264475 GACGCGGGCTGCAGCGGGGGAGG + Intronic
1099989761 12:89709306-89709328 GGCGCGAGCTTCGGCGGCGGTGG - Intergenic
1099989873 12:89709734-89709756 GGAGGGAGCGGCGGGGGAGGAGG + Intergenic
1100391438 12:94148881-94148903 GACGCGGGCGGCGGCGGCGGCGG - Exonic
1100618407 12:96249374-96249396 GACGCGCGCCACTGCGGAGGGGG + Intronic
1100869446 12:98894985-98895007 GGCGGCAGCGGCGGCGGCGGCGG + Intronic
1100963077 12:99984756-99984778 GAGGAGCGCGGCGGCGGCGGCGG + Intergenic
1101605878 12:106247579-106247601 GGCGGCAGCGGCGGCGGAGGCGG + Exonic
1101849735 12:108392581-108392603 AAAGAGAGCGGCGGGGGAGGGGG + Intergenic
1102025882 12:109714203-109714225 GGCGGCAGCGGCGGCGGCGGCGG - Intergenic
1102687667 12:114736882-114736904 CCCGCGAGGGGAGGCGGAGGCGG + Intergenic
1103309100 12:119989978-119990000 GATGAGGGCGGCGGCGGCGGCGG - Exonic
1103509695 12:121466514-121466536 GGCGGCAGCGGCGGCGGCGGCGG - Intronic
1103775655 12:123364767-123364789 GACTGGAGCGGAGGCGGCGGTGG + Intronic
1104376213 12:128267189-128267211 AGCGCGAGCAGCGGCGGAGCCGG + Intergenic
1104448819 12:128853493-128853515 GACGCGGACGGCGGGGGAGCCGG - Intronic
1104749754 12:131230870-131230892 GACGCGAGCTGCTGGGCAGGGGG - Intergenic
1105388987 13:19958501-19958523 GAGTCGAGGGCCGGCGGAGGCGG + Intergenic
1105472503 13:20705301-20705323 AAGGCGAGCGGGGGCGGTGGGGG + Intronic
1106242001 13:27920265-27920287 AACGGGTGCGGCGGCGGCGGCGG - Exonic
1106447651 13:29850579-29850601 GGCGGCAGCGGCGGCGGCGGCGG + Exonic
1106590070 13:31091425-31091447 GCCGGGAGCGGGGGCGGCGGGGG - Intergenic
1106602568 13:31200259-31200281 GACGCGCGCGCCGGCGGGGCAGG - Intronic
1106602653 13:31200535-31200557 AGCGCGAGTGGCGGCGGCGGCGG + Intronic
1106652158 13:31703347-31703369 GCTGTGAGCGGCGGGGGAGGTGG + Intergenic
1107058545 13:36131368-36131390 GAGGAGGGCGGCGGCGGCGGCGG + Intergenic
1107467545 13:40664819-40664841 GGCGCGGGCGGTGGCGGTGGCGG - Intronic
1108227455 13:48303941-48303963 GGCGGCAGCGGCGGCGGTGGCGG - Exonic
1108727790 13:53201117-53201139 GAGGGCAGCGGCGGCGGCGGCGG - Intergenic
1110119728 13:71866411-71866433 AACGGCAGCGGCGGCGGCGGCGG - Exonic
1110558467 13:76886093-76886115 AACGGGGGCGGCGGCGGGGGCGG - Exonic
1111951329 13:94711606-94711628 GACGCGTGCGGCGGCAGCGGCGG + Exonic
1112039805 13:95535558-95535580 GAAGGGAGCTGCGGGGGAGGTGG + Intronic
1112216366 13:97434432-97434454 GTCGCGGGCGGCGGCGGCGGCGG + Exonic
1112507129 13:99981885-99981907 GATCCAGGCGGCGGCGGAGGCGG + Exonic
1113655606 13:112066658-112066680 CGCGCGCGCGGCGGCGGCGGCGG - Intergenic
1113655916 13:112067737-112067759 GGGGCGGGCGGCGGCGGGGGCGG + Exonic
1113655926 13:112067761-112067783 GGCGGGGGCGGCGGCGGCGGCGG + Exonic
1114270678 14:21098333-21098355 GGAGCGGGCGGCGGCGGCGGCGG + Exonic
1114318319 14:21526267-21526289 GCAGGGAGCAGCGGCGGAGGGGG + Intronic
1114485174 14:23057662-23057684 GGCGGGGGCGGGGGCGGAGGCGG + Intergenic
1114523327 14:23352351-23352373 GACGCGGGCGGCGACGGACTGGG - Exonic
1115028400 14:28767499-28767521 GCCGGGGGCGGCGGCGGCGGCGG - Exonic
1115399160 14:32938868-32938890 CAGGCGACCGGCGGCGGCGGCGG - Intronic
1115399201 14:32938991-32939013 GGCGCAGGCGGCGGCGGAAGCGG + Intronic
1115851783 14:37595136-37595158 GGCGTGCGCGGCGGCGGCGGCGG + Intronic
1117141056 14:52791530-52791552 GGCGCGGGCGGTGGAGGAGGAGG - Exonic
1117176734 14:53153215-53153237 GACCCGAGCTGCGGCGGCAGCGG + Intronic
1117721988 14:58637753-58637775 GAAGAGAGCGGGGGAGGAGGCGG + Intronic
1118748537 14:68790865-68790887 GTCGCGGGCGGTGGCGGGGGCGG - Intronic
1118797016 14:69152986-69153008 GGCGCGAGCGGCGGCGGCGGCGG - Exonic
1118849838 14:69574666-69574688 GACGCTGGCGGCGGCAGATGGGG - Exonic
1119004159 14:70908430-70908452 GACGAGGGCCGCGGCGGGGGCGG - Intronic
1119322233 14:73738967-73738989 GGCGGGAGCGGCGGGGGAAGGGG + Exonic
1121417508 14:93789096-93789118 GGCGCTGGCGGCGGCGGCGGGGG - Intergenic
1122130729 14:99603451-99603473 GCCGCAAGCGGTGGCGGCGGCGG - Exonic
1122143375 14:99675235-99675257 GCGGCGGGCGGCGGCGGGGGCGG + Exonic
1122904570 14:104795808-104795830 GACGCCCCGGGCGGCGGAGGCGG - Intergenic
1122993302 14:105248988-105249010 GGCGCGGGCGGCGGCGGCGCTGG - Exonic
1123036557 14:105474218-105474240 GGCGCGGGCGGGGGCGGAGCGGG + Intronic
1123041294 14:105491324-105491346 GCCCCGGGCCGCGGCGGAGGCGG + Exonic
1123641024 15:22402946-22402968 GAAGCCAGCAGTGGCGGAGGTGG + Intergenic
1123684404 15:22786875-22786897 GAGGCGGGCGGCGGAGAAGGCGG + Intronic
1123898065 15:24848235-24848257 GGCGGGGGCGGCGGCGGGGGCGG + Intronic
1124014338 15:25863115-25863137 GGCGTGAGCGGCGGAGGAGCCGG - Exonic
1124501929 15:30236092-30236114 GAAGCCAGCGGCTGTGGAGGAGG + Intergenic
1124640364 15:31392823-31392845 GTCGCGGGCGGGGGCGGGGGCGG - Intronic
1124741636 15:32302560-32302582 GAAGCCAGCGGCTGTGGAGGAGG - Intergenic
1124929147 15:34101894-34101916 GCCGCCAGCGGCGGCGGTGGCGG - Exonic
1126113284 15:45187755-45187777 GGGGGGGGCGGCGGCGGAGGGGG - Intronic
1126736661 15:51737677-51737699 GGCGGCGGCGGCGGCGGAGGAGG - Exonic
