ID: 1088219885

View in Genome Browser
Species Human (GRCh38)
Location 11:107558589-107558611
Sequence ATGCCGTCTGAGTGTTTTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 97}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088219885 Original CRISPR ATGCCGTCTGAGTGTTTTGT GGG Intronic
904960099 1:34325752-34325774 ATGCTGTCTTAGTTTTGTGTAGG - Intergenic
911856090 1:102877383-102877405 TTGCCCTCTGAGAATTTTGTTGG + Exonic
914707447 1:150182095-150182117 ATGCCGTACCAGTGATTTGTTGG + Intergenic
914923350 1:151862470-151862492 ATTCAGTCTGAGGGTTCTGTGGG - Intergenic
918376935 1:183918626-183918648 ATGCTGTCTGAGTGTTGGGAGGG + Intronic
921394741 1:214656465-214656487 ATGCTTTCAGAGTGTTTTTTTGG + Intronic
1062809452 10:451345-451367 ATACCCTGTGAGTGTTTTGGTGG - Intronic
1062997902 10:1884258-1884280 AAGCCGTCTGTGTCTTTTTTTGG - Intergenic
1066434531 10:35384837-35384859 CTGCCGTCTGAGAATTCTGTTGG + Intronic
1069317681 10:67127576-67127598 ATGAAGTCTGATTGTTTTGCTGG - Intronic
1069626276 10:69869480-69869502 ATGCCGTCTGGGTGTATCCTGGG + Intronic
1073750853 10:106525284-106525306 ATGCTGTCTAGATGTTTTGTTGG - Intergenic
1074490156 10:113932764-113932786 ATACCCCCTGAGCGTTTTGTTGG + Intergenic
1076275539 10:129195666-129195688 AGGCCAACTGAGTGTTTTGGTGG - Intergenic
1076714632 10:132357244-132357266 ATGGCGACTGAGTGTCCTGTGGG - Intronic
1077365462 11:2159750-2159772 GTGCCGTCTGTGTGTCTTGGGGG - Intronic
1078590761 11:12638793-12638815 CTGATGTCTGAGTGTTGTGTAGG + Intergenic
1084352610 11:68613598-68613620 ATGCCCTCTAAGTGTTATTTTGG + Exonic
1085717877 11:78889269-78889291 AGGCAGTCTGAGGGTATTGTGGG - Intronic
1087789493 11:102391658-102391680 GCCCCATCTGAGTGTTTTGTTGG - Intergenic
1088219885 11:107558589-107558611 ATGCCGTCTGAGTGTTTTGTGGG + Intronic
1099029840 12:77512507-77512529 AAGCACTCTGAGGGTTTTGTTGG - Intergenic
1099501069 12:83415061-83415083 TGACCGTCTGAGTGTTTTGCTGG - Intergenic
1100183805 12:92114938-92114960 ATGCCATCATAGTGATTTGTTGG + Intronic
1100893479 12:99153041-99153063 ATGCTTTATGAGTGATTTGTTGG - Intronic
1101965791 12:109281192-109281214 ATGACATTTGAGTGTCTTGTCGG + Intronic
1105963979 13:25368711-25368733 ATGCCAACTGACTGTTTTCTAGG + Intergenic
1111607837 13:90563759-90563781 ATGGAGTCTGAGTTCTTTGTAGG - Intergenic
1114393872 14:22339048-22339070 CTGGCTTCTGGGTGTTTTGTTGG - Intergenic
1115171143 14:30508173-30508195 CTGGTATCTGAGTGTTTTGTTGG + Intergenic
1117689906 14:58296103-58296125 ATGTCTTCATAGTGTTTTGTGGG - Intronic
1120983217 14:90309579-90309601 ATGGAGTCTGTGTGTTTTATAGG - Intronic
