ID: 1088186432

View in Genome Browser
Species Human (GRCh38)
Location 11:107176581-107176603
Sequence GGCGACTTCCACTTGTTTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 4, 3: 8, 4: 55}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088186432_1088186444 17 Left 1088186432 11:107176581-107176603 CCCACAAACAAGTGGAAGTCGCC 0: 1
1: 0
2: 4
3: 8
4: 55
Right 1088186444 11:107176621-107176643 ATATGTGTCCCACGGCACCACGG 0: 1
1: 0
2: 1
3: 5
4: 66
1088186432_1088186439 -10 Left 1088186432 11:107176581-107176603 CCCACAAACAAGTGGAAGTCGCC 0: 1
1: 0
2: 4
3: 8
4: 55
Right 1088186439 11:107176594-107176616 GGAAGTCGCCCAGCGGGAGGGGG 0: 1
1: 1
2: 2
3: 14
4: 283
1088186432_1088186446 23 Left 1088186432 11:107176581-107176603 CCCACAAACAAGTGGAAGTCGCC 0: 1
1: 0
2: 4
3: 8
4: 55
Right 1088186446 11:107176627-107176649 GTCCCACGGCACCACGGGAAAGG 0: 1
1: 1
2: 2
3: 10
4: 78
1088186432_1088186447 24 Left 1088186432 11:107176581-107176603 CCCACAAACAAGTGGAAGTCGCC 0: 1
1: 0
2: 4
3: 8
4: 55
Right 1088186447 11:107176628-107176650 TCCCACGGCACCACGGGAAAGGG 0: 1
1: 3
2: 1
3: 10
4: 75
1088186432_1088186445 18 Left 1088186432 11:107176581-107176603 CCCACAAACAAGTGGAAGTCGCC 0: 1
1: 0
2: 4
3: 8
4: 55
Right 1088186445 11:107176622-107176644 TATGTGTCCCACGGCACCACGGG 0: 1
1: 2
2: 3
3: 8
4: 53
1088186432_1088186449 25 Left 1088186432 11:107176581-107176603 CCCACAAACAAGTGGAAGTCGCC 0: 1
1: 0
2: 4
3: 8
4: 55
Right 1088186449 11:107176629-107176651 CCCACGGCACCACGGGAAAGGGG 0: 1
1: 0
2: 2
3: 8
4: 92
1088186432_1088186442 9 Left 1088186432 11:107176581-107176603 CCCACAAACAAGTGGAAGTCGCC 0: 1
1: 0
2: 4
3: 8
4: 55
Right 1088186442 11:107176613-107176635 GGGGCCAAATATGTGTCCCACGG 0: 1
1: 3
2: 1
3: 10
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088186432 Original CRISPR GGCGACTTCCACTTGTTTGT GGG (reversed) Intergenic
901235113 1:7663581-7663603 GGGGACTTCCACCTGGTTGGTGG - Exonic
901264814 1:7902507-7902529 GGCGACTTGCACATCATTGTTGG + Intergenic
910986668 1:93011775-93011797 TGCTACTTCTACTTGTCTGTTGG + Intergenic
920304435 1:205009563-205009585 GGCGATGTCCGCTTGGTTGTTGG - Exonic
1064783465 10:18868129-18868151 GGCGGCTTCCACTTTTCTCTTGG - Intergenic
1072899348 10:99393671-99393693 GAGGACTTCCACTTCTTGGTGGG - Exonic
1074888393 10:117713648-117713670 GGCAACTGCCACTGCTTTGTTGG + Intergenic
1075867472 10:125738040-125738062 TGCAAATTACACTTGTTTGTTGG + Intronic
1078730291 11:13967475-13967497 GGCCAATTCCTTTTGTTTGTGGG + Intronic
1078821841 11:14891148-14891170 GGCGACCACCGCTTGTGTGTGGG - Intronic
1085198073 11:74684079-74684101 GCCGACTTCCACCTGTGTGACGG + Intergenic
1088186432 11:107176581-107176603 GGCGACTTCCACTTGTTTGTGGG - Intergenic
1094090789 12:26646767-26646789 GGAGAATTCCATTTATTTGTAGG - Intronic
1094317711 12:29150232-29150254 GACGCCTTCCTCTGGTTTGTAGG - Intronic
1094713221 12:32986134-32986156 GGCAATTTCCACTTGTTTGCAGG - Intergenic
1112391270 13:98986545-98986567 GGGGACTTCCAGATGATTGTTGG - Intronic
1117598218 14:57345327-57345349 GGCGACTGCCAGTCGTTTGCAGG - Intergenic
1118597452 14:67446893-67446915 AGCCACGTCCATTTGTTTGTAGG + Intergenic
1120994141 14:90402738-90402760 AGTAACTTCCTCTTGTTTGTGGG + Intronic
1124786096 15:32682006-32682028 GCCACCTTCTACTTGTTTGTAGG + Intronic
1125545047 15:40497258-40497280 GGAGACTGCCACTTGTTTCAAGG + Intergenic
