ID: 1088186440

View in Genome Browser
Species Human (GRCh38)
Location 11:107176602-107176624
Sequence ATATTTGGCCCCCTCCCGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 47
Summary {0: 1, 1: 1, 2: 2, 3: 7, 4: 36}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088186440_1088186452 14 Left 1088186440 11:107176602-107176624 CCCAGCGGGAGGGGGCCAAATAT 0: 1
1: 1
2: 2
3: 7
4: 36
Right 1088186452 11:107176639-107176661 CACGGGAAAGGGGAATGATCAGG 0: 1
1: 1
2: 4
3: 10
4: 127
1088186440_1088186447 3 Left 1088186440 11:107176602-107176624 CCCAGCGGGAGGGGGCCAAATAT 0: 1
1: 1
2: 2
3: 7
4: 36
Right 1088186447 11:107176628-107176650 TCCCACGGCACCACGGGAAAGGG 0: 1
1: 3
2: 1
3: 10
4: 75
1088186440_1088186446 2 Left 1088186440 11:107176602-107176624 CCCAGCGGGAGGGGGCCAAATAT 0: 1
1: 1
2: 2
3: 7
4: 36
Right 1088186446 11:107176627-107176649 GTCCCACGGCACCACGGGAAAGG 0: 1
1: 1
2: 2
3: 10
4: 78
1088186440_1088186453 19 Left 1088186440 11:107176602-107176624 CCCAGCGGGAGGGGGCCAAATAT 0: 1
1: 1
2: 2
3: 7
4: 36
Right 1088186453 11:107176644-107176666 GAAAGGGGAATGATCAGGTCTGG 0: 1
1: 1
2: 7
3: 41
4: 421
1088186440_1088186445 -3 Left 1088186440 11:107176602-107176624 CCCAGCGGGAGGGGGCCAAATAT 0: 1
1: 1
2: 2
3: 7
4: 36
Right 1088186445 11:107176622-107176644 TATGTGTCCCACGGCACCACGGG 0: 1
1: 2
2: 3
3: 8
4: 53
1088186440_1088186449 4 Left 1088186440 11:107176602-107176624 CCCAGCGGGAGGGGGCCAAATAT 0: 1
1: 1
2: 2
3: 7
4: 36
Right 1088186449 11:107176629-107176651 CCCACGGCACCACGGGAAAGGGG 0: 1
1: 0
2: 2
3: 8
4: 92
1088186440_1088186444 -4 Left 1088186440 11:107176602-107176624 CCCAGCGGGAGGGGGCCAAATAT 0: 1
1: 1
2: 2
3: 7
4: 36
Right 1088186444 11:107176621-107176643 ATATGTGTCCCACGGCACCACGG 0: 1
1: 0
2: 1
3: 5
4: 66

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088186440 Original CRISPR ATATTTGGCCCCCTCCCGCT GGG (reversed) Intergenic
903058553 1:20653725-20653747 AGCTGTGGCCCTCTCCCGCTGGG - Exonic
905928222 1:41767189-41767211 CTATTTGGACTCCTCCCTCTGGG + Intronic
1071755901 10:88538892-88538914 CTATTTGGCCACCTCCTGTTGGG - Intronic
1073149640 10:101303064-101303086 ATGTTTGGACCCCTCCAGATAGG + Intergenic
1079575016 11:21993265-21993287 ACATTTGTCACCCTCTCGCTTGG + Intergenic
1081626609 11:44659765-44659787 ACATGTGGCCCCCTCCCTCCTGG + Intergenic
1085325886 11:75606291-75606313 ATATTTGAGCCCCTCCCTGTAGG + Intronic
1086124210 11:83333214-83333236 ATATATGGCTGCCTCCCTCTAGG + Intergenic
1088186440 11:107176602-107176624 ATATTTGGCCCCCTCCCGCTGGG - Intergenic
1094713228 12:32986155-32986177 ATACTTGGCCCCCTCCCGGTGGG - Intergenic