1127144083 15:56007190-56007212 GATCCGGGCGGCGGCGGCGGCGG + Intergenic
1127165767 15:56243791-56243813 GGAGCGAGCGGCGGCGGCGGCGG - Intergenic
1127267988 15:57376543-57376565 GACGCGGGAGGAGGCGGCGGCGG + Exonic
1127515608 15:59689997-59690019 GGCGAGGGCGGAGGCGGAGGCGG + Intergenic
1128322516 15:66703331-66703353 GGCGGCAGCGGCGGCGGCGGTGG + Exonic
1128582253 15:68818488-68818510 GGCGCGGGTGGCGGAGGAGGGGG - Intronic
1130224242 15:82045650-82045672 AACGGCAGCGGCGGCGGCGGCGG - Exonic
1130224434 15:82046365-82046387 GGCGTTAGCGGCGGCGGGGGAGG - Intergenic
1130362964 15:83207692-83207714 AGCGCGCGCGGCGGCGGCGGCGG - Exonic
1132585956 16:705833-705855 GGCGCGCGCGGCGCCGGCGGCGG - Intronic
1132641871 16:981772-981794 GACCCGAGCCTCGGCGGCGGCGG + Intergenic
1132779025 16:1612814-1612836 GACGCGAGCCGGTGCGGAGCGGG + Intronic
1132834053 16:1943495-1943517 GGCGCGAGGGGCGGCAGGGGCGG - Intergenic
1132994760 16:2817222-2817244 GGCGCGAGAGGAGGCAGAGGGGG + Exonic
1133156456 16:3880144-3880166 GCCGCGGCCGGCGGCGGCGGCGG - Exonic
1133156576 16:3880487-3880509 GGCGGCAGCGGCGGCGGCGGCGG - Exonic
1133212872 16:4272863-4272885 GATGCTGGCGGCGGCGGCGGCGG + Exonic
1133924067 16:10180324-10180346 GCCGAGCGCGGCGGCGGAGAAGG - Exonic
1134134169 16:11668628-11668650 GGCGCGCGCGGCGGCGGGGCCGG + Intronic
1134164047 16:11915903-11915925 GACGACAGAGGCGGCGGCGGCGG + Exonic
1134419322 16:14071335-14071357 GGCGGGAGCGGCGGCGGCGGCGG + Intronic
1134849912 16:17470981-17471003 GACGCGGGCCGAGGCGGAGAGGG + Intergenic
1136365177 16:29806411-29806433 GGCCCGGGCGGCGGCGGCGGCGG - Intronic
1136365477 16:29807234-29807256 GGCGATAGTGGCGGCGGAGGCGG - Exonic
1136707670 16:32202524-32202546 GACGGGGGCGGGGGCGGAGCGGG + Intergenic
1136760240 16:32726886-32726908 GACGGGGGCGGGGGCGGAGCGGG - Intergenic
1136807864 16:33143500-33143522 GACGGGGGCGGGGGCGGAGCGGG + Intergenic
1137617263 16:49855506-49855528 GGCGGCGGCGGCGGCGGAGGGGG - Intronic
1137683270 16:50368965-50368987 CCCGAGAGCGGCGGCGGGGGGGG + Intergenic
1137738376 16:50742018-50742040 GGAGGGAGCGGGGGCGGAGGGGG - Intergenic
1137787577 16:51151308-51151330 AAATCGAGCGGCGGCGGCGGCGG + Intronic
1138667693 16:58586256-58586278 GAGGCGAGGGGAGGGGGAGGGGG + Intronic
1139534393 16:67562609-67562631 GGCGGCAGCGGCGGCGGCGGTGG + Exonic
1139590601 16:67930882-67930904 GAGGCGAGGGGCGGGGCAGGTGG + Intronic
1139917808 16:70439028-70439050 GACGGCGGCGGCGGCGGCGGCGG - Intronic
1139917809 16:70439031-70439053 GACGACGGCGGCGGCGGCGGCGG - Intronic
1140223032 16:73057985-73058007 GCCGGGAGCGGCGGGGGCGGGGG + Intronic
1140504812 16:75464569-75464591 GAGGGGAGCGGCGGCAGCGGCGG - Exonic
1140927582 16:79599196-79599218 GGCGGCGGCGGCGGCGGAGGCGG - Exonic
1141184737 16:81779295-81779317 GTAGCGAGCGCCGGCGGCGGAGG + Exonic
1141292021 16:82727082-82727104 GATGAGGGCGGCGGCGGTGGTGG + Intronic
1141608500 16:85169022-85169044 GACGCGGGGGGAGGCGGCGGCGG + Intergenic
1141682598 16:85553295-85553317 GCCGGCAGCGGCGGCGGCGGCGG - Intergenic
1141989604 16:87602549-87602571 GGCTCGGGCGGCGGCGGCGGCGG - Intronic
1141991425 16:87612782-87612804 GAGGCGGGCGGAGGCCGAGGAGG + Intronic
1142136267 16:88453307-88453329 GCGGCGAGCGGCGGAGCAGGCGG - Exonic
1203062394 16_KI270728v1_random:987208-987230 GACGGGGGCGGGGGCGGAGCGGG - Intergenic
1142611012 17:1109240-1109262 GACGCGCGAGGCGGCGGCGGCGG - Intronic
1143155357 17:4833180-4833202 GAAGTGGGCGGCGGCCGAGGCGG - Intergenic
1143443916 17:6996201-6996223 GACGCGCGGGGAGGCGGAGCTGG + Exonic
1143527224 17:7479606-7479628 GATGTCAGCGGCGGCGGCGGCGG - Intronic
1143548687 17:7615225-7615247 GGGGCCAGCGGCGGCGGAGTGGG - Intronic
1143590781 17:7885056-7885078 GGCGGGGGCGGCGGCGGCGGGGG - Exonic
1143750072 17:9021516-9021538 AGCGCGAGTGGCGGCGGCGGCGG + Intergenic
1144724542 17:17495261-17495283 GCCGGCAGCGGCGGCGGCGGCGG - Exonic
1146339609 17:32007676-32007698 GACGTGGGCGGCGGCGGCGGCGG - Intergenic
1146398560 17:32487009-32487031 GACGGCGGCGGCGGCGGCGGCGG - Exonic
1147702621 17:42405408-42405430 GACATGAGAGGCGTCGGAGGAGG + Intronic
1147943502 17:44066600-44066622 GCCGCGGCCGGCGGCGGCGGCGG + Exonic
1147990008 17:44326805-44326827 CGCGCGGGCGGTGGCGGAGGGGG + Intergenic
1148060083 17:44830171-44830193 GGCGGCAGCGGCGGAGGAGGTGG - Intronic
1148562437 17:48613667-48613689 GCCGCGGTCGGCGGAGGAGGAGG + Intronic
1148685354 17:49497577-49497599 GCCGCGCGCCGAGGCGGAGGCGG - Intronic
1148786836 17:50149732-50149754 GGGGCGGGCGGCGGCGGCGGCGG + Exonic
1149430616 17:56593727-56593749 GACTCCAGCGGCGGCGGCGGCGG - Exonic
1149486340 17:57045896-57045918 GCCGCGTGGGGAGGCGGAGGCGG - Intergenic
1150407973 17:64919164-64919186 GACGTGGGCGGCGGCGGCGGCGG + Intronic
1150488805 17:65560959-65560981 GAGTCGTGCGGCGGGGGAGGGGG + Intronic
1150624821 17:66835086-66835108 GGCGCGAGCTGCGGCGGCGGCGG + Intergenic
1150627230 17:66849333-66849355 GACGGGAGGGGCAGAGGAGGAGG + Intronic
1150692377 17:67377489-67377511 GAGCCGAGCGGCGGCGGCGGCGG + Intronic
