ID: 1088219002

View in Genome Browser
Species Human (GRCh38)
Location 11:107547440-107547462
Sequence CCTTCAGGTGTATCTGTTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 149}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088219002_1088219005 -6 Left 1088219002 11:107547440-107547462 CCTAGAACAGATACACCTGAAGG 0: 1
1: 0
2: 1
3: 8
4: 149
Right 1088219005 11:107547457-107547479 TGAAGGAGCCTTTACACGCATGG 0: 1
1: 0
2: 1
3: 3
4: 51

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088219002 Original CRISPR CCTTCAGGTGTATCTGTTCT AGG (reversed) Intronic
900216051 1:1482244-1482266 CCTTCAGGCGGATCTGCTCGCGG - Exonic
900223171 1:1520247-1520269 CCTTCAGGCGGATCTGCTCGCGG - Exonic
905316277 1:37083463-37083485 CCTTGAGGTCTCTCTGTTATGGG - Intergenic
908060439 1:60342432-60342454 CCATGAGGTGTATGTCTTCTTGG + Intergenic
909286994 1:73832074-73832096 CCATCAGCTGTTTCTGTGCTGGG - Intergenic
909747766 1:79120097-79120119 GATTCAGGTGTATCATTTCTGGG - Intergenic
913701220 1:121376226-121376248 GCTTCAAGTGTATCTCATCTCGG + Intronic
914041777 1:144056693-144056715 GCTTCAAGTGTATCTCATCTTGG + Intergenic
914136313 1:144903793-144903815 GCTTCAAGTGTATCTCATCTTGG - Intronic
914696560 1:150087679-150087701 CTTTCAGCTGTATCAGTCCTTGG - Intronic
915885947 1:159721347-159721369 CCTTCCTCTGTATATGTTCTGGG - Intergenic
916839238 1:168583165-168583187 CCTTCAGGTGTTTATCTTCTGGG + Intergenic
917133317 1:171763940-171763962 CCTTCAGCTGTCTCGGTGCTTGG + Intergenic
918867086 1:189915662-189915684 CCTTCAAGTGTATTTTTTCAAGG + Intergenic
920030932 1:203036965-203036987 GCCACATGTGTATCTGTTCTAGG + Intronic
920488646 1:206394948-206394970 GCTTCAAGTGTATCTCATCTCGG + Intronic
1065010043 10:21412545-21412567 CCCTCAGATGAATCTGTTTTAGG + Intergenic
1066490516 10:35889635-35889657 CCCTCAGGTGTATCTGCTTTAGG + Intergenic
1066659355 10:37725524-37725546 CCTTCAGGAAGATGTGTTCTTGG - Intergenic
1068844124 10:61652068-61652090 ATTTCTTGTGTATCTGTTCTAGG + Intergenic
1071728115 10:88219914-88219936 CCTTCAGGGGAATCTCCTCTGGG + Intergenic
1072570112 10:96651141-96651163 CCTTCTGCTGTAACTCTTCTGGG - Intronic
1074708276 10:116155513-116155535 CATTAATATGTATCTGTTCTGGG - Intronic
1077647956 11:3942977-3942999 CCTTCTGGGGTGTCTGTTCCAGG - Intronic
1079723161 11:23845596-23845618 ACTGCAGCTGTATCTGCTCTAGG + Intergenic
1080778892 11:35412701-35412723 CCTTCAGGTGTGGCTGTTTAGGG - Intronic
1081365301 11:42227995-42228017 CCTTCAGCAGTATCTCTCCTAGG + Intergenic
1082555217 11:54556504-54556526 CCTTTATGTTTTTCTGTTCTTGG - Intergenic
1087850888 11:103027964-103027986 CATTCATGTGTATATGTACTTGG - Intergenic
1088019707 11:105104716-105104738 CCTTCATGTTTTTCTCTTCTTGG + Intergenic
1088219002 11:107547440-107547462 CCTTCAGGTGTATCTGTTCTAGG - Intronic
1089059053 11:115611307-115611329 CCTTCTGGTATCTCTTTTCTTGG + Intergenic
1093535891 12:20222445-20222467 ACTTTTAGTGTATCTGTTCTAGG - Intergenic
