ID: 1088208915

View in Genome Browser
Species Human (GRCh38)
Location 11:107430261-107430283
Sequence TGTGAGCCTGTATATGGATA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 167}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088208910_1088208915 14 Left 1088208910 11:107430224-107430246 CCTTTACAAGGACTAGATCAGGG 0: 1
1: 0
2: 0
3: 7
4: 66
Right 1088208915 11:107430261-107430283 TGTGAGCCTGTATATGGATAGGG 0: 1
1: 0
2: 0
3: 11
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088208915 Original CRISPR TGTGAGCCTGTATATGGATA GGG Intronic
901214451 1:7548053-7548075 TGTGAGCATTTATATTGATCAGG + Intronic
901891179 1:12266719-12266741 TATGTGCCTGTAGATAGATAGGG + Intronic
904391217 1:30187476-30187498 TGTGTGCGTATATATGCATATGG - Intergenic
906913628 1:49983347-49983369 TGTGAGGCTGTAGCTGGATTAGG - Intronic
907201875 1:52734314-52734336 TGTGAGCCTGTAGATGAATTGGG + Intronic
907598806 1:55745986-55746008 CGTGAGCCTGAATATGGCTCAGG - Intergenic
910793707 1:91076431-91076453 TGTGTGGCTGTATTTGGAAATGG + Intergenic
914396293 1:147272054-147272076 GCTGTGCCTGTATATGGAAAGGG + Intronic
915042658 1:152981889-152981911 TGTGAGGATGGAGATGGATAGGG + Intergenic
920312243 1:205055390-205055412 TGTGAGGGTGTCTGTGGATATGG + Intronic
921940541 1:220834278-220834300 TGTGAGGTTGTTTCTGGATAAGG + Intergenic
922452747 1:225750177-225750199 TGTTAGCCTCTACATGGATCAGG + Intergenic
1062808882 10:447319-447341 TGTGATCCTGAATATCGACAGGG - Intronic
1062809131 10:448668-448690 TGTGATCCTGAATATCGACAGGG - Intronic
1063687720 10:8254438-8254460 TGTGTGTGTGTATATGTATATGG + Intergenic
1065148431 10:22797217-22797239 TGTGTGCGTATATATGTATATGG + Intergenic
1066155925 10:32677829-32677851 TGTGAACCAATATATGCATATGG - Intronic
1072769756 10:98127878-98127900 TGTGAGGGAGTGTATGGATATGG + Intergenic
1072943023 10:99784485-99784507 GGTAAGGCTGGATATGGATATGG + Intronic
1073215447 10:101833690-101833712 TGTGAGCCTGTGTATGGGACAGG - Intronic
1073673697 10:105620938-105620960 TGTGTGTATGTATATGTATATGG - Intergenic
1074641218 10:115383846-115383868 TCTGAGTCTGTATTTGGAAAAGG - Intronic
1075297729 10:121292756-121292778 TGTGTGCCTGTATATGTGTCTGG - Intergenic
1076099340 10:127762952-127762974 TGTGAGCTTGTATATTTATTCGG + Intergenic
1078488847 11:11750685-11750707 TGTGAGTTTGAATATGGAAAGGG + Intergenic
1078567400 11:12428289-12428311 TGAGAGACTCTATATGGAAAAGG - Intronic
1078596100 11:12688048-12688070 TGTAGGCCTGGATATGGAAATGG + Intronic
1080110745 11:28564689-28564711 TGTGTGTGTGTATATGGATATGG - Intergenic
1082101411 11:48176223-48176245 TGGGAGCCTTTATATGGAGTTGG + Intergenic
1082701561 11:56438152-56438174 TGTGAGACTGTAGATGGAGCTGG - Intergenic
1084715155 11:70868978-70869000 TGTGCGACTGTATAGGGAGATGG + Intronic
1086120860 11:83303515-83303537 TGGGAGCCTGGATATGGACTTGG - Intergenic
1086775161 11:90821707-90821729 TGTATGTCTGTATATGGAAAAGG + Intergenic
1087561142 11:99792452-99792474 TGTGCTGCTGGATATGGATATGG + Intronic
1088084748 11:105963818-105963840 TGTGAAACTGTCTTTGGATATGG + Intronic
1088108810 11:106237115-106237137 GGTGAGTTTGTATGTGGATATGG - Intergenic
1088208915 11:107430261-107430283 TGTGAGCCTGTATATGGATAGGG + Intronic
1089305366 11:117523020-117523042 TGTGAGAGTGTACTTGGATATGG + Intronic