1150747248 17:67825800-67825822 GACGTGGGCGGCGGCGGCGGTGG - Exonic
1150791895 17:68205762-68205784 GACTTGGGCGGCGGCGGCGGCGG - Intergenic
1150791966 17:68205968-68205990 GGCGGGGGCGGCGGCGGCGGCGG + Intergenic
1151153804 17:72110429-72110451 TATGCGCGCGGCGGCGGGGGAGG + Intergenic
1151370871 17:73645325-73645347 GCCGGGAGGGGCGGCGGCGGCGG + Intergenic
1152175130 17:78782275-78782297 GAGGCGAGCGGGGGCGCGGGTGG - Exonic
1152197375 17:78925491-78925513 GGCGCGGGCGGAGGGGGAGGAGG - Intergenic
1152225408 17:79090472-79090494 GAGCCCAGCGGCGGCGGAGCAGG - Intronic
1152362540 17:79839349-79839371 GGGGCGAGCGGCGGCGGCGGCGG - Exonic
1152552143 17:81035194-81035216 GACGCAAGCGGCGGCAGCAGCGG - Exonic
1152924156 17:83079885-83079907 AGCGGGAGCGGCGGCGGGGGCGG - Exonic
1153489113 18:5629924-5629946 GAGGCAAGAGGGGGCGGAGGAGG + Intronic
1153794403 18:8609497-8609519 GGCGGCAGCGGCGGAGGAGGAGG + Exonic
1153805384 18:8705591-8705613 GACGGCGGCGGCGGCGGCGGCGG - Intergenic
1153805385 18:8705594-8705616 GACGACGGCGGCGGCGGCGGCGG - Intergenic
1153872744 18:9335161-9335183 GACGCGGGCTGCGGAGGACGCGG - Intronic
1154266574 18:12883975-12883997 GAGGCGAGAGGCGGGGGAGGCGG + Intronic
1154270005 18:12911119-12911141 GGCGCGAGCGGGAGCGGAAGCGG + Intronic
1155007511 18:21741529-21741551 GGCGGCAGCGGCGGCGGCGGCGG + Exonic
1155392495 18:25351151-25351173 GACGGCGGCGGCGGCGGCGGCGG + Intronic
1155392742 18:25352367-25352389 GGCGCGAGGGGCGGCGGCGCAGG - Intergenic
1155570337 18:27185351-27185373 GGCGGGAGCGGGCGCGGAGGCGG - Intergenic
1155654340 18:28177067-28177089 GGCGGCGGCGGCGGCGGAGGAGG + Exonic
1155654572 18:28178002-28178024 GGCGAGGGCGGCGGCGGCGGCGG - Intergenic
1156275827 18:35581835-35581857 TAGGCGCGCGGCGGCGGCGGCGG - Intronic
1156488368 18:37481115-37481137 GACGCGAGGGGAGGGGAAGGGGG + Intronic
1157383934 18:47247073-47247095 GGCGGGGGCGGCGGCGGCGGCGG + Intronic
1157473711 18:48008376-48008398 GCCGGGAGGGGCGGGGGAGGTGG - Intergenic
1157753023 18:50195019-50195041 GTTGCGAGCGCCGGGGGAGGAGG + Exonic
1157849134 18:51030707-51030729 GACGACGGCGGCGGCGGCGGCGG + Intronic
1157849135 18:51030710-51030732 GACGGCGGCGGCGGCGGCGGCGG + Intronic
1158150159 18:54358305-54358327 GTCGCGGGACGCGGCGGAGGGGG + Intronic
1158435998 18:57435837-57435859 GGCGGGGGCGGCGGCGGGGGCGG + Exonic
1158954143 18:62523557-62523579 CCCGCGGGCGGCGGCGGCGGCGG - Exonic
1160680318 19:409109-409131 GATGCGGGCGGCGGCGGCGGCGG + Exonic
1160690245 19:458217-458239 GACGCGGGTTCCGGCGGAGGGGG + Intronic
1160715007 19:572578-572600 GCCGCGGGCGGCGGCGGCAGCGG + Exonic
1160719167 19:590012-590034 GGCGCGGGCGGCGGCGGCGGCGG - Exonic
1160719181 19:590051-590073 GGCGCGGGCGGCGGCGGCGGCGG - Exonic
1160769107 19:822282-822304 GACGGGGGCGGAGGCGGGGGCGG + Intergenic
1160829259 19:1095324-1095346 GGTGCGAGCGGCGGCGGCGGCGG - Exonic
1160873173 19:1286089-1286111 GGCGGCGGCGGCGGCGGAGGAGG + Intergenic
1160887055 19:1354978-1355000 GCGGGGAGCGGCGGCGGCGGCGG + Intronic
1160909002 19:1466249-1466271 CACGCGGGCGTCGGCGGAGGTGG - Exonic
1160930589 19:1568000-1568022 GGCGGGGGCGGCGGCGGCGGCGG - Exonic
1160948220 19:1653071-1653093 GCCGCGAGAGGCGGCCGGGGTGG + Intergenic
1160967696 19:1753825-1753847 GACGGCGGCGGCGGCGGCGGCGG + Exonic
1161051072 19:2164305-2164327 GTCCCCAGGGGCGGCGGAGGAGG - Intronic
1161215798 19:3094557-3094579 GCGGCGGGCGGCGGCCGAGGCGG + Exonic
1161688975 19:5719903-5719925 GAAGCGAGCAGCCGCGGCGGAGG - Exonic
1161779200 19:6279896-6279918 GCCGGGATCGGCGGCGGCGGCGG - Exonic
1162021159 19:7869235-7869257 GCCGCGGGCGGCAGCGGCGGGGG - Exonic
1162470937 19:10871702-10871724 GATGGCAGCGGCGGCGGCGGCGG + Exonic
1162497955 19:11034037-11034059 GAGGCGAGCGGCGGCGTCCGTGG - Intronic
1162778644 19:12995570-12995592 GGCGGCAGCGGCGGCGGCGGCGG + Intergenic
1162778651 19:12995607-12995629 GGCGAGCGCGGCGGCGGCGGCGG + Exonic
1162954503 19:14090784-14090806 CGCGCGTGCGGCGGCGGCGGCGG - Intronic
1163452388 19:17386072-17386094 GACGCCAGGGCCGGGGGAGGTGG + Intergenic
1163636959 19:18441458-18441480 GACGGGAGCGGCGGTGGTGCAGG - Intergenic
1163743892 19:19033489-19033511 GCCTCGCGCGGCGGCGGCGGCGG - Intronic
1164594640 19:29525395-29525417 GACGGCAGGGGCGGCGGGGGTGG - Intergenic
1164658554 19:29942390-29942412 GACGCGAACAGCAGCGGCGGCGG + Exonic
1164723010 19:30445648-30445670 GAGGAGAGCGGGGTCGGAGGCGG + Exonic
1165236799 19:34428401-34428423 ACCACGAGCCGCGGCGGAGGCGG - Exonic
1165349522 19:35268522-35268544 CGCGCGCGCGGCGGCGGCGGCGG - Intergenic
1165493944 19:36141117-36141139 GCCGGGGGCGGCGGCGGCGGCGG + Exonic
1165803159 19:38565278-38565300 GGCGCGTGCGGCGGCTGCGGCGG + Exonic
1165850859 19:38849701-38849723 GCGGCGGGCGGCGGCGGCGGTGG - Exonic
1165928609 19:39342441-39342463 GACGGCGGCGGCGGCGGCGGCGG + Intronic
1165928641 19:39342540-39342562 GGCCCGAGCGGCGGCGGTGGCGG + Exonic
1166100360 19:40567983-40568005 GACCCCCGCGGCGGCGGAGCAGG + Exonic
1166105962 19:40598204-40598226 AACCCGAGCCGCGGCGGGGGCGG + Intronic