1094543722 12:31384680-31384702 ACTTCAGGTGTAACTTTTTTGGG + Exonic
1098534709 12:71581542-71581564 CCTGCATGTGTATCTGTTTAAGG + Intronic
1100017369 12:90027074-90027096 CTTTCATGTGTGTCTGTTGTGGG + Intergenic
1102220412 12:111190649-111190671 CCTTCAGGTGTGTCTCTGTTAGG - Intronic
1102455226 12:113066769-113066791 CCTCAAGGTGCTTCTGTTCTGGG + Intronic
1102876757 12:116454951-116454973 CCTACAGGTATTTCTGCTCTTGG + Intergenic
1107027254 13:35815050-35815072 CCTTTCGTTATATCTGTTCTTGG - Intronic
1109373910 13:61463262-61463284 GAGTCAGGTGTATTTGTTCTGGG - Intergenic
1111824202 13:93248251-93248273 GCTACAGGTTTTTCTGTTCTAGG - Intronic
1118485925 14:66214522-66214544 CCTTCAGTTGTCTCTGGGCTTGG - Intergenic
1121838212 14:97110642-97110664 CCTTCGGGAGGATCTTTTCTTGG + Intergenic
1122244759 14:100394644-100394666 CCTCCAGGGCTATCTGTGCTGGG + Intronic
1127023691 15:54780010-54780032 CCTTCAGGTGTTCATGTTTTAGG - Intergenic
1131511863 15:93053598-93053620 CCCTCAAATGTGTCTGTTCTTGG - Intronic
1133865264 16:9636410-9636432 ACTTCAGATGTAACTGTACTTGG - Intergenic
1136187214 16:28595534-28595556 CCCTCAGGTGTGTGTGTCCTGGG - Exonic
1137905565 16:52318638-52318660 CCTTAAATTGTGTCTGTTCTGGG - Intergenic
1140486458 16:75297501-75297523 TCCTCAGGTGGGTCTGTTCTGGG - Intronic
1143749465 17:9017950-9017972 CCCTCAGTTTTATCTCTTCTGGG - Intergenic
1147782462 17:42953436-42953458 CATTCAGGTTTATGTGTGCTGGG - Intronic
1148579760 17:48735409-48735431 CTTTCAAGTGTCTCTGTGCTGGG - Intergenic
1148800521 17:50222109-50222131 CCTGCAGGTGTCTCTGGTCAGGG + Intergenic
1150197741 17:63318546-63318568 TCTACAGATGTTTCTGTTCTGGG + Intronic
1159049366 18:63404394-63404416 TCTGCAGGGGTATCTTTTCTCGG - Intronic
1160206821 18:76841367-76841389 CGGCCAGGTGAATCTGTTCTTGG + Intronic
1160561847 18:79763901-79763923 CCTTCAGGTCCTTCTGTTGTTGG - Intergenic
1160861865 19:1240551-1240573 GCTGCAGGTGCAGCTGTTCTAGG - Intergenic
1162139657 19:8578090-8578112 TCTTCAGCTGTGTCTGCTCTGGG + Intergenic
1163331586 19:16641955-16641977 CCTTCATGTACATCTGCTCTAGG - Intronic
925059096 2:877575-877597 CCTTCAGGCTTCTCTGTTCCTGG + Intergenic
925425264 2:3744152-3744174 CCTGCAGTTGCATGTGTTCTCGG + Intronic
926433631 2:12816341-12816363 CCATCAAGTGTTTCTCTTCTTGG + Intergenic
928624843 2:33129054-33129076 CTTCCAGGTGTCTCTGTTCCAGG - Intronic
931234010 2:60398311-60398333 CCTTCTGGTGTTTCCCTTCTGGG + Intergenic
933253894 2:80059151-80059173 CCCTCGGGTGTATATGTGCTGGG - Intronic
935061794 2:99615122-99615144 CCTTCAGATGGAAGTGTTCTTGG + Intronic
935826920 2:106961586-106961608 CCTTCAGCTGTGTCAGTTCTCGG - Intergenic
938454666 2:131451726-131451748 CCTCCCTCTGTATCTGTTCTAGG - Intergenic
938833356 2:135074547-135074569 CCTTCAGTTGTCTCTGGGCTTGG + Intronic
946615060 2:221500283-221500305 CCATTAGGTGAATCTGTGCTTGG - Intronic
947611593 2:231528169-231528191 CCTGCAGGTGTATCTGGACCTGG + Exonic
947894218 2:233654335-233654357 CCTTCAGGATTATGTGTTTTGGG + Intronic
