ID: 1088177477

View in Genome Browser
Species Human (GRCh38)
Location 11:107070229-107070251
Sequence ACTATAAACCAGATCTCAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088177477_1088177479 27 Left 1088177477 11:107070229-107070251 CCTACTGAGATCTGGTTTATAGT No data
Right 1088177479 11:107070279-107070301 TGACTTTTTTCTTTTGTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088177477 Original CRISPR ACTATAAACCAGATCTCAGT AGG (reversed) Intergenic
No off target data available for this crispr