1125227897 15:37416025-37416047 ATGCTGCCTGAGTGATTAGTAGG - Intergenic
1127519871 15:59733133-59733155 GTGCCATCTGAATGTTTTCTGGG + Intergenic
1137972901 16:53003192-53003214 TTGCCGCCTGTGTGTTTTGATGG - Intergenic
1140233696 16:73139748-73139770 AAGCACTCTGAGTGTTTAGTAGG - Intronic
1142892877 17:2956686-2956708 GTGGCCTCTGTGTGTTTTGTTGG + Intronic
1146272312 17:31492429-31492451 GTGCCCTCTGAGTTTTTGGTGGG + Intronic
1154281356 18:13005984-13006006 ATCCCGTCTGAGTCCCTTGTGGG + Intronic
1157930529 18:51816774-51816796 AACCCATCTGATTGTTTTGTAGG - Intergenic
1159587208 18:70292254-70292276 ATGCCCTCTGAGTCTTATCTGGG + Intronic
1162437446 19:10670268-10670290 ATACCATCTGAGTGGCTTGTGGG + Intronic
931482720 2:62658117-62658139 ATGCCATCTGAAGGCTTTGTTGG - Intergenic
933003429 2:76956864-76956886 ATTCAGTCTGGGTGGTTTGTAGG - Intronic
935545011 2:104391666-104391688 GTGACTTCTGTGTGTTTTGTTGG + Intergenic
935772000 2:106433748-106433770 CAGTCTTCTGAGTGTTTTGTTGG - Intronic
935908069 2:107862197-107862219 CAGTCTTCTGAGTGTTTTGTTGG + Intronic
936963624 2:118103782-118103804 ATGCCGTTTATGTGGTTTGTCGG - Intronic
938405493 2:131030746-131030768 AGGCCATCTCTGTGTTTTGTGGG + Intronic
945964696 2:216174124-216174146 AAGCCATCTGAGTTCTTTGTGGG + Intronic
946009643 2:216554485-216554507 ATGCCCTATTAGGGTTTTGTGGG + Intronic
946186071 2:217981057-217981079 TTGCCCTCTGAGTGTAGTGTGGG - Intronic
1175659150 20:60797351-60797373 AAGCCATCTTAGAGTTTTGTTGG + Intergenic
1175982304 20:62744862-62744884 ATGGCGTTTGAGTGGTTGGTAGG - Intronic
1177120524 21:17132425-17132447 TTCCCATCTGAGTGTTTTGCTGG + Intergenic
1184294893 22:43517015-43517037 ATACCCTGTGACTGTTTTGTTGG - Intergenic
951766637 3:26206691-26206713 ATACATTCTGAGTGTTTTCTGGG + Intergenic
952331449 3:32367641-32367663 ATGCAGTCTCAGTGTCTCGTGGG + Intronic
957014253 3:75044386-75044408 GAGCCATCTGAGTGTTTTGCTGG - Intergenic
958779729 3:98525650-98525672 ATGCGTCCTGAGTGTTTTCTAGG - Intronic
959700657 3:109295946-109295968 AAGCCCTCTGATTCTTTTGTTGG - Intronic
961861696 3:129921556-129921578 ATTTCCTCTGAGTGTTATGTAGG - Intergenic
962431948 3:135328077-135328099 GTGCCTTCTGAATGTTTTCTGGG - Intergenic
963805930 3:149723080-149723102 ATGCCTTGTGAATTTTTTGTTGG + Intronic
964981063 3:162680184-162680206 ATGACCTCTGAGTTGTTTGTAGG - Intergenic
965523173 3:169689240-169689262 AATCCGTCAAAGTGTTTTGTTGG + Intergenic
968442688 4:632394-632416 GTGCCGTCTGAGGGTTATGAGGG + Intronic
972142836 4:35982645-35982667 CTGCTGTCTGAGTGCTTTCTGGG - Intronic
