ID: 1088205975

View in Genome Browser
Species Human (GRCh38)
Location 11:107393004-107393026
Sequence GTGGATTGCCTTAAATCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 90}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088205975 Original CRISPR GTGGATTGCCTTAAATCTCC TGG Intronic
906958886 1:50402435-50402457 TTGGATTGCCTTAGCTCTTCAGG - Intergenic
909398410 1:75196408-75196430 GTGTATTGCTTTCAAGCTCCAGG - Intergenic
910036625 1:82796681-82796703 GTGGCTTGCCTGAAATCTGGTGG - Intergenic
911025479 1:93431718-93431740 TGGGATTGCTTTGAATCTCCAGG - Intergenic
1062901029 10:1147352-1147374 GTGCATTTCCTCAAGTCTCCTGG + Intergenic
1063806907 10:9655532-9655554 GTGGATTACTTTTAATCTTCTGG - Intergenic
1064608969 10:17077172-17077194 GTGGATTGCCTTATTCGTCCAGG + Intronic
1069223124 10:65908250-65908272 GTGCCTTGCCTGAAATCTACTGG - Intergenic
1072086839 10:92088016-92088038 ATGGTTTGCCTGAAGTCTCCTGG - Intronic
1073140114 10:101241736-101241758 GTGGAATGCCTTGAATCTCCAGG + Intergenic
1074266408 10:111908498-111908520 GTGCATTGCCTTACCTCTGCAGG + Intergenic
1074735733 10:116430813-116430835 GTCCATTGCCTTCAATCTTCTGG + Intronic
1075415751 10:122261938-122261960 TAGGATTGCATTAAATCTGCAGG + Intergenic
1077776903 11:5281820-5281842 GTTGATTGCCTTAATTCATCAGG - Intronic
1081774295 11:45666753-45666775 GTGGATGGCTTGAAAACTCCAGG + Intergenic
1084973380 11:72783309-72783331 GTGAATGACCTTAGATCTCCAGG + Intronic
1087778979 11:102283432-102283454 GTGGATTGTATTAGATTTCCAGG + Intergenic
1088205975 11:107393004-107393026 GTGGATTGCCTTAAATCTCCTGG + Intronic
1096621973 12:52870776-52870798 GTGGACTGCCTTCAGACTCCAGG - Intergenic
1097600426 12:61685448-61685470 TTGGATTGATTTAAAACTCCAGG + Intergenic
1099247746 12:80214407-80214429 CTGGAGAGCCTAAAATCTCCAGG + Intronic
1109117238 13:58403998-58404020 GGGAATTGCATTAAATCTGCAGG + Intergenic
1109945167 13:69423347-69423369 GTGGATTGTCTTAGCTTTCCTGG - Intergenic
1110578917 13:77095512-77095534 GTGCATTGGCTTTAATCACCTGG + Exonic
1113771920 13:112915747-112915769 GTGGATTGCCCAGCATCTCCTGG + Intronic
1116018759 14:39436276-39436298 GTGGATGTCCTCAAAACTCCAGG - Intergenic
1117567898 14:57015051-57015073 GTGGATTTCCTCAAATATCTAGG + Intergenic
1121750336 14:96349077-96349099 GTGGGCTGCCTTGAATCTGCAGG - Intronic
1122064865 14:99165794-99165816 GTTTATTCCCTTAACTCTCCTGG - Intergenic
1124439712 15:29677129-29677151 GGGGGTTTCCATAAATCTCCCGG - Intergenic
1128177765 15:65571617-65571639 GTGGATTCCCTTATATCCACTGG + Exonic
1140380276 16:74480647-74480669 GAGGATTGCCTTCAAGCCCCGGG - Intronic
1142553660 17:757028-757050 GTGCCTTGAGTTAAATCTCCGGG - Intergenic
1146686548 17:34845143-34845165 GGGGCTTTCCTTAACTCTCCTGG + Intergenic
1146895870 17:36541633-36541655 GTTGATTGCCTTTACTTTCCTGG + Intronic
1151869220 17:76825253-76825275 GCGGATTTTCTTAAATCTCTAGG + Intergenic
1156810859 18:41249727-41249749 GTGGATTGGCTTGAATTTACAGG - Intergenic
1157093305 18:44661723-44661745 GTGTATTGCCTTTAATCTCTGGG - Intergenic
926411788 2:12611506-12611528 TTGGATTGCTTTGAATCTACAGG - Intergenic
927055144 2:19359968-19359990 GAGGATTTCCTTATATCCCCAGG + Intergenic
929671716 2:43881064-43881086 GTAGCTTGCCTTAACTCCCCAGG + Intergenic
933745386 2:85567156-85567178 GTGGATGGCCTAGAAACTCCTGG - Intronic
938793172 2:134694860-134694882 CTGGAATGCCAGAAATCTCCCGG + Intronic
942327995 2:174791809-174791831 GTGGATTTCCTCTGATCTCCTGG + Intergenic
947917266 2:233840990-233841012 AAGTATTGCCTCAAATCTCCTGG - Exonic
948041243 2:234903346-234903368 GTGGATTGCCTGCAATGTTCAGG - Intergenic
948543613 2:238708616-238708638 GTTGATAGCCTTAAATCTATAGG + Intergenic
1169011543 20:2255330-2255352 GTGGGTGGCCTTATCTCTCCAGG - Intergenic
