ID: 1088223357

View in Genome Browser
Species Human (GRCh38)
Location 11:107591753-107591775
Sequence CCAAAATGGAAGGCGGGACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 139}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088223342_1088223357 24 Left 1088223342 11:107591706-107591728 CCTAGCGACCTAACGCCGAGGGC 0: 1
1: 0
2: 0
3: 2
4: 13
Right 1088223357 11:107591753-107591775 CCAAAATGGAAGGCGGGACAAGG 0: 1
1: 0
2: 0
3: 10
4: 139
1088223346_1088223357 16 Left 1088223346 11:107591714-107591736 CCTAACGCCGAGGGCTCGGGGAA 0: 1
1: 0
2: 1
3: 5
4: 48
Right 1088223357 11:107591753-107591775 CCAAAATGGAAGGCGGGACAAGG 0: 1
1: 0
2: 0
3: 10
4: 139
1088223349_1088223357 9 Left 1088223349 11:107591721-107591743 CCGAGGGCTCGGGGAAGGGATCC 0: 1
1: 0
2: 2
3: 15
4: 180
Right 1088223357 11:107591753-107591775 CCAAAATGGAAGGCGGGACAAGG 0: 1
1: 0
2: 0
3: 10
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088223357 Original CRISPR CCAAAATGGAAGGCGGGACA AGG Intronic
901191892 1:7417495-7417517 TCAAACTGCAAGGCGGCACAAGG - Intronic
901410113 1:9077107-9077129 GAAAAAAGGAAGGCTGGACATGG + Intronic
902665497 1:17934821-17934843 ATAAAATGGAAGGCGTGGCATGG + Intergenic
902941102 1:19800545-19800567 CCAGAATGGAAAGCAGGAAATGG - Intergenic
908520182 1:64934084-64934106 CCAAAATGCAGGAGGGGACAGGG + Intronic
909899175 1:81110837-81110859 CCAAAATGGAATGGGGGAGGGGG + Intergenic
912694332 1:111829678-111829700 TCAGAATGGAGGGCGGGACGAGG - Intronic
917408941 1:174737997-174738019 CCAACATTGAAGGGGGGACCTGG - Intronic
918051488 1:180976642-180976664 CCGATCTGGAAGGCAGGACATGG + Exonic
920585326 1:207153389-207153411 CCAAGATGGAAGGAGGGAACTGG - Intergenic
1068328237 10:55524280-55524302 ACAAAATGAAAGGAGAGACAAGG + Intronic
1069832117 10:71287802-71287824 ACAAAACAGAAGGTGGGACAGGG - Intronic
1070448042 10:76527285-76527307 CAAAAATGGAAGCTGGCACATGG - Intronic
1072280210 10:93859092-93859114 GCAAAATGGAAGGCTGGAAGTGG + Intergenic
1072826131 10:98608691-98608713 CCACAAAGGAAGGCTGCACATGG + Intronic
1076440899 10:130480814-130480836 CCAGAATGGGAAGCCGGACAGGG - Intergenic
1076497935 10:130910529-130910551 GCTAAATGGAAGGAGGGACGTGG - Intergenic
1076538275 10:131196936-131196958 CTAAAATGAAAGGCAGAACAAGG + Intronic
1077549688 11:3194546-3194568 CCAACATGGAAGGAGGGAAGGGG - Intergenic
1078456016 11:11476063-11476085 CCAGAAGGGAAGGCTGAACAGGG - Intronic
1079445348 11:20551977-20551999 CAAAAATGGAAGACTAGACAAGG + Intergenic
1081928910 11:46854280-46854302 CCAAAGAGGAAGGAGGGAGAAGG + Intergenic
1083183344 11:61002791-61002813 ACACAATGGAAGGCGTCACATGG + Intronic
1083207879 11:61163889-61163911 CCATGTTGGAAGGTGGGACATGG + Intergenic
1086924907 11:92629800-92629822 ACAAAATGGAATGAGAGACATGG - Intronic
1087814269 11:102641240-102641262 CCTAAAGGGAAGGTGAGACAAGG + Intergenic
1088223357 11:107591753-107591775 CCAAAATGGAAGGCGGGACAAGG + Intronic
1089151047 11:116364633-116364655 CCAAAAAGGAATGTGGGCCAGGG + Intergenic