1099705183 12:86143176-86143198 ATATTGGGCCCCCTCAGGCATGG - Intronic
1105480707 13:20773289-20773311 ACATGTGGCTCCCTCCCGGTAGG + Intronic
1109070324 13:57757895-57757917 ATCTTTGGCCTCCACCCACTAGG - Intergenic
1124172351 15:27387727-27387749 ACATTTGGCCCCCTCCCTGCTGG - Intronic
1131369435 15:91867368-91867390 ATATTTGCCCCCCTCCCATGTGG - Intronic
1133913675 16:10088667-10088689 ATTTTTGGCTCCCACCCACTCGG + Intronic
1138624055 16:58235235-58235257 AGATTTGGCCCCCTCTCCCCAGG - Intronic
1139445030 16:66992378-66992400 ATTTTTGGCCACCTGCAGCTGGG + Intronic
1151728716 17:75898717-75898739 CTCTTTGGCCCCCTCCCGTCAGG - Exonic
934049271 2:88196904-88196926 ATATTTGACTCACTCCCTCTAGG - Intergenic
1169200036 20:3704479-3704501 GCCTTTGGCCCCCTCCCACTAGG - Intronic
1169918050 20:10703362-10703384 ATGTTTGGCACCATCCCCCTTGG + Intergenic
950260768 3:11542294-11542316 ATATTTGGCACCCTCCCTCTGGG - Intronic
961973311 3:130993565-130993587 ATTCTTGGCCCCTTCCCACTAGG + Intronic
962575448 3:136751884-136751906 AAATTTTGCCCCCGCCCGCCCGG - Intronic
966194295 3:177298061-177298083 ACACTTGGCCCCCTCCTGCTGGG + Intergenic
968470482 4:779865-779887 ATATTTGGACTCCTCCTGCATGG + Intergenic
987801508 5:22702634-22702656 ATATTTTTTCCCCTCCAGCTCGG + Intronic
989159947 5:38380869-38380891 ATATTTTACCCCCTCTGGCTAGG + Intronic
990245453 5:53859480-53859502 ATACTTGGCCCCCTTCCACTGGG - Intergenic
1001693018 5:173646813-173646835 AAATTTGCCCCCCTCCTCCTTGG + Intergenic
1002152657 5:177248110-177248132 CCATTTGACCCCCTCCCTCTGGG - Intronic
1021491162 7:21221090-21221112 TAACTTGGCCCCCTCCCGCTGGG + Intergenic
1025759500 7:64376908-64376930 ATACTTTGCCCCCTACCACTAGG + Intergenic
1040770799 8:50972832-50972854 AATTGTGGCCCCTTCCCGCTAGG + Intergenic
1051385634 9:16505539-16505561 ATATTTGGCTCTCTCCCTCCAGG - Intronic
1052798522 9:32946312-32946334 ATACTTGGCCTCCTCCTGCTTGG - Intergenic
1055676529 9:78668166-78668188 ATATTTGGCCTCCTCTCCCTTGG - Intergenic
1061418020 9:130458543-130458565 ATACTTGGCCCCCTCCCGCTGGG - Exonic
1062524624 9:136973261-136973283 ATCTGTGGCCCCATCCCCCTGGG + Intergenic
1185838484 X:3367465-3367487 ATACTTGGTCCCCTCCTGCTGGG - Intergenic
1192762143 X:74104804-74104826 ATATTGGCCCCCATCCCCCTGGG + Intergenic
1194104739 X:89754988-89755010 ATATTGGGCCCCTTCAAGCTGGG - Intergenic
1196202632 X:112902726-112902748 AGATTAGGCCCCCTGCCTCTAGG + Intergenic
1196434818 X:115665211-115665233 TTACTTGGCCCTCTCCTGCTGGG - Intergenic
1201237277 Y:11923431-11923453 GTACTTGGCCCCCTCCTGCTGGG + Intergenic
1201555144 Y:15259316-15259338 TTACTTGGCCCCCTCCTGCGTGG - Intergenic