1169074090 20:2750913-2750935 GTGGATTTCCTTTAGTTTCCCGG - Intronic
1175074924 20:56364158-56364180 GTGGATTGTTTTAAACCACCAGG - Intronic
1175376639 20:58531073-58531095 GTGGCTTGCCTGACATCTCAGGG + Intergenic
1179003671 21:37488825-37488847 GTGGATGGCTTTTAATCTCCTGG - Intronic
1183482712 22:38073938-38073960 GAAGATGGCCCTAAATCTCCAGG - Intronic
1183485950 22:38087897-38087919 GTGGATGGCCTTAAATGGCGGGG - Intronic
952194776 3:31063124-31063146 GTGCATTGATTTAAAGCTCCTGG + Intergenic
952420047 3:33122401-33122423 GTGGATTTTCTTAAACCTCCTGG - Intronic
954404547 3:50338063-50338085 GGGGCTTCCCTTCAATCTCCGGG - Intronic
957805044 3:85135956-85135978 GTAGATTGCTATAAATCTCTAGG - Intronic
961832804 3:129632927-129632949 GTGGATTGCCTGAGGTCACCAGG + Intergenic
965894662 3:173560495-173560517 GTTGATTGCTTTAAATCTACAGG - Intronic
974719039 4:65712695-65712717 GTGGATTCCTTTATTTCTCCTGG - Intergenic
979585216 4:122407354-122407376 GTGGCCTGCTTGAAATCTCCTGG - Intronic
981520941 4:145661725-145661747 GTGTATTGACTTCATTCTCCTGG + Intergenic
984191273 4:176608583-176608605 TTGAATTTCCTTACATCTCCAGG - Intergenic
984403254 4:179294482-179294504 GAGTATTCCCCTAAATCTCCTGG - Intergenic
988522968 5:31962804-31962826 GAGGAGTTCCTTAAATCTCTGGG - Intronic
988595232 5:32585035-32585057 GTGAACTCCCTTACATCTCCAGG + Intronic
988796206 5:34656041-34656063 GTGGCTTGCTTTTAGTCTCCAGG - Intergenic
995991053 5:118240173-118240195 GTGGATTCCCTTGAATCCCCTGG + Intergenic
997621502 5:135300538-135300560 GTGGATTGCATTGAGTCTACAGG - Intronic
998367662 5:141641228-141641250 GTGAAATGCCTGAAATCTCTGGG - Exonic
1000109905 5:158098490-158098512 CTGGATTGCCTGAAATGGCCAGG + Intergenic
1004256663 6:14070725-14070747 GTGGATTTCCTAATATATCCAGG - Intergenic
1005128310 6:22473723-22473745 GTTGATTGCTGTCAATCTCCTGG + Intergenic
1008006762 6:46418621-46418643 GGGGAGTGGCTTAAATTTCCAGG + Intronic
1008443842 6:51564983-51565005 GTGGATATCCTAAAATTTCCTGG - Intergenic
1014041881 6:116837121-116837143 GTTGATTGCCTAAAATCTCAGGG - Intergenic
1018204154 6:161421181-161421203 GAGGAATGCCTCAACTCTCCTGG - Intronic
1021378541 7:19938253-19938275 ATGGATTGCATTAAATCTGTAGG - Intergenic
1022470710 7:30680472-30680494 CTGGATGGCCCTTAATCTCCGGG + Intronic
1027139555 7:75647633-75647655 GTGAATTGCCTGAGAGCTCCGGG - Intronic
1028676181 7:93464526-93464548 ATGGATTGCATTAAAACTCCTGG + Intronic
1031262770 7:119543301-119543323 CTGGATTGCTTTCAAACTCCTGG - Intergenic
1039449677 8:37662052-37662074 GTGGATTGCATGAAGCCTCCTGG - Intergenic
1041164647 8:55079265-55079287 GTGGTTTGCCTTACTTTTCCTGG + Intergenic
1044517733 8:93158638-93158660 ATGGAATGCCTTGAATCACCAGG + Intronic
1044912618 8:97076657-97076679 GTGGATTGAGTTAAATCTAGAGG + Intronic
1046185329 8:110707156-110707178 GTGGATTACATAAAATCTGCAGG + Intergenic
1054725250 9:68643571-68643593 CTTTATTGCCTTAAATTTCCAGG + Intergenic
1059992904 9:119882017-119882039 GTGGATTCCCTTAGGTTTCCTGG - Intergenic
1187276702 X:17822456-17822478 GTGGAGGGGCTGAAATCTCCTGG - Intronic
1188409643 X:29855513-29855535 GTAGATGGGCTTAAAACTCCAGG - Intronic
1190923232 X:54877281-54877303 GGGGATTCCCTTAAATCACAAGG + Intergenic
1191943526 X:66504626-66504648 GTGGATTCCCTTAATTCCCAGGG - Intergenic
1193591982 X:83400314-83400336 AGGGATTGCCTTGAATCTGCAGG - Intergenic
1194135924 X:90141581-90141603 GTGGATTCCCTTAAGTGTCCAGG + Intergenic
1194257102 X:91647478-91647500 TGGGATTGCATTAAATCTGCAGG + Intergenic
1195409733 X:104556816-104556838 ATGGATTGCCTAAAATGTCCAGG + Intergenic
1196640663 X:118056392-118056414 GAGGATTGTGTTAAATCTGCAGG - Intronic
1200481680 Y:3711657-3711679 GTGGATTCTCTTAAGTGTCCAGG + Intergenic
1200575812 Y:4886747-4886769 TGGGATTGCATTAAATCTGCAGG + Intergenic