ID: 1088184103

View in Genome Browser
Species Human (GRCh38)
Location 11:107144246-107144268
Sequence CAGCAGTGGGAGACTGTAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088184103_1088184111 13 Left 1088184103 11:107144246-107144268 CCCTCTACAGTCTCCCACTGCTG No data
Right 1088184111 11:107144282-107144304 GAAGCTACCTGGAAACCACAGGG No data
1088184103_1088184110 12 Left 1088184103 11:107144246-107144268 CCCTCTACAGTCTCCCACTGCTG No data
Right 1088184110 11:107144281-107144303 TGAAGCTACCTGGAAACCACAGG No data
1088184103_1088184115 28 Left 1088184103 11:107144246-107144268 CCCTCTACAGTCTCCCACTGCTG No data
Right 1088184115 11:107144297-107144319 CCACAGGGTAAATCAGAGGATGG No data
1088184103_1088184108 2 Left 1088184103 11:107144246-107144268 CCCTCTACAGTCTCCCACTGCTG No data
Right 1088184108 11:107144271-107144293 TTCCATTGGCTGAAGCTACCTGG No data
1088184103_1088184113 24 Left 1088184103 11:107144246-107144268 CCCTCTACAGTCTCCCACTGCTG No data
Right 1088184113 11:107144293-107144315 GAAACCACAGGGTAAATCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088184103 Original CRISPR CAGCAGTGGGAGACTGTAGA GGG (reversed) Intergenic
No off target data available for this crispr