ID: 1088186446

View in Genome Browser
Species Human (GRCh38)
Location 11:107176627-107176649
Sequence GTCCCACGGCACCACGGGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 1, 2: 2, 3: 10, 4: 78}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088186440_1088186446 2 Left 1088186440 11:107176602-107176624 CCCAGCGGGAGGGGGCCAAATAT 0: 1
1: 1
2: 2
3: 7
4: 36
Right 1088186446 11:107176627-107176649 GTCCCACGGCACCACGGGAAAGG 0: 1
1: 1
2: 2
3: 10
4: 78
1088186432_1088186446 23 Left 1088186432 11:107176581-107176603 CCCACAAACAAGTGGAAGTCGCC 0: 1
1: 0
2: 4
3: 8
4: 55
Right 1088186446 11:107176627-107176649 GTCCCACGGCACCACGGGAAAGG 0: 1
1: 1
2: 2
3: 10
4: 78
1088186441_1088186446 1 Left 1088186441 11:107176603-107176625 CCAGCGGGAGGGGGCCAAATATG 0: 1
1: 1
2: 2
3: 9
4: 45
Right 1088186446 11:107176627-107176649 GTCCCACGGCACCACGGGAAAGG 0: 1
1: 1
2: 2
3: 10
4: 78
1088186433_1088186446 22 Left 1088186433 11:107176582-107176604 CCACAAACAAGTGGAAGTCGCCC 0: 1
1: 1
2: 3
3: 11
4: 43
Right 1088186446 11:107176627-107176649 GTCCCACGGCACCACGGGAAAGG 0: 1
1: 1
2: 2
3: 10
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088186446 Original CRISPR GTCCCACGGCACCACGGGAA AGG Intergenic
903446397 1:23424939-23424961 GTCCCCCGGCGCCCCTGGAAGGG - Intergenic
904624366 1:31793746-31793768 CTCCCACGGAACCACAGGACAGG - Exonic
905136926 1:35807628-35807650 GCCGGAAGGCACCACGGGAATGG - Intergenic
905675324 1:39820637-39820659 CTCCCTCGGCACCACGGGACTGG - Intergenic
915302942 1:154961884-154961906 TTACCACGGCACCACGCGAGTGG + Intronic
916314958 1:163438753-163438775 GTCCCATGTCAACAAGGGAAGGG - Intergenic
922067521 1:222158514-222158536 CTCCCAAGGGACCAAGGGAAGGG + Intergenic
1068674568 10:59757521-59757543 GTCTCAGAGCCCCACGGGAAAGG + Intergenic
1076999691 11:316343-316365 GTCCCCCGGCACCCCGCGTAGGG - Intergenic
1077334889 11:1998820-1998842 TTCCCATGGCCCCACCGGAAAGG + Intergenic
1083710467 11:64545319-64545341 GTCCCAGAGCAGCATGGGAAAGG - Intergenic
1083721854 11:64607420-64607442 GTCCAGCAGCACCACGGGCATGG - Exonic
1088186446 11:107176627-107176649 GTCCCACGGCACCACGGGAAAGG + Intergenic
1089752392 11:120660928-120660950 GTCCCACAGCAACAAGGCAAGGG - Intronic
1202817872 11_KI270721v1_random:54002-54024 TTCCCATGGCCCCACCGGAAAGG + Intergenic
1094713235 12:32986180-32986202 GTCCCATGGCGTCACGGGAAAGG + Intergenic
1099328699 12:81253312-81253334 CTGCCACGGTACCATGGGAAAGG - Exonic
1114671005 14:24411059-24411081 GTCCCACGACCCCACAGGCATGG + Exonic
1122992012 14:105240957-105240979 GCCCCACGAGACCACGGGCAGGG + Intronic
1129717306 15:77859889-77859911 GTCCAGCTGCACCAGGGGAAGGG + Intergenic
1132069097 15:98759902-98759924 GTCTCACGGTACCACGGGACAGG - Intronic
1134081719 16:11329290-11329312 GTCACACTGCTCCAGGGGAAAGG + Intronic
1134683286 16:16141514-16141536 GTCTCAGGGCACCAGGGGCAGGG - Exonic
1141523446 16:84596625-84596647 TTCCCACGGCACCCAGGGCATGG + Intronic
1143927284 17:10383105-10383127 GTCCCAGGGCATCATGGGAAGGG + Intergenic
1144080955 17:11763374-11763396 GTCCAACAGCACCACCAGAATGG + Intronic
1147862775 17:43533290-43533312 GTCCAAGGGCACCAGGGGCAGGG + Exonic
1148322708 17:46767156-46767178 GTTCCACAGCACCCCGGGATAGG - Intronic
1149868891 17:60165598-60165620 ATCCCACGGCTCCTGGGGAAGGG - Intronic
1152770301 17:82163443-82163465 GTGCCATGGCCTCACGGGAAAGG - Intronic
1155918161 18:31576247-31576269 GCCCCATGGCACCACAGGGATGG + Intergenic
1160511013 18:79453392-79453414 GTGCCACGGCGCCATGGGTAAGG + Intronic
1161683759 19:5693239-5693261 GGCCCACACCACCACGGGACAGG - Intronic
1163587731 19:18173204-18173226 GTCCCACGGGACCACGGTGAGGG + Intronic
1165779158 19:38422229-38422251 GCCCCAAGGCACCACGGGAGAGG + Intronic
925295646 2:2774730-2774752 GTCCCAGGGGACCAAGGCAAGGG - Intergenic
926336750 2:11869004-11869026 CTCCCACAGCACCGAGGGAAAGG + Intergenic
