ID: 1088175541

View in Genome Browser
Species Human (GRCh38)
Location 11:107049180-107049202
Sequence AGGTACTAATCTAGACCTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088175541_1088175545 -10 Left 1088175541 11:107049180-107049202 CCCTCAGGTCTAGATTAGTACCT No data
Right 1088175545 11:107049193-107049215 ATTAGTACCTGGCAAGTGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088175541 Original CRISPR AGGTACTAATCTAGACCTGA GGG (reversed) Intergenic
No off target data available for this crispr