ID: 1088186433

View in Genome Browser
Species Human (GRCh38)
Location 11:107176582-107176604
Sequence GGGCGACTTCCACTTGTTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 59
Summary {0: 1, 1: 1, 2: 3, 3: 11, 4: 43}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088186433_1088186445 17 Left 1088186433 11:107176582-107176604 CCACAAACAAGTGGAAGTCGCCC 0: 1
1: 1
2: 3
3: 11
4: 43
Right 1088186445 11:107176622-107176644 TATGTGTCCCACGGCACCACGGG 0: 1
1: 2
2: 3
3: 8
4: 53
1088186433_1088186444 16 Left 1088186433 11:107176582-107176604 CCACAAACAAGTGGAAGTCGCCC 0: 1
1: 1
2: 3
3: 11
4: 43
Right 1088186444 11:107176621-107176643 ATATGTGTCCCACGGCACCACGG 0: 1
1: 0
2: 1
3: 5
4: 66
1088186433_1088186447 23 Left 1088186433 11:107176582-107176604 CCACAAACAAGTGGAAGTCGCCC 0: 1
1: 1
2: 3
3: 11
4: 43
Right 1088186447 11:107176628-107176650 TCCCACGGCACCACGGGAAAGGG 0: 1
1: 3
2: 1
3: 10
4: 75
1088186433_1088186449 24 Left 1088186433 11:107176582-107176604 CCACAAACAAGTGGAAGTCGCCC 0: 1
1: 1
2: 3
3: 11
4: 43
Right 1088186449 11:107176629-107176651 CCCACGGCACCACGGGAAAGGGG 0: 1
1: 0
2: 2
3: 8
4: 92
1088186433_1088186446 22 Left 1088186433 11:107176582-107176604 CCACAAACAAGTGGAAGTCGCCC 0: 1
1: 1
2: 3
3: 11
4: 43
Right 1088186446 11:107176627-107176649 GTCCCACGGCACCACGGGAAAGG 0: 1
1: 1
2: 2
3: 10
4: 78
1088186433_1088186442 8 Left 1088186433 11:107176582-107176604 CCACAAACAAGTGGAAGTCGCCC 0: 1
1: 1
2: 3
3: 11
4: 43
Right 1088186442 11:107176613-107176635 GGGGCCAAATATGTGTCCCACGG 0: 1
1: 3
2: 1
3: 10
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088186433 Original CRISPR GGGCGACTTCCACTTGTTTG TGG (reversed) Intergenic
903693654 1:25192160-25192182 GGGCTGCTTCCACTTTTTGGAGG - Intergenic
913410205 1:118542676-118542698 GGTTGACTGCCACTTGTTGGAGG - Intergenic
915723654 1:158002379-158002401 GGGCCATTTCCACTGGTCTGTGG + Intronic
1068841015 10:61614170-61614192 GGGACACTTACACTGGTTTGGGG + Intergenic
1069330014 10:67280578-67280600 GGGCGTCTTCAGCTTGTGTGTGG - Intronic
1076361486 10:129892419-129892441 TGGCGATTTCCACTTATTTGGGG + Intronic
1079217519 11:18526913-18526935 TGCCGACTTCCTGTTGTTTGAGG - Exonic
1082204702 11:49419078-49419100 AGGGAACTTCCACATGTTTGGGG + Intergenic
1084879270 11:72158727-72158749 GGATGACTTCCACTGGGTTGGGG + Intergenic
1085761176 11:79242965-79242987 GGGAGATTGCCACTTGTTCGGGG + Intronic
1085942534 11:81222281-81222303 GGGCGACTTCCTAGTGTTTGAGG - Intergenic
1086650385 11:89281439-89281461 GGGGAACTTCCACATGTTTGGGG - Intronic
1088186433 11:107176582-107176604 GGGCGACTTCCACTTGTTTGTGG - Intergenic
1088907688 11:114167105-114167127 GGCTGACTTCCACTGGCTTGCGG + Intronic
1092123823 12:6062475-6062497 GGGCCACTTCCTCTTGTTCTTGG - Intronic
1093812056 12:23503432-23503454 GGTCGACATCCAGGTGTTTGAGG + Intergenic
1106027413 13:25968315-25968337 GGCCGACTTCCGGTTCTTTGCGG + Intronic