1166219132 19:41353902-41353924 GGCGCGAAGGGCGGCGGCGGCGG + Exonic
1166306905 19:41940413-41940435 GGGGCGCGCGGCGGCGGGGGAGG - Intergenic
1166546997 19:43639801-43639823 GGAGCGAGCGGCGGCGGCGGCGG - Exonic
1166750612 19:45162494-45162516 GATGCGAGCGGGGTGGGAGGGGG + Intronic
1166888256 19:45973956-45973978 GGCGCGGGCGGCGGCGGCGACGG + Intergenic
1167369656 19:49072836-49072858 GGCGCGGGCGGCGGCGGCGGCGG - Exonic
1167456152 19:49597465-49597487 GGCGCGGGAGGCGGCGGTGGCGG - Exonic
1167488286 19:49776194-49776216 GATGCGGGCGGCGGCGGGGGCGG - Intronic
1167578329 19:50328316-50328338 GACGCGGGCGGCGGCGCCGGGGG - Exonic
1167578503 19:50328994-50329016 GACTCGGGCGGCTGCGGCGGTGG + Exonic
1167649081 19:50719734-50719756 GGAGCGGGCGGCGGCGGCGGCGG - Intergenic
1168076347 19:53982598-53982620 GCCGGGGGCGGCGGCGGAGGCGG + Exonic
1168297434 19:55384263-55384285 GGCGCCAGCGGCGGCGGTGCAGG - Exonic
1168564973 19:57415138-57415160 GACACGAGTGGCGGCTGTGGAGG + Intronic
1168721766 19:58558386-58558408 GGCGGCAGCGGCGGCGGCGGCGG - Exonic
926090027 2:10043623-10043645 GCTGCGGGCGGCGGCGGCGGCGG - Exonic
926154899 2:10448288-10448310 GCGGCGGGCGGCGGCGGCGGCGG + Exonic
927652486 2:24920603-24920625 GAAGGAAGCCGCGGCGGAGGAGG - Intergenic
927679255 2:25129317-25129339 GACGGGGGCGGGGGCGGGGGCGG + Intronic
927887589 2:26728188-26728210 CAGGCGGGCGGCGGCGGAGGGGG + Exonic
929174234 2:38960557-38960579 GCCGCGGGCGGCGACGGCGGCGG - Exonic
929218118 2:39437125-39437147 GAGGGGAGCGGCGGCGGCGGCGG - Exonic
931253669 2:60553281-60553303 GGGGCGGGCGGCGGCGGCGGCGG + Exonic
932231500 2:70087559-70087581 GGGGCGGGCGGCGGCGGCGGAGG - Exonic
933684713 2:85133700-85133722 GGCGGGGGCGGCGGCGGCGGCGG + Exonic
935463060 2:103361904-103361926 GAGGCGGGAGGAGGCGGAGGCGG - Intergenic
935463066 2:103361920-103361942 GAGGCGGGAGGAGGCGGAGGCGG - Intergenic
935592452 2:104855317-104855339 GGCGGAGGCGGCGGCGGAGGAGG + Intergenic
935592612 2:104855824-104855846 GGCGGCAGCGGCGGCGGCGGCGG - Exonic
935592699 2:104856106-104856128 GAGGTGCGCGGCGGCGGCGGCGG - Exonic
935592903 2:104857101-104857123 GGCGGCAGCGGCGGCGGCGGCGG - Exonic
936122683 2:109760395-109760417 GGCGGGGGCGGCGGCGGCGGCGG + Intergenic
936122698 2:109760436-109760458 GCCGGGGGCGGCGGCGGCGGCGG + Intergenic
936222010 2:110611078-110611100 GGCGGGGGCGGCGGCGGCGGCGG - Intergenic
938273021 2:129992524-129992546 GAGGCCAGCGCCGGCGGCGGCGG + Intergenic
938406244 2:131034875-131034897 GGCGGGGGCGGCGGCGGCGGCGG - Intronic
938443203 2:131353582-131353604 GAGGCCAGCGCCGGCGGCGGCGG - Intronic
939613028 2:144332563-144332585 GACGCGCCCGGAGGCCGAGGCGG - Intronic
939629682 2:144516947-144516969 GGCGCGAGCGGAGCGGGAGGCGG + Intronic
939900453 2:147844417-147844439 GGCGGCAGCGGCGGCGGCGGCGG - Intergenic
941029317 2:160493452-160493474 GGCGGCAGCGGCGGCGGCGGCGG + Exonic
941686848 2:168456326-168456348 GGCGGGAGCAGCGGCGGCGGCGG + Exonic
942278201 2:174337465-174337487 GGCGGCAGCGGCGGCGGCGGCGG + Exonic
942965867 2:181891932-181891954 GAAGCGGGCGCCGGAGGAGGAGG - Exonic
943060533 2:183038113-183038135 GAGGCGGCCGGCGGCGGCGGCGG - Exonic
943669861 2:190649078-190649100 CGCGCGGGCGGCGGCGGCGGCGG - Intronic
944715932 2:202376260-202376282 GGCGGAGGCGGCGGCGGAGGCGG + Intergenic
946019855 2:216633599-216633621 GGCGCGAGTGGCGGCGGCGGCGG + Exonic
946692487 2:222319763-222319785 GGCGGCAGCGGCGGCGGCGGCGG + Intergenic
946921434 2:224585171-224585193 GGCGGGGGCGGCGGCGGCGGCGG + Exonic
947212079 2:227717768-227717790 CACGCGGGCTGCGGCGTAGGGGG + Intronic
947549784 2:231037838-231037860 GGCGGGGGCGGCGGCGGCGGCGG + Exonic
947593079 2:231395969-231395991 GGCGGGCGCGGCGGCGGCGGCGG + Intronic
948207006 2:236167778-236167800 AGCGCGGGCGGCGGCGGCGGCGG + Exonic
949004410 2:241637190-241637212 GACGCGGGCGGGGGCTGGGGCGG - Exonic
1168753135 20:297776-297798 GAGGAAAGCGGCGGCGGTGGAGG + Exonic
1169065563 20:2692798-2692820 CCCGGGAGCGGCGGCGGCGGCGG + Intergenic
1169849543 20:10034867-10034889 GGCGCGAGGGGCGGAGGCGGAGG + Intronic
1169849554 20:10034888-10034910 GGCGGGGGCGGGGGCGGAGGCGG + Intronic
1169849556 20:10034894-10034916 GGCGGGGGCGGAGGCGGAGGCGG + Intronic
1170674522 20:18467008-18467030 AACCCGGGCGGCGGCGAAGGAGG - Exonic
1172073666 20:32277728-32277750 AAAGCGGGCGGCGGCGGCGGCGG - Exonic
1172117979 20:32583313-32583335 GGCCCGGGCGGCCGCGGAGGGGG + Intronic
1172331162 20:34077054-34077076 GGCGCCGGCGGCGGCGGCGGTGG + Exonic
1172474529 20:35226885-35226907 CGCGCGGGCGGCGGCGGCGGCGG + Exonic
1173548167 20:43914869-43914891 GGCGGGCGCGGCGGCGGCGGCGG - Exonic
1174357821 20:50010099-50010121 GCCGGCAGCGGCGGCGGCGGCGG + Intergenic
1174467765 20:50731007-50731029 GGCGCGAGCCCCGGCGGAGCCGG + Intergenic
1175340937 20:58228605-58228627 GCGGCGGGCGGCGGCGGGGGCGG - Exonic
1175399540 20:58692758-58692780 GCCCGGAGCGGCGGGGGAGGCGG + Exonic
1175470263 20:59222418-59222440 GGCGCCGGCGGGGGCGGAGGGGG - Intronic
1175804610 20:61820572-61820594 GAGGGGAGCTGAGGCGGAGGGGG + Intronic