1169568896 20:6885721-6885743 CCTGCAGTTGTATCTGTTAAAGG - Intergenic
1171070173 20:22060905-22060927 TCTTCAGGGGTATCTTTTCAGGG + Intergenic
1175253544 20:57624258-57624280 CCTTCAGGTGTGTCCATTCACGG + Intergenic
1180209299 21:46284970-46284992 CCTTCAAGTTCATCTGTGCTGGG - Exonic
1181668171 22:24412555-24412577 CCTTCAGATGCATCTGTCCCAGG + Intronic
950391794 3:12702608-12702630 CCTTCAGGTTTTTGTTTTCTGGG - Intergenic
950847154 3:16026216-16026238 CCTTCAACTGTATTTGTTCTAGG - Intergenic
951000662 3:17555634-17555656 CCTTCAGGGTTATCTCTTGTGGG - Intronic
953556315 3:43949405-43949427 CCTTTAGGTTTCTGTGTTCTTGG - Intergenic
954679143 3:52332152-52332174 CCTTCAGGTCTGTCAGTACTGGG + Exonic
959217574 3:103471911-103471933 CCTTCATCTACATCTGTTCTGGG + Intergenic
961707440 3:128798700-128798722 CCTTCAGGGGTTTCTTTTCTAGG - Intronic
962966752 3:140362784-140362806 CATTATGGTATATCTGTTCTTGG - Intronic
964021500 3:152018676-152018698 ACTTCAGTTGCATCTGTTATAGG + Intergenic
966228229 3:177621054-177621076 CCCTCATGTGTCACTGTTCTGGG + Intergenic
966935402 3:184705004-184705026 CCTTTATGTGTTTCTCTTCTTGG - Intergenic
969211239 4:5689080-5689102 CTTCCAGGTGAATGTGTTCTGGG - Intronic
969827177 4:9766836-9766858 CCTCCAGGTGTCTCTGCCCTCGG + Intergenic
970389619 4:15594504-15594526 GCTTCAGGTGTGTTTATTCTGGG + Intronic
972070075 4:35007962-35007984 CCATCAGTTGCATCTGTACTAGG - Intergenic
975769786 4:77708599-77708621 TCTTCTGTTGTAGCTGTTCTGGG + Intergenic
976662089 4:87550278-87550300 CCTTCAGGTGTATCAGGTGAAGG - Intergenic
976702120 4:87981805-87981827 CCATCAGGTGTGTCTGTTAAAGG - Intronic
978019494 4:103789500-103789522 CCTTTATGTTTTTCTGTTCTTGG + Intergenic
980132471 4:128829699-128829721 CCTTCAGGTCTAACTCTTCTTGG - Intronic
982141742 4:152328065-152328087 ACTTCAGATGTTTCTATTCTAGG - Intronic
982338212 4:154264544-154264566 CATTCATTTGTATCTTTTCTTGG - Intronic
983784723 4:171716432-171716454 CCTTGAGGTGTCACTTTTCTGGG - Intergenic
984745884 4:183216992-183217014 CCTTCTGATGTTTCTGTTCAAGG - Intronic
984996713 4:185438936-185438958 CTTTCAGGTGGTTCTTTTCTTGG + Intronic
985870468 5:2550136-2550158 GCTTCAGGCCTATCTATTCTTGG + Intergenic
985908390 5:2860227-2860249 CCTTCAGGGGCATCTGGACTGGG + Intergenic
987304711 5:16626350-16626372 CTTTTAGGTGTAGCAGTTCTAGG - Intergenic
991447420 5:66715101-66715123 GCTCCAGGTGGATCTGTTTTGGG - Intronic
994064773 5:95526432-95526454 TCTTCAGGTGTATTTGCACTTGG + Intronic
994065884 5:95541304-95541326 CCTCTAGGTGTTTCTTTTCTTGG + Exonic
994314651 5:98318475-98318497 CCTTCAGTTGTTTCTGACCTGGG + Intergenic
996667873 5:126081191-126081213 TCTTTAGTTGTATCTGTTTTTGG - Intergenic
998102825 5:139448461-139448483 CCTGCATGTATGTCTGTTCTAGG + Intergenic
1001660796 5:173391278-173391300 ACTGCAGATGTAGCTGTTCTTGG + Intergenic
1009742625 6:67767040-67767062 CCTACAGGTATGTCTGTTCCTGG + Intergenic
1010665559 6:78625915-78625937 CCTTCTAGTGAATCTGTTCCAGG - Intergenic