926764409 2:16311675-16311697 ATCCCACTGCACCACGGTGAGGG + Intergenic
927640376 2:24841879-24841901 GTCCCCAGGCACCACAGGGAGGG - Intronic
928607370 2:32955004-32955026 GTCCAGCGGGACCACTGGAAGGG + Intronic
929158777 2:38811311-38811333 GTCCCACAGTGCCATGGGAAAGG - Intronic
930326212 2:49922168-49922190 GTCCAGCAGCACCACGGGTATGG - Exonic
937317893 2:120943612-120943634 GTCCCAAAGCACCAGGGGCATGG - Intronic
942678852 2:178455555-178455577 GTCCCAGGGCATCAGGAGAAAGG + Intronic
947523638 2:230865881-230865903 GTCCCCCGACCCCACGGGGAGGG + Intronic
948002256 2:234577831-234577853 GGCCCACGGCAGCACTGGTAGGG - Intergenic
1171168998 20:22998867-22998889 TTCCCACGGCTTCTCGGGAATGG - Intergenic
1173681505 20:44885602-44885624 TTGCCACGGCCCCACGGGAGGGG - Intergenic
1175712894 20:61235247-61235269 AGCCCACGGCAGCAGGGGAAGGG + Intergenic
1175991007 20:62789120-62789142 CTCCCAGGGGGCCACGGGAAGGG + Intergenic
1180177655 21:46098262-46098284 GTCCCTCGGGTCCCCGGGAAGGG + Intronic
1181490128 22:23256383-23256405 TTCCCACAGCACCCCGGGCAAGG - Intronic
1181583260 22:23839310-23839332 GACCCACGACACCACGGGGGCGG + Intergenic
1184836897 22:47029256-47029278 GTCCCTGGGCCCCATGGGAAGGG - Intronic
1184836910 22:47029294-47029316 GTTCCCGGGCCCCACGGGAAGGG - Intronic
1185292497 22:50034241-50034263 GGCCCACAGCACCACAGGGAAGG - Intronic
966194289 3:177298036-177298058 GTCCCATGGCACCACGGGAAAGG - Intergenic
968996363 4:3948154-3948176 CTCCCACGGCACCACAGGCCTGG - Intergenic
969817603 4:9698065-9698087 CTCCCACGGCACCACAGGCCTGG + Intergenic
977444148 4:97107538-97107560 GTCCCAAGGAATCAAGGGAAGGG + Intergenic
977684940 4:99836941-99836963 GTTCTACGGCAGCAAGGGAATGG - Intronic
981526963 4:145716224-145716246 GTCCCAGGTCACCATGAGAAAGG - Intronic
992641842 5:78774465-78774487 CTCCCATGGCACCAGGGCAAAGG + Intergenic
996464484 5:123783439-123783461 GTCCCAGGGCACAAGTGGAAGGG + Intergenic
997818357 5:137039602-137039624 GTCCCACGCCCCCATGGGCAGGG + Intronic
998743294 5:145229154-145229176 GTCCCACAGCCCCACAAGAAAGG + Intergenic
1002492130 5:179586180-179586202 GGCACACGGCATCATGGGAAGGG - Intronic
1005360197 6:25024127-25024149 GTCCCGCGGCGCCACCGGTAAGG - Intronic
1010816068 6:80359396-80359418 GTCCCAGTTCACCACGGGAAGGG - Intergenic
1018017651 6:159727057-159727079 GCCCCAGGGCATCACGGGAAGGG - Exonic
1025019413 7:55468776-55468798 GCCCCAGGGTACCACGGGACAGG + Intronic
1025105076 7:56163881-56163903 TTCCCAAGGCAGCAGGGGAAAGG + Intergenic
1028338035 7:89681946-89681968 CTCTCAGGGCACCATGGGAAAGG - Intergenic
1029669547 7:102019684-102019706 GTACAACTCCACCACGGGAAGGG - Intronic
1032845086 7:135745417-135745439 CTGCCAGGGCACCACTGGAAGGG - Intronic
1034358587 7:150474003-150474025 GTCCCACAGGCCCAAGGGAAAGG + Exonic
1034359646 7:150483066-150483088 CTCCCAGGGCACCACTGGACAGG - Intergenic
1035699534 8:1627383-1627405 GTCCCTGGGCACCACGGGAGGGG + Intronic
1035704419 8:1664265-1664287 TACCCATGCCACCACGGGAAGGG - Intronic
1036380889 8:8235860-8235882 CTCCCACAGCACCACGGGTCTGG + Intergenic
1040877466 8:52168122-52168144 GTCCCACGGCACTTGGGGCACGG + Intronic
1041678713 8:60564288-60564310 TACCCACAGCACCAAGGGAAAGG - Intronic
1048606438 8:135973483-135973505 ATCCCAGGGCAGCAAGGGAAAGG + Intergenic
1049694816 8:143977961-143977983 GTACCACGGCACGACGGCACCGG - Exonic
1052927868 9:34032442-34032464 GTCCCAAGGCTTCACAGGAAAGG + Intronic
1055626053 9:78178603-78178625 GTCCCACGGTGCCACGGGAAAGG + Intergenic
1056100885 9:83299701-83299723 GTCCCGCATCACCACAGGAATGG + Intronic
1057602508 9:96471059-96471081 GTCCCAGGGCACCCCGGAAGAGG + Exonic
1060540453 9:124426524-124426546 TTCTCAGGGCATCACGGGAAGGG + Intergenic
1061418025 9:130458568-130458590 GTCCCACGGCGCCACAGGAAAGG + Exonic
1196434822 X:115665236-115665258 GTCCCACAGCGCCACAGGAAAGG + Intergenic
1200279362 X:154763256-154763278 GTCCCACGCCACCGCGGGGTGGG - Intronic