1175847372 20:62065827-62065849 GGCCCGAGCGGCGGCGGCGGCGG - Intergenic
1176157013 20:63627002-63627024 GTCGGGAGCTGCGGCGGCGGCGG + Intronic
1179213728 21:39349106-39349128 GACGCGGGGGGAGGAGGAGGCGG - Exonic
1179437168 21:41369834-41369856 GGCGGGAGCGGGGGCGGGGGCGG - Intronic
1179603397 21:42496244-42496266 GACGCGGGACGCGGCGGTGGAGG - Exonic
1179674890 21:42974689-42974711 GGCGAGAGCGGCGGCGGCGGCGG - Intronic
1179674911 21:42974755-42974777 GACCCGGGCGGCAGCGGCGGCGG - Intronic
1179675071 21:42975205-42975227 GGGGCGCGCGGCGGCGCAGGCGG + Intronic
1180559226 22:16601979-16602001 AACCCGAGCAGCGGCGGCGGCGG + Intergenic
1180949413 22:19714464-19714486 GGAGCGGGCGGCGGCGGCGGCGG + Exonic
1180960691 22:19761057-19761079 TAGGCGTGCGGCGGCGGCGGCGG - Exonic
1181478093 22:23180835-23180857 GGCCCGCGCGGCGGCGGCGGCGG - Exonic
1181934618 22:26429606-26429628 GGCGGGGGCGGCGGCGGCGGCGG - Intronic
1182137457 22:27919228-27919250 GGCGGTAGCGGCGGCGGCGGCGG - Exonic
1182237000 22:28883805-28883827 GGCGCAGGCGGCGGCGGCGGCGG - Exonic
1182445499 22:30387252-30387274 GACGGAGGCGGCGGCGGAGGCGG + Exonic
1182485350 22:30635690-30635712 GGAGCGGGCGGCGGCGGGGGAGG + Exonic
1183427204 22:37746304-37746326 GCCGAGAGGGGCGGCGGCGGCGG + Intronic
1183553352 22:38506165-38506187 GACGAGAGAGGCGGCGACGGTGG - Exonic
1184276463 22:43411897-43411919 GAGGCGGGCGGCGGCGGGCGGGG + Intronic
1184767036 22:46577400-46577422 GGCCCGGGCGGCGGCGGCGGCGG - Intronic
1184796918 22:46738145-46738167 GACGAGCCCGGCGGCGGAGATGG - Exonic
1184891019 22:47379234-47379256 GAAGGAGGCGGCGGCGGAGGAGG + Intergenic
1184891040 22:47379300-47379322 GGCGGAGGCGGCGGCGGAGGAGG + Intergenic
1185055288 22:48575924-48575946 AGCGCGGGCGGCGGAGGAGGCGG + Intronic
1185278855 22:49961378-49961400 GGCACGGGCGGCGGCGGCGGCGG + Intronic
950054008 3:10011209-10011231 GCGGCGAGCGGCGGCGGGCGGGG - Intergenic
950729786 3:14947607-14947629 CGCGCGGGCGGCGGCGGCGGCGG + Intronic
951078571 3:18425346-18425368 GGCGGCGGCGGCGGCGGAGGAGG + Intronic
951208326 3:19947271-19947293 GGCGGCGGCGGCGGCGGAGGAGG + Exonic
952867189 3:37862000-37862022 GAGCCCAGCGGCGGCGGCGGCGG + Intronic
953350266 3:42210071-42210093 GCCGCCAGCGGCCACGGAGGAGG + Intronic
953672652 3:44975979-44976001 GAAGGCAGCGGCGGCGGCGGCGG - Exonic
953705058 3:45225164-45225186 GGCGGCAGCGGCGGCGGCGGCGG + Exonic
954025662 3:47781548-47781570 CACGCGACCGGGGCCGGAGGCGG - Intronic
954333551 3:49903493-49903515 GTCGCGAGAGGCCGCGTAGGGGG + Exonic
954558787 3:51538798-51538820 GGCGGGGGCGGCGGCTGAGGCGG - Intergenic
955769246 3:62372549-62372571 CGGGCGGGCGGCGGCGGAGGCGG - Exonic
955911537 3:63863791-63863813 GGCGTGCGCGGCGGCGGCGGCGG + Exonic
959085799 3:101849650-101849672 GACGACAGCCGCGGCGGAGAGGG + Exonic
959849670 3:111071779-111071801 GAGGGGAGTGGCGGCGGCGGCGG + Exonic
959849824 3:111072388-111072410 GACCCGCGCGGCCGCGGGGGAGG - Intronic
960664121 3:120094034-120094056 GAGGCGGGCGGTGGCGGTGGCGG + Intronic
960664216 3:120094379-120094401 GGCCCGGGCGGCGGCGGCGGCGG + Intronic
963038377 3:141051391-141051413 GGAGCGGGCGGCGGCGGCGGAGG + Exonic
964570777 3:158105804-158105826 GGCGGAGGCGGCGGCGGAGGAGG - Exonic
964570784 3:158105825-158105847 GGCGGAGGCGGCGGCGGAGGAGG - Exonic
965166224 3:165196485-165196507 GACGCTCGCGGCGGCGGCGGCGG + Intronic
966182197 3:177197557-177197579 GAGGCCCGCGGCGGCGGCGGCGG + Intergenic
967184228 3:186931208-186931230 GAGGCCCGCGGCAGCGGAGGGGG + Intronic
967859680 3:194141536-194141558 GGAGCGGGCGGCGGCGGCGGCGG + Intergenic
967924186 3:194633381-194633403 GGCGCGGGCGGCGGCGGCGAAGG + Exonic
968066364 3:195761779-195761801 AACGCGGGCAGCGGTGGAGGAGG + Intronic
968701293 4:2059381-2059403 GGCGGCAGCGGCGGCGGCGGCGG - Intergenic
968850577 4:3075024-3075046 GGCGGGGGCGGCGGCGGGGGCGG - Exonic
968965561 4:3767524-3767546 GCGGCGAGCGGGCGCGGAGGGGG + Exonic
970333007 4:15003718-15003740 CACCCGGGCGGCGGCGGCGGCGG + Exonic
970333130 4:15004165-15004187 ATGGCGGGCGGCGGCGGAGGGGG - Exonic
970823944 4:20252003-20252025 GGCGGCGGCGGCGGCGGAGGCGG + Intergenic
971196142 4:24472674-24472696 GGCGGCAGCGGCGGCGGCGGCGG - Intergenic
971451366 4:26804664-26804686 GGCGGGAGCAGCCGCGGAGGCGG + Intergenic
971757590 4:30722059-30722081 GGCGCGAGCGGCGGCGGCTCGGG + Exonic
971876971 4:32319461-32319483 GATGCCAGCTGCAGCGGAGGAGG - Intergenic
972265341 4:37454009-37454031 GACGGCGGCGGCGGCGGCGGCGG - Intronic
972765811 4:42151776-42151798 GACGCGGGCGGCGGCTGCGCCGG + Exonic
972765859 4:42151953-42151975 GGCGCGAAGGGCGGCGGGGGCGG + Exonic
973027044 4:45284940-45284962 GACGCTGGCGGCAGCAGAGGAGG - Intergenic
975342536 4:73258370-73258392 GACAACAGCGGCGGCGGTGGAGG - Exonic
975985958 4:80202066-80202088 CACGGGGGCGGCGGCGGCGGTGG + Exonic
977809935 4:101346974-101346996 GAAGGCGGCGGCGGCGGAGGAGG - Exonic
977810065 4:101347529-101347551 GGCGGCGGCGGCGGCGGAGGGGG - Intronic
978072574 4:104491423-104491445 GGCGGCGGCGGCGGCGGAGGCGG - Exonic