1089639697 11:119839622-119839644 TGTCAGCCTGCAAATGGAAAAGG - Intergenic
1091385367 12:91353-91375 TGTGAGCCTGGCTCTGGATGCGG + Intronic
1091401024 12:180775-180797 TGTGACCCTGCATAGGGATGGGG + Intergenic
1092136826 12:6155290-6155312 TCTGAGCCTGGATCTGGATCTGG - Intergenic
1095477566 12:42601374-42601396 TGTGACCCTGTGTATGTGTATGG + Intergenic
1096608829 12:52787811-52787833 TGTGAGCCTGTAGATTCAGAAGG - Intergenic
1098741289 12:74176810-74176832 TGTGAGGCTGTATTTGGAGATGG + Intergenic
1099477630 12:83126659-83126681 TGTGAGTATGTATATGGGTGGGG + Intronic
1099498893 12:83387101-83387123 TGTGAGGCTGTATAAGGCCATGG + Intergenic
1100581729 12:95945683-95945705 TGTGAGTGTGTATAGGGAGAGGG + Intronic
1102915553 12:116749664-116749686 TGTGACCCTGTTTAAAGATAGGG - Intronic
1109326471 13:60873298-60873320 TGTGAGTCAGTGTGTGGATAGGG + Intergenic
1111271003 13:85885306-85885328 AGTGAGCTTGTATAGGGAAAAGG + Intergenic
1114285175 14:21235112-21235134 TGTGAATCTGCATATGGTTATGG - Intronic
1116604167 14:46968292-46968314 TGTAAGCCTGTCTCTGGAGAGGG - Intronic
1117369453 14:55063098-55063120 TATGGGCCTGGAGATGGATATGG - Exonic
1119988974 14:79173355-79173377 TGTGTGCCTGTGTAAAGATAGGG - Intronic
1121366304 14:93314562-93314584 TGTGACCCTCAATATGGATTTGG - Intronic
1122708551 14:103638088-103638110 TCTGCGCCTGTATATGGGGATGG + Intronic
1123080273 14:105689679-105689701 TGTGAGTGTGTATAGGTATATGG - Intergenic
1123144115 14:106111349-106111371 TGAGAGCCTGTGGATGGAGAAGG + Intergenic
1123220888 14:106854438-106854460 TGAGAGCCTGTGGATGGAGAAGG + Intergenic
1124519856 15:30398643-30398665 TGTGTGTGTGTATATGTATATGG - Intergenic
1124538798 15:30567578-30567600 TGTGTGTGTGTATATGTATATGG + Intergenic
1124896400 15:33781182-33781204 TGTGATCCTGCCTAAGGATAAGG + Intronic
1127676867 15:61247709-61247731 TGTGAGCATGTATATGCAACAGG + Intergenic
1129610226 15:77047891-77047913 TGAGAGTCTGTTTATGGATTGGG - Intronic
1130313281 15:82772779-82772801 TGTGAGACTGTATAGGGGTGGGG - Intronic
1132944392 16:2524609-2524631 AGTGAGCCTGTGTATCCATAGGG + Intronic
1136083184 16:27866540-27866562 TGAGAGCCTGCATTTGGGTAGGG - Intronic
1138372169 16:56535907-56535929 TGTGAGCTTGTTTAGAGATAGGG + Intergenic
1142501104 17:333758-333780 TGTGAACCTGACTATGGAAAAGG - Exonic
1142760205 17:2037511-2037533 TGTGGGCCTGTCTAGGGACAGGG - Intronic
1146919886 17:36703445-36703467 TGGGAGCCTAAATATGGAGAGGG + Intergenic
1148031061 17:44621378-44621400 TGTGTGCATGTGGATGGATATGG - Intergenic
1148543988 17:48502948-48502970 TGTGAGACTGCATAAGGAAAGGG + Intergenic
1148830441 17:50427211-50427233 TGTGGGCCTGGACATGGAAAAGG + Intronic
1149683990 17:58525014-58525036 TGTGTACCTGTGTATGGAGAAGG + Intronic
1149990676 17:61381767-61381789 TGTGTGCCTGTATGTGGTTCTGG + Intronic
1152028762 17:77828496-77828518 TGTGTGCATGTATATGCATGTGG + Intergenic
1152028775 17:77828661-77828683 TGTGTGCATGTATATGCATGTGG + Intergenic
1152028781 17:77828777-77828799 TGTGTGCATGTATATGCATGTGG + Intergenic
1152028805 17:77829087-77829109 TGTGTGCATGTATATGCATGTGG + Intergenic
1152028810 17:77829201-77829223 TGTGTGCATGTATATGCATGTGG + Intergenic
1156769753 18:40705421-40705443 TGTGTGCTTGTATTTGGCTATGG + Intergenic
1158455192 18:57599860-57599882 GGAGAGCCAGGATATGGATAAGG - Intergenic
1160427399 18:78787737-78787759 TGTGAGCCTGGTTCTGGGTATGG - Intergenic
