ID: 1088186441

View in Genome Browser
Species Human (GRCh38)
Location 11:107176603-107176625
Sequence CATATTTGGCCCCCTCCCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 58
Summary {0: 1, 1: 1, 2: 2, 3: 9, 4: 45}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088186441_1088186444 -5 Left 1088186441 11:107176603-107176625 CCAGCGGGAGGGGGCCAAATATG 0: 1
1: 1
2: 2
3: 9
4: 45
Right 1088186444 11:107176621-107176643 ATATGTGTCCCACGGCACCACGG 0: 1
1: 0
2: 1
3: 5
4: 66
1088186441_1088186447 2 Left 1088186441 11:107176603-107176625 CCAGCGGGAGGGGGCCAAATATG 0: 1
1: 1
2: 2
3: 9
4: 45
Right 1088186447 11:107176628-107176650 TCCCACGGCACCACGGGAAAGGG 0: 1
1: 3
2: 1
3: 10
4: 75
1088186441_1088186446 1 Left 1088186441 11:107176603-107176625 CCAGCGGGAGGGGGCCAAATATG 0: 1
1: 1
2: 2
3: 9
4: 45
Right 1088186446 11:107176627-107176649 GTCCCACGGCACCACGGGAAAGG 0: 1
1: 1
2: 2
3: 10
4: 78
1088186441_1088186449 3 Left 1088186441 11:107176603-107176625 CCAGCGGGAGGGGGCCAAATATG 0: 1
1: 1
2: 2
3: 9
4: 45
Right 1088186449 11:107176629-107176651 CCCACGGCACCACGGGAAAGGGG 0: 1
1: 0
2: 2
3: 8
4: 92
1088186441_1088186445 -4 Left 1088186441 11:107176603-107176625 CCAGCGGGAGGGGGCCAAATATG 0: 1
1: 1
2: 2
3: 9
4: 45
Right 1088186445 11:107176622-107176644 TATGTGTCCCACGGCACCACGGG 0: 1
1: 2
2: 3
3: 8
4: 53
1088186441_1088186453 18 Left 1088186441 11:107176603-107176625 CCAGCGGGAGGGGGCCAAATATG 0: 1
1: 1
2: 2
3: 9
4: 45
Right 1088186453 11:107176644-107176666 GAAAGGGGAATGATCAGGTCTGG 0: 1
1: 1
2: 7
3: 41
4: 421
1088186441_1088186452 13 Left 1088186441 11:107176603-107176625 CCAGCGGGAGGGGGCCAAATATG 0: 1
1: 1
2: 2
3: 9
4: 45
Right 1088186452 11:107176639-107176661 CACGGGAAAGGGGAATGATCAGG 0: 1
1: 1
2: 4
3: 10
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088186441 Original CRISPR CATATTTGGCCCCCTCCCGC TGG (reversed) Intergenic
900516917 1:3086528-3086550 CACTTCTGGCCTCCTCCCGCCGG + Intronic
900929400 1:5726734-5726756 CATATTTTGCCCCATCACCCCGG - Intergenic
901055664 1:6447742-6447764 CATATTTGGCCCCCGGCTCCGGG - Intronic
905928221 1:41767188-41767210 CCTATTTGGACTCCTCCCTCTGG + Intronic
909520778 1:76565367-76565389 CACAGTTGTCCCCCTCCCCCAGG + Intronic
924446225 1:244134422-244134444 CATATCTGGCACCCACTCGCAGG - Intergenic
1071755902 10:88538893-88538915 CCTATTTGGCCACCTCCTGTTGG - Intronic
1073214040 10:101826884-101826906 CATTCTTGTCCCCCTCCCACAGG + Intronic
1074701822 10:116099053-116099075 CACATTTGACCACCTCCCCCTGG + Intronic
1074813125 10:117125239-117125261 CTTATTTGCCACCCTCCCACTGG + Intronic
1088186441 11:107176603-107176625 CATATTTGGCCCCCTCCCGCTGG - Intergenic
1094713229 12:32986156-32986178 CATACTTGGCCCCCTCCCGGTGG - Intergenic
1096554675 12:52395982-52396004 CATCTTTGACCCCCTCCTGGAGG + Intronic
1102932886 12:116876230-116876252 CACATCTGGCCCCTTCCCGGGGG + Intronic
1105411782 13:20177244-20177266 CCAATGTGGCCCCCTCTCGCGGG + Intergenic
1134482940 16:14633977-14633999 CATCTGTCGCCCCCTCCCGCCGG - Intronic