978072584 4:104491453-104491475 GGCGGGGGCGGCGGCGGGGGGGG - Exonic
978072623 4:104491551-104491573 GATGCGCGCGGCGGCCGCGGCGG + Exonic
980130070 4:128809981-128810003 GACGGCGGCGGCGGCGGCGGCGG + Intronic
982115991 4:152098866-152098888 GAGGCGAGAGGAGGCGGAGCTGG - Intergenic
984778848 4:183505831-183505853 GGGGCGAGAGGCCGCGGAGGCGG + Intronic
985532685 5:443224-443246 GGCGGGGGCGGCGGCGGCGGCGG + Exonic
985628908 5:1004905-1004927 GAAGCGGGCGGCGGCGGGCGCGG - Intergenic
985896183 5:2751177-2751199 GAAGCCGGCGGCGGCGGCGGCGG + Exonic
986748105 5:10761402-10761424 GGCGGGGGCGGGGGCGGAGGAGG + Intergenic
987132379 5:14871716-14871738 GACGGCGGCGGCGGCGGCGGCGG + Exonic
987373816 5:17217180-17217202 GAGGAGAGGGGAGGCGGAGGGGG + Intronic
989565135 5:42894279-42894301 GATGCCAGCGCCTGCGGAGGTGG + Intergenic
989565732 5:42899143-42899165 GATGCCAGCGCCTGCGGAGGTGG - Intergenic
989573874 5:42971301-42971323 GATGCCAGCGCCTGCGGAGGTGG + Intergenic
989584783 5:43066371-43066393 GACGCCAGCGGCGCCGCCGGGGG + Intronic
990557750 5:56952203-56952225 CACCCGCCCGGCGGCGGAGGCGG + Intronic
990825427 5:59893354-59893376 GCCCCGGGCGGCGGCGGGGGCGG + Exonic
990955115 5:61332687-61332709 GACGACAGCGGTGGCGGCGGCGG + Exonic
990955122 5:61332708-61332730 GGCGCGGGCGGCGGCGGCGGCGG + Exonic
991584208 5:68186175-68186197 GACGCGAGGGGCGGTGGGGCTGG - Intergenic
993457372 5:88141740-88141762 GGCGGGGGCGGGGGCGGAGGCGG - Intergenic
993726946 5:91380217-91380239 GGCGGCAGCGGCGGCGGCGGCGG - Intronic
993900975 5:93584315-93584337 GGCGGCGGCGGCGGCGGAGGAGG - Exonic
993901116 5:93584824-93584846 GGCGGCAGCGGCGGCGGCGGCGG + Exonic
994072826 5:95620849-95620871 GACGTTGGCGGCGGCGGCGGCGG - Exonic
995106329 5:108381296-108381318 GGCGGCAGCGGCGGCGGCGGCGG + Exonic
995224954 5:109690754-109690776 GCGGCGTGCGGCGGCGGCGGCGG + Intronic
995512454 5:112922338-112922360 GGGGCGCGCGGCGGCCGAGGAGG - Exonic
995650364 5:114362185-114362207 GAGGAGCGCGGCGGCGGCGGCGG - Exonic
996978489 5:129461458-129461480 GACGGGGGCGGCTGCGGGGGAGG - Exonic
998143230 5:139711334-139711356 GACGCGCTCGGCGGCGGCGGCGG - Intergenic
998467456 5:142357173-142357195 GAACCGGGCGGGGGCGGAGGAGG - Intergenic
999038743 5:148383934-148383956 TATGCGAGCGGCGGCGGAAGCGG + Intronic
1000279897 5:159773401-159773423 GACGTCTGCGGCGGCGGCGGCGG + Intergenic
1002140236 5:177133530-177133552 GCCGCGAGCGGGCGCGCAGGGGG + Intronic
1002352039 5:178590124-178590146 GCGGCGGGCGGCGGCGGCGGAGG - Exonic
1002455901 5:179345222-179345244 TTCGCGGGCGGCGGCGGCGGCGG + Exonic
1002525332 5:179812467-179812489 GATGCCAGCGCCTGCGGAGGTGG - Intronic
1002691372 5:181053005-181053027 GGCGCGCGCGGCGGAGGGGGCGG - Intronic
1002763602 6:220021-220043 GAAGCGAGCGGGGGTGCAGGCGG - Intergenic
1002927344 6:1611900-1611922 GGCGAGCGCGGCGGCGGCGGCGG + Exonic
1004216776 6:13711237-13711259 GGCGGGGGCGGCGGCGGGGGCGG + Exonic
1004216791 6:13711273-13711295 GCCGGGGGCGGCGGCGGCGGAGG + Exonic
1004395896 6:15246052-15246074 AACTCCAGCGGCGGCGGCGGCGG - Intergenic
1004658378 6:17686883-17686905 GGGGCGGGCGGCGGGGGAGGGGG + Intronic
1004709379 6:18155430-18155452 GGCGGAAGCGGCGGCGGCGGCGG + Exonic
1004924049 6:20402366-20402388 GGCGGCAGCGGCGGCGGCGGCGG - Exonic
1004924116 6:20402596-20402618 GGCGGCAGCGGCGGCGGCGGCGG + Exonic
1005040165 6:21594406-21594428 GACGCGCGCGGCGGCCGAACTGG - Exonic
1005987702 6:30884626-30884648 GGGGCGAGGGGCGGGGGAGGCGG - Intronic
1006304130 6:33208668-33208690 GGCGGGAGCGGGGGCGGAGAGGG + Intronic
1006535659 6:34696812-34696834 GAGGCGAGAGGCGGCGGAGGCGG - Exonic
1006535667 6:34696846-34696868 GGCGCGGGAGGAGGCGGAGGCGG - Exonic
1006558574 6:34889535-34889557 GGCGGCAGCGGCGGCGGCGGCGG + Exonic
1007521127 6:42452391-42452413 GACGCGGGCGGGGGCCGAGGCGG - Intergenic
1007702215 6:43771901-43771923 GACGCGAGCGGGGACGGGCGGGG - Intronic
1007739499 6:44002252-44002274 GGCGCGGGCGGCGGGGGAGAAGG - Intronic
1007784200 6:44270776-44270798 GCCGCCGGCGGCGGCGGCGGCGG + Exonic
1008886231 6:56433402-56433424 GAAGAAGGCGGCGGCGGAGGCGG - Intergenic
1009808828 6:68635558-68635580 GAAGTGACCGGCGGCGGCGGCGG - Exonic
1010204492 6:73310202-73310224 GGAGCGAGCGGCGGAAGAGGCGG - Exonic
1011418914 6:87152046-87152068 TTCGCGGGCGGCGGCGGCGGCGG + Intergenic
1012100696 6:95083448-95083470 GACGCCAGCTGCAGCGGGGGAGG + Intergenic
1012133083 6:95520132-95520154 GACGCTAGCTGCAGCGGGGGAGG - Intergenic
1012400020 6:98835111-98835133 GGCGGGGGCGGCGGCGGGGGCGG + Exonic
1012887256 6:104859847-104859869 GGCGCGAGCAGAGGCGGCGGCGG - Exonic
1013170830 6:107635080-107635102 GGCGCGGGCGGCGGCGGCGGCGG - Exonic
1013793682 6:113860422-113860444 GCCGGGCCCGGCGGCGGAGGGGG - Exonic
1013836601 6:114342415-114342437 CACGCAGGCGGCGGCGGCGGCGG + Exonic
1014029109 6:116681106-116681128 GGCGGCGGCGGCGGCGGAGGAGG - Intergenic
1014137542 6:117907194-117907216 GGCGCCGGCGGCGGCGGCGGCGG - Intergenic
1014137624 6:117907479-117907501 GGGGCGGGCGGCGGCGGCGGCGG + Intergenic
1014521291 6:122445560-122445582 GAAGGGAGGGGCGGGGGAGGGGG - Intronic