972910203 4:43806341-43806363 ATGCCTTCTGAGTTTATTATTGG + Intergenic
977776900 4:100931506-100931528 AAGCCTCCTGAGTGTTTTGAAGG + Intergenic
980688447 4:136260618-136260640 ATGCCACCTGAGTGTTTTGCTGG + Intergenic
983817005 4:172143458-172143480 TTGCCATCTGTGTGTTTGGTAGG + Intronic
984519357 4:180783737-180783759 ATGCCTTCTCATTTTTTTGTTGG + Intergenic
988907662 5:35806243-35806265 TTGCCTTCTGAGTGTTTAGTTGG + Intronic
992800337 5:80289820-80289842 ATGACCTCTGAATGTTTTATTGG - Intergenic
997673799 5:135697449-135697471 ATGCTGGCTGCGTGTTTTGCTGG + Intergenic
999514729 5:152289426-152289448 ATGCCATCTGACTGTGTTGGTGG + Intergenic
1005374821 6:25171676-25171698 GTGCCCTCTGAGTGTTTGGCTGG - Intergenic
1006881280 6:37342067-37342089 ATGCAGCCTGAGTGTGTGGTGGG - Intergenic
1006937119 6:37726209-37726231 ATGACGTGTGCGTGTTGTGTTGG - Intergenic
1009703874 6:67219862-67219884 AAGCAGTCTGATGGTTTTGTAGG - Intergenic
1010277057 6:73980698-73980720 TTGCTCTCAGAGTGTTTTGTGGG + Intergenic
1011447997 6:87463413-87463435 ATGCCTTTTGAGTTTTTTCTTGG + Intronic
1016101502 6:140106711-140106733 TTGCTTTCTGTGTGTTTTGTAGG + Intergenic
1017640372 6:156487830-156487852 ATGGCAACTGAGTTTTTTGTTGG + Intergenic
1017939989 6:159043714-159043736 ATGCTGTATGTGTGTTTTGTGGG - Intronic
1022983348 7:35625385-35625407 TTGCCTTCTAAGTGCTTTGTAGG - Intergenic
1024521900 7:50312637-50312659 ATGCTGTTTGAATGTTTTCTTGG - Intronic
1033112611 7:138595193-138595215 ATGCTGTCTGTATGTGTTGTTGG + Intronic
1034806398 7:154093090-154093112 ATGCTGTGTGAGTGGTATGTGGG - Intronic
1037885916 8:22596284-22596306 ATGCCTTCTGAGGGCTTTGTAGG + Intronic
1041969590 8:63723175-63723197 ATGCCGTCTGAGCTAATTGTGGG + Intergenic
1044993640 8:97818435-97818457 ATGCTGTGTGAGTGTTCTGTGGG + Intronic
1045018994 8:98025101-98025123 ATGCTGCCTGAGTCTTTTTTTGG + Intronic
1045389434 8:101700909-101700931 ACCACGTCTGAGTGTGTTGTGGG + Intronic
1048636294 8:136299576-136299598 GTGCAGTCAGAGTGTTTTGGGGG + Intergenic
1052240253 9:26263339-26263361 CTGCCGTCCGAGTGTGTGGTTGG - Intergenic
1056267896 9:84917803-84917825 CTGGCGCCTGACTGTTTTGTTGG - Intronic
1056654394 9:88497188-88497210 ATGCCTTCTGTGTGTGTTTTTGG + Intergenic
1057208337 9:93186035-93186057 GTGCAGTCAGAGTGTTTTGGGGG + Intronic
1058313292 9:103533243-103533265 CTGCCATCTGGGTGTTTTCTGGG - Intergenic
1187971471 X:24663375-24663397 ATGCCCCCTGGGGGTTTTGTGGG + Intronic
1196647555 X:118134094-118134116 AATCCGTCAGAGTGTTCTGTGGG - Intergenic
1202054356 Y:20814400-20814422 ATGCCATCTCAGTGTTTTCTGGG - Intergenic