1012038908 6:94178436-94178458 ACTTCAGGGGCATCTGTTCTAGG + Intergenic
1016742104 6:147539774-147539796 CCTTTAGGTTTTTCTCTTCTTGG - Intronic
1018988040 6:168652699-168652721 CCTTCAAGTGCATCTTTGCTGGG + Intronic
1019108407 6:169689749-169689771 CCTTCAGGTGCATCTATTGCCGG - Intronic
1021904576 7:25320571-25320593 GCTCCAGGTGAATCTGTTCAAGG + Intergenic
1024967619 7:55038137-55038159 CATTCAGGTGGATCCGTTTTTGG + Intronic
1028616208 7:92770225-92770247 CCTTTAGGTGCATCCATTCTTGG - Intronic
1035887038 8:3302512-3302534 CCTGCATGTCTATCTTTTCTGGG + Intronic
1036211543 8:6844891-6844913 CCATCAGGAGTCTCTGTTTTTGG - Intergenic
1037142927 8:15540009-15540031 CATTCAGGTCTTTCTGTGCTAGG + Intronic
1039089122 8:33809792-33809814 CATTCTGGTGAATGTGTTCTTGG + Intergenic
1039979296 8:42392736-42392758 CATTTAAGTGTATCTTTTCTCGG + Intronic
1046193151 8:110825554-110825576 CTTTCAGGAGTATATGTTGTGGG + Intergenic
1046528758 8:115416630-115416652 CATTCAAGTGTATCACTTCTAGG - Intronic
1046741955 8:117838883-117838905 CCCTCAGGGGTTTCTATTCTGGG - Intronic
1047790823 8:128201952-128201974 CTTGCAGGGGAATCTGTTCTCGG + Intergenic
1048918020 8:139202894-139202916 CCTCCAGGTGAGTCTGTTGTGGG - Intergenic
1050856853 9:10368969-10368991 GCTTCAGTCATATCTGTTCTGGG + Intronic
1051638558 9:19203406-19203428 CCTTCAGGTGTTTCTGTGTGAGG - Intergenic
1052542591 9:29829440-29829462 TCTTCAGGTGAATCTGTGATTGG + Intergenic
1053062583 9:35043686-35043708 CCTTCAGGGCTAACTTTTCTGGG - Exonic
1056294506 9:85178917-85178939 CATTCAGGTGTATCTTTGCCTGG + Intergenic
1056650962 9:88461650-88461672 CTTTCAGGTCTTTTTGTTCTTGG + Intronic
1057018381 9:91676036-91676058 GCTTCAGGTGTTTCTGAACTTGG + Intronic
1057115538 9:92517716-92517738 CCTTCAGGTATAACTGTTTGGGG + Exonic
1058992433 9:110267469-110267491 CCTTAAAGTTTATCTGTTCATGG - Intergenic
1059430798 9:114249111-114249133 TCTTCAGGTGTGTGGGTTCTGGG - Intronic
1059761584 9:117342834-117342856 CCTTCAGTGGCATCTCTTCTGGG + Intronic
1062354591 9:136155850-136155872 CCTACAGGTGTCTCTGTTCTAGG - Intergenic
1185937273 X:4272674-4272696 CCTTCAGTTGGATATTTTCTAGG - Intergenic
1188073504 X:25747054-25747076 GCTTCAGAGTTATCTGTTCTGGG + Intergenic
1188933433 X:36143816-36143838 CCTTATTGTTTATCTGTTCTGGG + Intronic
1189632744 X:42972790-42972812 CCTTTAGGTTTTTCTCTTCTCGG - Intergenic
1190323702 X:49193591-49193613 CCTTCAGGTGAAAGTGTTGTGGG - Intronic
1190914927 X:54804297-54804319 CCTTCTGGTATATCTATGCTCGG - Intergenic
1191179278 X:57541706-57541728 ACTTCAGTTGTATCTGTTTTAGG - Intergenic
1194844935 X:98793790-98793812 CCTTTTTGTGTATTTGTTCTTGG - Intergenic
1195311173 X:103633328-103633350 CCTCCAGGTGTGTCTGTGCAGGG - Intergenic
1195314614 X:103665663-103665685 CCTCCAGGTGTGTCTGTGCAGGG - Intergenic
1195601470 X:106753452-106753474 TTTTTTGGTGTATCTGTTCTAGG - Intronic
1195973759 X:110502323-110502345 CCTTCATGTGCCTCTGTGCTAGG - Intergenic
1196563141 X:117174380-117174402 CCTTTATGTTTATCTCTTCTTGG + Intergenic