ID: 1088191662

View in Genome Browser
Species Human (GRCh38)
Location 11:107234518-107234540
Sequence AGTTATCTGCAGAATATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088191658_1088191662 16 Left 1088191658 11:107234479-107234501 CCCAGTAACAGGCCAAGAACTGT No data
Right 1088191662 11:107234518-107234540 AGTTATCTGCAGAATATGGCAGG No data
1088191660_1088191662 4 Left 1088191660 11:107234491-107234513 CCAAGAACTGTCTCTCAAAAGAA No data
Right 1088191662 11:107234518-107234540 AGTTATCTGCAGAATATGGCAGG No data
1088191659_1088191662 15 Left 1088191659 11:107234480-107234502 CCAGTAACAGGCCAAGAACTGTC No data
Right 1088191662 11:107234518-107234540 AGTTATCTGCAGAATATGGCAGG No data
1088191657_1088191662 22 Left 1088191657 11:107234473-107234495 CCAAAGCCCAGTAACAGGCCAAG 0: 169
1: 171
2: 103
3: 76
4: 232
Right 1088191662 11:107234518-107234540 AGTTATCTGCAGAATATGGCAGG No data
1088191656_1088191662 25 Left 1088191656 11:107234470-107234492 CCACCAAAGCCCAGTAACAGGCC 0: 144
1: 161
2: 86
3: 68
4: 218
Right 1088191662 11:107234518-107234540 AGTTATCTGCAGAATATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088191662 Original CRISPR AGTTATCTGCAGAATATGGC AGG Intergenic
No off target data available for this crispr