1162761184 19:12889198-12889220 TGTGTGTCTGTCTATGTATATGG + Intergenic
1163117848 19:15199164-15199186 TGTGTGTCTGTATGTGGATTTGG + Intronic
1166306119 19:41938034-41938056 TGCGAGCCTGTTGATGGATGGGG + Intergenic
925854493 2:8116707-8116729 TGTGAGGCTGGAGATGGATGAGG - Intergenic
925876222 2:8313166-8313188 TGTGTGGCTGTATTTGGAGATGG - Intergenic
925931088 2:8708584-8708606 TGTGAGCCTTCATATGGAAAAGG - Intergenic
927155776 2:20220345-20220367 TGTGCGCATGTGTATGGGTATGG - Intronic
932781040 2:74558659-74558681 TGTGAACCTGAGCATGGATATGG + Exonic
934691635 2:96365200-96365222 TGTGTCCCTGTATGTGGAAAGGG + Intronic
935541832 2:104357611-104357633 TGTGTGCCTGTATATACACATGG + Intergenic
936706723 2:115084112-115084134 TGTGAGCAGGTATATTAATAGGG - Intronic
939396250 2:141633338-141633360 TATAAACATGTATATGGATATGG + Intronic
940834975 2:158511019-158511041 TGTGAGCCTGAGTATGGTGAAGG + Intronic
941484826 2:166067073-166067095 TGTGTGCCTCTATAAGGAAATGG - Intronic
942153275 2:173100246-173100268 TGTGAGCCTGAATTTGGTGAAGG + Intronic
943800594 2:192052775-192052797 TGTGTGCCTGTTTATGGGGAAGG - Intronic
944891820 2:204125448-204125470 TGTGAGCCTGTGTTTGGAAACGG - Intergenic
947628882 2:231638767-231638789 TGTATGCATGTATATAGATAGGG - Intergenic
1175406624 20:58737020-58737042 AGTAAGCCTTTATAGGGATAAGG - Intergenic
1178481205 21:32980595-32980617 TGTGTGCCTGTAAATGGAAATGG + Intergenic
1179070931 21:38070068-38070090 TGTGAGCATGCTTATGCATAAGG + Intronic
1182021117 22:27082296-27082318 TGTGAGCATGTGTCTGGATGGGG - Intergenic
1182479262 22:30596353-30596375 TGTGCGTGTGTATATGGATATGG + Intronic
953098885 3:39806928-39806950 TGTGAGCCTGTTGATTGCTATGG - Intergenic
954164515 3:48745505-48745527 TGTGAGGGTGTTTTTGGATAAGG + Intronic
957610959 3:82466061-82466083 TGTGTGCATATATATGTATATGG - Intergenic
962163377 3:133023021-133023043 TGTGTGTCTGTATATGTACATGG + Intergenic
963299185 3:143579979-143580001 TTTGATCCTGTAATTGGATAAGG + Intronic
964036624 3:152206828-152206850 TGTGAATCTGGACATGGATAAGG + Intergenic
967037813 3:185661267-185661289 TTTGAGTCTGTTTGTGGATAAGG - Intronic
969650204 4:8462059-8462081 TGTGAACCTGTATATGAAACAGG + Intronic
969913766 4:10469699-10469721 TGTGATGCTGTATCTAGATATGG - Intergenic
972300166 4:37777751-37777773 CGAGAGCCTGTGTATGGAGAGGG - Intergenic
972828092 4:42784999-42785021 TGGGAGCTTGTACATGGAAAAGG - Intergenic
974139689 4:57869395-57869417 TGTGTGTGTGTATATGTATATGG - Intergenic
982600761 4:157445100-157445122 TGTTAGCATGTTTTTGGATATGG + Intergenic
982718066 4:158829727-158829749 TGTGTGTGTGTATAAGGATAGGG + Intronic
983255987 4:165401247-165401269 AGTGAGCCTGTCTATGGAAAAGG - Intronic
983498485 4:168472362-168472384 AGTGATCATGTATATGTATATGG + Intronic
986019214 5:3785508-3785530 TGTGAGTGTGGATATGCATATGG - Intergenic
986019260 5:3785919-3785941 TGTGAGTGTGGATATGCATATGG - Intergenic
986574245 5:9196228-9196250 AGTGTGGCTGTATATGGAGATGG + Intronic
986859645 5:11911757-11911779 AGTGCGCCTGTATTTGGAGATGG + Intergenic
987321829 5:16777603-16777625 AGTTAGACTGTGTATGGATATGG + Intronic
988623826 5:32850008-32850030 TGTGTGGCTGTATTTGGAGATGG + Intergenic
989074028 5:37543486-37543508 TGTGTGCATGTATATATATATGG + Intronic
991243742 5:64487672-64487694 TGTGAGACTTTATAAGGAAAAGG - Intergenic