1014913375 6:127118838-127118860 CGGGCGAGCGGCGGCGGCGGCGG - Exonic
1016010750 6:139135501-139135523 GGCGGGAGCGGCGGCCGGGGGGG + Exonic
1017672282 6:156778842-156778864 GGCGCGGGCGGCGGCGGCGGCGG + Exonic
1017672287 6:156778857-156778879 GGCGGCGGCGGCGGCGGAGGAGG + Exonic
1017695297 6:157008741-157008763 TACGGGATCGGCGGGGGAGGGGG + Intronic
1017842350 6:158232209-158232231 GACGCGGGGGGAGGCGGCGGCGG + Intergenic
1018984500 6:168625879-168625901 GAGGCGAGGGGCCTCGGAGGAGG + Intronic
1019111927 6:169724009-169724031 GGCCCGCGCGGCGGCGGCGGCGG - Exonic
1019279674 7:193414-193436 GTCGCCGGCGGCGGAGGAGGCGG - Exonic
1019308239 7:346588-346610 GCCCCGGGCGGCGGCGGTGGTGG - Intergenic
1019308259 7:346656-346678 GCCCCGGGCGGCGGCGGTGGTGG - Intergenic
1019308278 7:346723-346745 GCCCCGGGCGGCGGCGGTGGTGG - Intergenic
1019828226 7:3301272-3301294 GGCGGGGGCGGCGGCGGCGGCGG + Intergenic
1020034902 7:4958951-4958973 GAGGTGAGCGGCGGCCGCGGAGG - Exonic
1020274294 7:6615499-6615521 GACGGCGGCGGCGGCGGCGGGGG + Intergenic
1021717313 7:23471298-23471320 ACCGCGAGCGCAGGCGGAGGCGG - Intergenic
1022101955 7:27174143-27174165 GGCGCGGGGGGCGGCGGCGGTGG - Exonic
1023881935 7:44325662-44325684 GGCGGGCGCGGCGGCGGCGGCGG - Intronic
1024043862 7:45574562-45574584 GGCGGAGGCGGCGGCGGAGGCGG + Exonic
1025069777 7:55887834-55887856 GCGGCGGGCGGCGGCGGCGGCGG + Intronic
1025069786 7:55887857-55887879 GCGGCGGGCGGCGGCGGCGGCGG + Intronic
1025069795 7:55887882-55887904 GCGGCGGGCGGCGGCGGCGGCGG + Intronic
1025992483 7:66506276-66506298 GAGGCGGGCGGCGACCGAGGCGG - Intergenic
1026006891 7:66607124-66607146 GGAGCGGGCAGCGGCGGAGGCGG - Intergenic
1026360534 7:69598380-69598402 GAGGCGGGCGGCGGCGGCGGCGG + Intergenic
1027774156 7:82443833-82443855 GGCGGGGGCGGGGGCGGAGGAGG + Intergenic
1029238794 7:99144023-99144045 GGCGGAGGCGGCGGCGGAGGCGG - Exonic
1029896493 7:103989710-103989732 GACACGTGTGGCGGCGGCGGGGG - Intergenic
1030093312 7:105876621-105876643 GAGGAGGGCGGCGGAGGAGGAGG + Intergenic
1030138734 7:106284667-106284689 GGCGCGGGCGGCGGCGGCTGGGG - Intronic
1031134834 7:117873337-117873359 GGCGGGGGCCGCGGCGGAGGCGG - Exonic
1031586340 7:123535129-123535151 GAGGCGAGCGGGCGTGGAGGAGG + Intergenic
1033253187 7:139777814-139777836 GGCGGCAGCGGCGGCGGCGGCGG - Intronic
1033299993 7:140176913-140176935 GGCCGGAGCGGCGGCGGCGGTGG - Exonic
1034267940 7:149790185-149790207 GAGGGGAGCAGCGGCGGAGGTGG + Intergenic
1034469791 7:151248993-151249015 GACGCCAGGGGAGGCGGCGGGGG + Intronic
1034483541 7:151341737-151341759 GGCGACAGCGGCGGCGGGGGCGG + Exonic
1034494187 7:151410224-151410246 GACCCAGGCGGCGGCGGCGGAGG - Intronic
1035169536 7:157009943-157009965 GCCCCCAGCGGCGGCGGCGGCGG + Exonic
1035169565 7:157010037-157010059 GGCGCGGGCGGCGGCGGCGGCGG - Exonic
1035323122 7:158046995-158047017 GAGGCGAGCGGCTGCGAGGGAGG + Intronic
1037273722 8:17156483-17156505 GCTGCGAGCGGAGGCCGAGGAGG - Exonic
1037273793 8:17156680-17156702 CCCGCGGGCGGCGGCGGAGCTGG + Exonic
1037297119 8:17413240-17413262 GACACCAGCGCGGGCGGAGGAGG - Intronic
1037535155 8:19817117-19817139 GTCGGGGGCGGGGGCGGAGGCGG - Intergenic
1037901771 8:22692978-22693000 GGAGCGAGCGGCGGCGGTGGCGG - Exonic
1037901906 8:22693395-22693417 GGCGGCAGCGGCGGCAGAGGCGG - Intergenic
1037902298 8:22695092-22695114 GGCGGGAGAGGCGGCGGGGGTGG - Intergenic
1038828554 8:31033190-31033212 AGTGCGAGCGGCGGCGGCGGGGG - Exonic
1039454399 8:37697670-37697692 GCCGTGAGCCGCGGCGGCGGTGG + Exonic
1039542299 8:38382229-38382251 GGCGGGAGAGGCGGCGGCGGCGG - Exonic
1039889435 8:41674113-41674135 GCCCCGAGCGGAGGCTGAGGGGG - Intronic
1039910471 8:41822855-41822877 CACGAGAGCGGGGGCGGTGGAGG + Intronic
1040038834 8:42896742-42896764 GGCGGCAGCGGCGGCGGCGGCGG + Intronic
1041059498 8:54022270-54022292 GAAGCCCGCGGCGGCGGCGGCGG + Exonic
1041280997 8:56211311-56211333 GACGTCGGCGGCGGCGGCGGCGG - Intronic
1041689923 8:60678785-60678807 GGCGGCAGCGGCGGCGGCGGCGG + Exonic
1041690396 8:60680409-60680431 GGCGGGGGCGGCGGCGGCGGCGG + Intronic
1042155693 8:65841977-65841999 GACTCCGGCGGCGGCGGCGGCGG - Intronic
1043502953 8:80874316-80874338 GGCGGCGGCGGCGGCGGAGGCGG - Intronic
1044115266 8:88327577-88327599 GGCGGCGGCGGCGGCGGAGGAGG - Intronic
1044822048 8:96161202-96161224 GGAGCGAGCGGCCCCGGAGGAGG + Intergenic
1045277855 8:100722721-100722743 GACGCGCGTGGCGGCGGTGCCGG - Intronic
1045582982 8:103499968-103499990 GACCCAAGGGGCGGCGGCGGTGG + Intergenic
1046871296 8:119208379-119208401 GAGCTGAGCGGCGGCGGCGGCGG + Exonic
1047024558 8:120811819-120811841 GGCGGTAGCGGCGGCGGCGGCGG - Exonic
1048214126 8:132480462-132480484 GACGGGGGCGGCGGAGGCGGCGG - Exonic
1048980891 8:139703084-139703106 GGCGGCGGCGGCGGCGGAGGAGG - Intergenic
1048981173 8:139703923-139703945 GGCGGGCGCGGCGGCGGCGGCGG + Intergenic
1049585629 8:143431175-143431197 TCCGCTAGCGGCGGCGGCGGCGG + Intergenic
1049659998 8:143815611-143815633 GCGGGGAGCGGCGGCGGCGGCGG + Intergenic