1137820363 16:51438867-51438889 AGCGTTTTCCATTTGTTTGTAGG - Intergenic
1139077166 16:63465251-63465273 GGCCACTTCCATTTATTTGAGGG - Intergenic
1156322336 18:36038398-36038420 GGCGGCTTCCATGTGATTGTGGG + Intronic
1158018432 18:52811329-52811351 GGCGACATTCATTAGTTTGTTGG + Intronic
1160017730 18:75157340-75157362 GTCCACTTGCACTTGCTTGTTGG - Intergenic
1160459864 18:79030770-79030792 GGCGACTGACACTTGTCTCTGGG + Intergenic
1164904902 19:31959385-31959407 GGCCACCTCCACGTGTTAGTGGG + Intergenic
929158787 2:38811357-38811379 AGCAATTTCCACTTGTTTGCGGG + Intronic
936014515 2:108947596-108947618 GGCAACTTCCACTTGGTGTTGGG - Intronic
1169004670 20:2196660-2196682 AGAGACTTACACTTGTTCGTGGG - Intergenic
950712083 3:14819979-14820001 GGCGGCTGCCACTTCTTGGTTGG - Exonic
954833048 3:53439598-53439620 TTTGACTTCCACTTCTTTGTAGG + Intergenic
964457784 3:156886632-156886654 TGCTACTTCTACTTTTTTGTGGG + Intronic
966194302 3:177298082-177298104 GGTGATTTCTACTTGTTTGTGGG + Intergenic
971424520 4:26502944-26502966 GGCATCCTCCACTTATTTGTGGG + Intergenic
979948195 4:126860413-126860435 GGTGACTTCCATGTGGTTGTGGG - Intergenic
980013918 4:127626638-127626660 GTCCACTTCCACTTGGTTATTGG + Intronic
980579613 4:134732561-134732583 GGCAGCTTCCACTTGGTTTTGGG + Intergenic
981638779 4:146911802-146911824 GCGGATTTCCACTTGTTTATTGG + Intronic
982531293 4:156547376-156547398 GGCCAATCCCCCTTGTTTGTAGG + Intergenic
984920925 4:184763521-184763543 GGCTGCTTCCAGGTGTTTGTAGG - Intronic
988907457 5:35803792-35803814 GGAGATTTCCAGTTGTTTGTGGG - Intronic
990245447 5:53859459-53859481 GGTGATTTCCATTTGTTTGCAGG - Intergenic
997208140 5:132062239-132062261 GGTGACTTCCACCTGCTTGTGGG + Intronic
998743283 5:145229108-145229130 GACGGTTTCCACTTTTTTGTGGG - Intergenic
1000035702 5:157446282-157446304 GGTGACTACCTCTTGTGTGTAGG + Intronic
1005360207 6:25024164-25024186 GGCGATTTCCACTTGTTTGCTGG + Intronic
1006422894 6:33946480-33946502 GGCCATTTCCACCTGTTTGGTGG + Intergenic
1010495704 6:76532267-76532289 GGGGTCTTTCACTTGTCTGTTGG + Intergenic
1021044243 7:15902961-15902983 GGTGAGATCCATTTGTTTGTGGG - Intergenic
1021491172 7:21221111-21221133 GGGGATTTCCACTTGTTTGCGGG + Intergenic
1022805712 7:33820270-33820292 GGCCACTTCCACATTTTTTTAGG + Intergenic
1042650433 8:71034496-71034518 TGCCACTTCCACCTGTTTGCTGG + Intergenic
1044690887 8:94877419-94877441 GGCCAGTTCCACTTGATTGGAGG + Intronic
1045437736 8:102181446-102181468 GGCCTCTTCCACTTGTTTCTTGG - Intergenic
1050324442 9:4486263-4486285 AGGAACTTCCACTTCTTTGTGGG - Intergenic
1052081594 9:24212697-24212719 GGGGACTTCCACTTGATTCAAGG + Intergenic
1052635671 9:31101270-31101292 GCAGACTTCCATATGTTTGTTGG + Intergenic
1052798518 9:32946291-32946313 GGCGATTTCCACTTGTTTGCCGG - Intergenic
1061418012 9:130458522-130458544 GGCGATTTCCACTTGTTTGCGGG - Exonic
1062474150 9:136719243-136719265 TGCAGCTTCCTCTTGTTTGTGGG - Intronic
1185838478 X:3367444-3367466 GGTGATTTCCACTTGTTTGTGGG - Intergenic
1187359174 X:18608995-18609017 AGCCACTTCAACTTATTTGTGGG - Intronic
1188396539 X:29691315-29691337 GGGGAATTGCACTTGTCTGTTGG + Intronic
1194132258 X:90095770-90095792 GGTGGCTTCCACTTGGTGGTGGG + Intergenic
1196434813 X:115665190-115665212 GGCGATTTCCACTTGTTTTCGGG - Intergenic
1201237284 Y:11923452-11923474 GGTAATTTCCACTTGTTTGTGGG + Intergenic