992890571 5:81200337-81200359 TGTGAGCATCAATATCGATAGGG + Intronic
994285294 5:97956942-97956964 TGTCAACATGTATATTGATATGG + Intergenic
995046283 5:107652229-107652251 TGTAACCTTGTATATGGATTTGG - Intronic
999035585 5:148345385-148345407 TTTGTGCCTTTATATAGATAAGG - Intergenic
1004040907 6:11974485-11974507 AGTGAGCCTGTTTAAGAATATGG + Intergenic
1005108229 6:22248675-22248697 GGTAAGCCTGTATAAGGAAAAGG - Intergenic
1006739475 6:36297120-36297142 ATTGAGCCAGTATATGGATGGGG + Intronic
1007005274 6:38356600-38356622 AGGGAACCTGTATAAGGATATGG - Intronic
1007491960 6:42230029-42230051 TGTGAGACTGTTTATGGAGAGGG + Intronic
1011852099 6:91641832-91641854 AGTGAGCCAATATATGCATACGG + Intergenic
1012355760 6:98311899-98311921 TGTGAGTGTGTATGTGTATACGG - Intergenic
1012704475 6:102503693-102503715 AGAGAGCCTATAAATGGATATGG - Intergenic
1013840183 6:114382332-114382354 TCTGAGTCTGTGTATGGATGTGG + Intergenic
1014048933 6:116928590-116928612 TTTGTGCTTGTACATGGATAAGG - Intronic
1016797957 6:148137977-148137999 TGAGAGACTGTATATGCAAATGG - Intergenic
1019276003 7:176228-176250 TGTGTGCATGCATATGTATATGG + Intergenic
1019902767 7:4036337-4036359 TGTGATCGTGTAAATGGATTTGG + Intronic
1022297528 7:29069823-29069845 TGTGTGCATGTAAATGCATAGGG + Intronic
1023492899 7:40763228-40763250 AGTGAGCCTGAATATGAATTAGG + Intronic
1024746059 7:52407800-52407822 TGTGTGGCTGTATTTGGAGATGG - Intergenic
1028054437 7:86225363-86225385 TGGGAGGCTGTATCTGGACAAGG + Intergenic
1030909515 7:115229270-115229292 TGTGTGCATGTGTATGGATGTGG + Intergenic
1031057298 7:117006628-117006650 GGTGTGCCTCTATATGGTTAGGG - Intronic
1034997941 7:155590251-155590273 TGAGAGCCTGGATATGCAAATGG + Intergenic
1035180679 7:157087029-157087051 TGTGAGCGTGTATATATGTAGGG - Intergenic
1039593409 8:38769528-38769550 TGTGAGACTGTGTATGGGTTGGG + Intronic
1039641075 8:39223217-39223239 TGTGAGAGTGTATTTGGAAAAGG + Exonic
1043512025 8:80959315-80959337 TGTGTGCGTGTGTATGCATACGG + Intergenic
1043842853 8:85129011-85129033 TGCTAGACTGTATATGGGTAGGG - Intronic
1044167289 8:89002306-89002328 TGTGAGAATGTATCTGGATGTGG - Intergenic
1044825677 8:96194640-96194662 TATGAGCCTGTATTTGGAGAAGG + Intergenic
1044888291 8:96803817-96803839 TGTGAGCCTGATTATGGCAAGGG + Intronic
1046581406 8:116097258-116097280 TTTGAGCCTGTGTTAGGATAAGG - Intergenic
1049227414 8:141462807-141462829 GGTGTGCCTCTATATGTATAAGG - Intergenic
1056197842 9:84245818-84245840 TGTGAGGGTGTGTTTGGATAAGG - Intergenic
1062187502 9:135225998-135226020 TGTGAGCATGTATGTGCATGTGG - Intergenic
1187197600 X:17102622-17102644 TTTGAGCCAGTGCATGGATATGG - Intronic
1189096833 X:38149427-38149449 TGATAGCCTGTGTATGGTTATGG + Exonic
1189358565 X:40330232-40330254 TGTGATCTTGTATTTGGATATGG + Intergenic
1191899601 X:66027146-66027168 TCTGAGCAAGAATATGGATAGGG - Intronic
1193069751 X:77295319-77295341 TGTGAGTCTGTATAATGATTTGG - Intergenic
1194073881 X:89363908-89363930 TATAAGCCTGTATATTTATATGG - Intergenic
1194368248 X:93035924-93035946 TGTGACCCTAAATGTGGATAAGG + Intergenic
1195281795 X:103342800-103342822 TGTGCGCCCGTATATGTATGTGG + Intergenic
1199465959 X:148137499-148137521 TGTGATCCTGTATATTAGTAAGG - Intergenic
1200676458 Y:6152189-6152211 TGTGACCCTAAATGTGGATAAGG + Intergenic
1200729266 Y:6715462-6715484 TATAAGCCTGTATATTTATATGG - Intergenic