ID: 1088196136

View in Genome Browser
Species Human (GRCh38)
Location 11:107276053-107276075
Sequence GTCCCATGGGGACATGGTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088196136_1088196149 30 Left 1088196136 11:107276053-107276075 CCATCACCATGTCCCCATGGGAC No data
Right 1088196149 11:107276106-107276128 AGGTCTGAGTTATCCAGATCTGG No data
1088196136_1088196146 0 Left 1088196136 11:107276053-107276075 CCATCACCATGTCCCCATGGGAC No data
Right 1088196146 11:107276076-107276098 CCAGTTCTGGCATGAGGGATTGG No data
1088196136_1088196142 -6 Left 1088196136 11:107276053-107276075 CCATCACCATGTCCCCATGGGAC No data
Right 1088196142 11:107276070-107276092 TGGGACCCAGTTCTGGCATGAGG No data
1088196136_1088196147 10 Left 1088196136 11:107276053-107276075 CCATCACCATGTCCCCATGGGAC No data
Right 1088196147 11:107276086-107276108 CATGAGGGATTGGTCAGCCAAGG No data
1088196136_1088196143 -5 Left 1088196136 11:107276053-107276075 CCATCACCATGTCCCCATGGGAC No data
Right 1088196143 11:107276071-107276093 GGGACCCAGTTCTGGCATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088196136 Original CRISPR GTCCCATGGGGACATGGTGA TGG (reversed) Intergenic
No off target data available for this crispr