1049668805 8:143860552-143860574 GCGGCGGGCGGCGGCGGTGGCGG + Exonic
1049669220 8:143862154-143862176 GCGGCGGGCGGCGGCGGTGGCGG + Exonic
1049670045 8:143865349-143865371 GCGGCGGGCGGCGGCGGCGGCGG + Exonic
1049688793 8:143949865-143949887 GACAGGAGAGGAGGCGGAGGGGG + Intronic
1049762267 8:144336888-144336910 GACGGCGGCGGCGGCGGCGGCGG + Intergenic
1050151387 9:2622139-2622161 GGAGCGAACGGCGGCGGCGGCGG + Exonic
1053188204 9:36036912-36036934 CGCGCGAGCGGCGGCGGTAGCGG + Exonic
1053786354 9:41655263-41655285 GGCGGGAGGGGAGGCGGAGGCGG + Intergenic
1054175075 9:61869219-61869241 GGCGGGAGGGGAGGCGGAGGCGG + Intergenic
1054662462 9:67711574-67711596 GGCGGGAGGGGAGGCGGAGGCGG - Intergenic
1055091025 9:72364929-72364951 GAAGCGAGGGGGGGCCGAGGAGG + Intronic
1055514160 9:77020147-77020169 GGCGGGGGCGGCGGCGGCGGCGG - Exonic
1055611847 9:78031823-78031845 GGCGGGGGCGGAGGCGGAGGCGG - Intergenic
1055611849 9:78031829-78031851 GGCGGGGGCGGGGGCGGAGGCGG - Intergenic
1055945716 9:81689507-81689529 GGCGCGGGCGGCGGCGGCGGTGG - Intergenic
1057643781 9:96854184-96854206 GGCGCGAGCGGCGGCGGGGGTGG - Exonic
1058467546 9:105244587-105244609 GGGGCGGGCGGCGGCGGCGGCGG - Intergenic
1058885941 9:109321019-109321041 GGCGGCAGCGGCGGCGGCGGCGG - Intergenic
1059375281 9:113876270-113876292 GGAGGGAGCGGCGGCGGCGGCGG + Exonic
1059769885 9:117414957-117414979 GCTGCGGGCGGCGGCGGCGGTGG + Exonic
1060087302 9:120714263-120714285 GACGGCGGCGGCGGCGGCGGCGG + Exonic
1060389876 9:123268488-123268510 GACGCGAGCGGGCGAGGTGGCGG - Intronic
1060700582 9:125746894-125746916 GGAGCGAGGGGGGGCGGAGGAGG - Intergenic
1060700601 9:125746938-125746960 GCGGCGGGCGGCGGCGGAGGAGG - Intergenic
1060770182 9:126326830-126326852 ACCGAGAGCGGCGGCGGCGGCGG - Exonic
1060814068 9:126625699-126625721 GGCGGCGGCGGCGGCGGAGGTGG - Intronic
1060814071 9:126625708-126625730 GACGAGGGTGGCGGCGGCGGCGG - Intronic
1060849194 9:126860678-126860700 GGCGCCGGCGGCGGCGGAGGGGG + Intronic
1060917101 9:127397879-127397901 GAGGCGGGCGGCTGCTGAGGAGG - Intronic
1061196663 9:129110571-129110593 GACCCCAGCCGCGGCGGCGGCGG - Exonic
1061438142 9:130579623-130579645 GAGCCGAGCGGCGGCGTCGGCGG + Exonic
1061450408 9:130664375-130664397 GACGCGGGTGGAGGCGGAGGCGG - Intergenic
1061483633 9:130909258-130909280 GGGGCGAGGGGCGGCGGAGGGGG - Intronic
1062162468 9:135087826-135087848 GGCGCGCGGGGCGGCGGCGGCGG + Exonic
1062372179 9:136245668-136245690 GCTGCTAGCGGCGGCGGCGGTGG - Exonic
1062574562 9:137200215-137200237 GGCGCGGGCGGCGGCGGCGGCGG + Exonic
1062630776 9:137462146-137462168 GCCACCCGCGGCGGCGGAGGCGG - Intronic
1062659099 9:137619084-137619106 GCGGCGGGCAGCGGCGGAGGCGG + Intronic
1062659133 9:137619177-137619199 GGCGGCAGCGGCGGCGGCGGCGG - Intronic
1203770910 EBV:49658-49680 GACGGCTGCGGCGGCGGAGGCGG - Intergenic
1186426070 X:9465133-9465155 GGCGGGCGCGGCGGCGGCGGCGG - Exonic
1186496374 X:10015308-10015330 GCCGGCAGCGGCGGCGGCGGCGG + Intergenic
1186768057 X:12791455-12791477 GGGGCGCGCGGCGGCGGAGGAGG - Exonic
1187181437 X:16946867-16946889 GGCGGCAGCGGCGGCGGCGGCGG + Exonic
1187547314 X:20266717-20266739 CACGGCAGCGGCGGCGGCGGCGG + Exonic
1187648323 X:21374140-21374162 CGCGTGCGCGGCGGCGGAGGCGG - Intergenic
1187688422 X:21839712-21839734 GGCGGCAGCGGCGGCAGAGGAGG - Exonic
1189293867 X:39905054-39905076 GACGTGAGTGGCGGCGGTGGGGG + Intergenic
1189310621 X:40014920-40014942 GGCGGGGGCGGGGGCGGAGGCGG - Intergenic
1189323075 X:40097813-40097835 TAGGCGGGCGGCGGCGGCGGAGG - Intronic
1189376555 X:40471181-40471203 GTCTGGAGCGGCGGGGGAGGCGG + Intergenic
1189615400 X:42778248-42778270 TACGGCAGCGGTGGCGGAGGCGG - Intergenic
1189821497 X:44873421-44873443 GCCGCCCGCGGCGGAGGAGGAGG + Intronic
1190319478 X:49171832-49171854 GACGCGGGCGGGGCCGGAGCCGG - Intergenic
1190385489 X:49879491-49879513 GCCGCCAGTGGAGGCGGAGGAGG + Intergenic
1190713061 X:53083061-53083083 GGCGGCGGCGGCGGCGGAGGAGG + Exonic
1191830015 X:65406698-65406720 GGCGCGGGCGGCGGCGGCGGCGG + Intronic
1191878610 X:65822263-65822285 GGCGCCAGAGGCGGCGGAGAGGG - Intergenic
1195108657 X:101623921-101623943 GACGGGGGTGGCGGCGGGGGTGG + Intronic
1197203043 X:123765253-123765275 GAACCGAGTGGCGGCGGCGGCGG - Intergenic
1197753945 X:129982386-129982408 GGAGCAAGCGGCGGCGAAGGGGG - Intronic
1198388141 X:136147718-136147740 GCCCCGAGCGGCGGCGGCGGCGG - Intronic
1198533585 X:137566837-137566859 GAAGGCAGCGGCGGCGGCGGCGG - Exonic
1199445111 X:147912064-147912086 GGCGGCGGCGGCGGCGGAGGCGG + Exonic
1199500367 X:148500669-148500691 GGCGGCAGCGGCGGCGGCGGCGG - Exonic
1199500385 X:148500727-148500749 GGCGGCAGCGGCGGCGGGGGCGG - Exonic
1199612777 X:149631902-149631924 CACGCGACCGGCGGAGGAGATGG + Exonic
1199736838 X:150693468-150693490 GACGGGAGCGGCGGCCGGGAAGG - Exonic
1199772772 X:150984524-150984546 GCCGGGGGCGGCGGCGGTGGCGG - Intronic
1200092481 X:153642413-153642435 GGAGGCAGCGGCGGCGGAGGCGG + Intergenic
1201904462 Y:19075974-19075996 GAGGAAAGCGGCGGCGGTGGCGG - Intergenic