1136554166 16:30997919-30997941 CATACATGGCCCCTTCACGCGGG - Intronic
1139445029 16:66992377-66992399 CATTTTTGGCCACCTGCAGCTGG + Intronic
1151449191 17:74187321-74187343 CAATTTTGTCCCCCTCCCCCAGG - Intergenic
1152192939 17:78899507-78899529 CATTCCTGGGCCCCTCCCGCAGG - Intronic
1152479358 17:80539737-80539759 CATATTTGCCCCCCACACTCAGG + Intergenic
1161494602 19:4580527-4580549 CGAGTGTGGCCCCCTCCCGCGGG - Intergenic
1167916152 19:52741620-52741642 CATATCTCGCCCCCGCCCACAGG - Intergenic
1168154299 19:54464537-54464559 CATGTTCGGCCCCATCCCTCGGG + Intergenic
929555933 2:42925663-42925685 CACATTTGCTCCCCTCCTGCTGG - Intergenic
931058986 2:58505050-58505072 CATGTTTGGCCCTCTGCCTCAGG - Intergenic
932865330 2:75335506-75335528 CATATTTGGCTTTCTCCAGCTGG + Intergenic
948729882 2:239956130-239956152 CACATCTGGACCCCTCCCACGGG + Intronic
1172847554 20:37938858-37938880 GATATTGGGCCCCCTCCCGTGGG + Intronic
1174034963 20:47663244-47663266 CAGATGGGGCCTCCTCCCGCAGG - Intronic
1180232298 21:46434459-46434481 CATCTTGGGCCTCTTCCCGCTGG + Intronic
1184076148 22:42179739-42179761 CAGATTTGGCCCTCTCCTCCAGG + Intronic
950260769 3:11542295-11542317 TATATTTGGCACCCTCCCTCTGG - Intronic
950534938 3:13573174-13573196 CCTATATGGCTCCCTCCGGCCGG + Intronic
966194294 3:177298060-177298082 CACACTTGGCCCCCTCCTGCTGG + Intergenic
970789148 4:19836056-19836078 CATATTTTGCCACCTTCTGCAGG + Intergenic
978203474 4:106050762-106050784 CATATCTGGCCCCCTCACGTGGG - Intronic
978639467 4:110852607-110852629 CAAATTTGTCTCCCTCCCTCAGG - Intergenic
990245454 5:53859481-53859503 TATACTTGGCCCCCTTCCACTGG - Intergenic
990410759 5:55538477-55538499 CATAGCTGCCCCCCTCCCCCGGG - Intergenic
990645871 5:57844060-57844082 CAGATTTGGCCCTGTCCTGCAGG + Intergenic
998743292 5:145229130-145229152 CACACTTGGCCCCCACCCGCTGG - Intergenic
1018088853 6:160328675-160328697 CATAATGGAGCCCCTCCCGCAGG + Intergenic
1021491161 7:21221089-21221111 ATAACTTGGCCCCCTCCCGCTGG + Intergenic
1023175748 7:37433830-37433852 CTTATTTTGCCCCCTGCAGCAGG - Intronic
1030746823 7:113175814-113175836 TATATTTGTCCCCCACCCCCAGG + Intergenic
1034828428 7:154288019-154288041 CATATGTGTCCCCCTACCGAGGG + Intronic
1037735713 8:21564331-21564353 CATATATGGCCCCCTGCTGATGG + Intergenic
1037880593 8:22571636-22571658 CATTTTGGGCCTCCTCCCTCAGG + Intronic
1055626048 9:78178579-78178601 CATACTTGGCCCCCTCCTGCTGG - Intergenic
1056100736 9:83298378-83298400 CATATTTGGCCCGTTCCCATTGG - Intronic
1056587987 9:87940585-87940607 CACCTTTGACCCCCTCCCTCTGG - Intergenic
1056608881 9:88112360-88112382 CACCTTTGACCCCCTCCCTCTGG + Intergenic
1061389479 9:130309635-130309657 CATGTTTGGACCCCCCCCGCTGG - Intronic
1061418021 9:130458544-130458566 CATACTTGGCCCCCTCCCGCTGG - Exonic
1185838485 X:3367466-3367488 CATACTTGGTCCCCTCCTGCTGG - Intergenic
1196434819 X:115665212-115665234 CTTACTTGGCCCTCTCCTGCTGG - Intergenic
1201237276 Y:11923430-11923452 CGTACTTGGCCCCCTCCTGCTGG + Intergenic