ID: 1088191659

View in Genome Browser
Species Human (GRCh38)
Location 11:107234480-107234502
Sequence GACAGTTCTTGGCCTGTTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088191659_1088191662 15 Left 1088191659 11:107234480-107234502 CCAGTAACAGGCCAAGAACTGTC No data
Right 1088191662 11:107234518-107234540 AGTTATCTGCAGAATATGGCAGG No data
1088191659_1088191663 16 Left 1088191659 11:107234480-107234502 CCAGTAACAGGCCAAGAACTGTC No data
Right 1088191663 11:107234519-107234541 GTTATCTGCAGAATATGGCAGGG No data
1088191659_1088191661 11 Left 1088191659 11:107234480-107234502 CCAGTAACAGGCCAAGAACTGTC No data
Right 1088191661 11:107234514-107234536 GAGTAGTTATCTGCAGAATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088191659 Original CRISPR GACAGTTCTTGGCCTGTTAC TGG (reversed) Intergenic
No off target data available for this crispr