1113656338 13:112069928-112069950 GGGCGCCTTCCACCTGGCTGGGG + Exonic
1120994140 14:90402737-90402759 GAGTAACTTCCTCTTGTTTGTGG + Intronic
1124659507 15:31534929-31534951 GGTCCACTTCCACTTATATGTGG - Intronic
1135630451 16:24032300-24032322 GGGCTGCTTCCACTTGGTTTGGG + Intronic
1137757181 16:50912105-50912127 GGGCGACCCCTATTTGTTTGAGG + Intergenic
1139077167 16:63465252-63465274 GGGCCACTTCCATTTATTTGAGG - Intergenic
1139182993 16:64770138-64770160 GTGGGACTCCCACTTGTTTCTGG - Intergenic
1155981186 18:32181669-32181691 GGATGAATCCCACTTGTTTGTGG + Intronic
1156488610 18:37483028-37483050 GGGGGACTTCTTCTTGTCTGGGG - Intronic
1157322864 18:46647496-46647518 GGGCGACTCCCTAGTGTTTGAGG + Intronic
1157510999 18:48274599-48274621 GTGTGACTTCCACATGTTTCTGG - Intronic
1160459863 18:79030769-79030791 GGGCGACTGACACTTGTCTCTGG + Intergenic
925412985 2:3650643-3650665 GGGCGTCTCGCACTTGTCTGGGG + Intergenic
926901171 2:17753625-17753647 GGGAGACTTCGACTTGTTGGCGG - Exonic
927055156 2:19360022-19360044 GGGTAACTTCGTCTTGTTTGAGG + Intergenic
928696693 2:33856539-33856561 GGGCGTCTTCAAATTATTTGGGG + Intergenic
929158786 2:38811356-38811378 GAGCAATTTCCACTTGTTTGCGG + Intronic
945165988 2:206946280-206946302 GGACAAATTCCACTTGGTTGTGG - Intronic
1169004671 20:2196661-2196683 GAGAGACTTACACTTGTTCGTGG - Intergenic
1169174904 20:3502530-3502552 GGGGGACTTCCATTTGATTCAGG - Intronic
1175470584 20:59224172-59224194 GGGGGACTTCCTCTTGTTCCTGG + Intronic
957964610 3:87306247-87306269 GGGCAGCTTCCATTTGCTTGGGG + Intergenic
960345300 3:116522867-116522889 GGGTGACTCCTACTTGTTTTTGG - Intronic
966194301 3:177298081-177298103 GGGTGATTTCTACTTGTTTGTGG + Intergenic
985651325 5:1109092-1109114 GAGGGACTTCCACTCGTCTGGGG - Intronic
988340066 5:29959871-29959893 GGGCCCCTTCCTTTTGTTTGAGG + Intergenic
988907458 5:35803793-35803815 GGGAGATTTCCAGTTGTTTGTGG - Intronic
997208139 5:132062238-132062260 GGGTGACTTCCACCTGCTTGTGG + Intronic
998743284 5:145229109-145229131 GGACGGTTTCCACTTTTTTGTGG - Intergenic
1015152710 6:130056519-130056541 GGGCTATTTCCAGTTTTTTGAGG - Intronic
1021044244 7:15902962-15902984 GGGTGAGATCCATTTGTTTGTGG - Intergenic
1021491171 7:21221110-21221132 GGGGGATTTCCACTTGTTTGCGG + Intergenic
1026807280 7:73436220-73436242 GGGGGACTTCCTCCTGATTGGGG - Intergenic
1026940465 7:74284907-74284929 GGGGGACTTCCCCTCGTTGGGGG - Intergenic
1030468265 7:109930227-109930249 GGGCGTCGTCCACTGGGTTGAGG + Intergenic
1030604781 7:111628542-111628564 GGGTAAATTCCACTTGATTGTGG + Intergenic
1039477187 8:37845370-37845392 GGGCGTCTTCCGCTTGTTAGGGG + Intronic
1061418013 9:130458523-130458545 GGGCGATTTCCACTTGTTTGCGG - Exonic
1185838479 X:3367445-3367467 GGGTGATTTCCACTTGTTTGTGG - Intergenic
1186091494 X:6053457-6053479 GGCCATCTTCCACTTGTGTGTGG - Intronic
1196434814 X:115665191-115665213 GGGCGATTTCCACTTGTTTTCGG - Intergenic
1201237283 Y:11923451-11923473 GGGTAATTTCCACTTGTTTGTGG + Intergenic