1089604132 11:119631868-119631890 CCAAAGTGGAAGGCAGGCCCTGG + Intronic
1094777858 12:33752779-33752801 CCAAATGGGAAGTGGGGACAAGG - Intergenic
1098827266 12:75311902-75311924 AGACAATGGAAGGAGGGACATGG + Intronic
1099959600 12:89384068-89384090 CAAAAGTGGCAGGCGGCACAGGG + Intergenic
1103708467 12:122894260-122894282 CCAAAATGGAAGGTGCCACATGG + Intronic
1104382641 12:128321113-128321135 CAAAAATGGCAGCCTGGACAGGG - Intronic
1105514544 13:21077745-21077767 TCAAAAGGGAAGGCGGGGCCAGG - Intergenic
1106138712 13:26993213-26993235 CCAAAATGCAGGGAGGGACTGGG + Intergenic
1109636890 13:65131882-65131904 CCAAAATCGAAGTGTGGACAGGG - Intergenic
1111571417 13:90091907-90091929 CCAAAGTTGAAGGAGGGTCATGG - Intergenic
1111941621 13:94614423-94614445 CAAAAATGGAAGCCTGGATAAGG - Intronic
1112936289 13:104803850-104803872 CCAAAATGAAAGAGGGGACTGGG + Intergenic
1114169650 14:20259328-20259350 GAAAAATAGAAGGCTGGACATGG - Intronic
1114411341 14:22503401-22503423 CCAAAATGGCAGGCAGGGGAGGG + Intergenic
1117675260 14:58149374-58149396 TCACAATGGAAGGAGGGAGAAGG + Intronic
1118143981 14:63116129-63116151 CTAAATAGGAAGGCGGGAAAAGG + Intergenic
1118628298 14:67679127-67679149 ACAAGATGGAAGGCATGACATGG + Intronic
1119201266 14:72754636-72754658 CTAAAATGGAAGACGGCAGATGG - Intronic
1119751628 14:77082728-77082750 CCAAAGTGGAGGGTGGGATAGGG - Intergenic
1122345224 14:101054463-101054485 CAAGAATGGATGGCGGGCCATGG + Intergenic
1126830526 15:52598789-52598811 CCAAAATTGAAGGTGGGGCCTGG + Intronic
1127691183 15:61399183-61399205 CCAAAACGGGAGGCAGCACATGG - Intergenic
1131605774 15:93901059-93901081 CCAAAATTGAAGTGGGCACAGGG + Intergenic
1135652484 16:24218388-24218410 CAAAAAGGGCAGGTGGGACATGG + Exonic
1137576683 16:49604672-49604694 CCAGACTGGAAGTTGGGACAGGG - Intronic
1138339852 16:56281530-56281552 GAAAAAGGGAAGGCGGGAAAGGG - Intronic
1142871849 17:2826392-2826414 TCGAAATGGATGGAGGGACATGG + Intronic
1143763727 17:9123725-9123747 CCAAAATGGGGGGTGGGAAATGG - Intronic
1146644220 17:34566182-34566204 CAGGAATGGAAGGCAGGACAAGG + Intergenic
1148813978 17:50313423-50313445 CCCAACTGGAAGGTGGGAAATGG + Intergenic
1154164721 18:12006245-12006267 CCACAATGGCAGCCGGGGCAGGG - Intronic
1157330585 18:46701014-46701036 CCTAAATGGAAGCTGTGACAGGG + Intronic
1157842405 18:50970627-50970649 CCAAAATGGAAGGGAAGACTAGG + Intronic
1157891682 18:51424145-51424167 CCAAACTGGACGGGGGGAAAGGG - Intergenic
1159282153 18:66299828-66299850 CCAAAATGTAAGGCAGAGCAAGG - Intergenic
1160535239 18:79588214-79588236 CTAAAATGGAAGGCGAGGGAGGG - Intergenic
1166198843 19:41223310-41223332 ACAAAATGAAAGACAGGACAGGG + Intronic
926218971 2:10922696-10922718 CCCAGGAGGAAGGCGGGACATGG - Intergenic
927408342 2:22797461-22797483 CCAAAGTGGAGGGCGGAACAGGG - Intergenic
928083093 2:28327206-28327228 GCTAAATGGAGGGAGGGACAGGG - Intronic
930812542 2:55558291-55558313 CCAAAATAGAATGGGGGACAGGG + Intronic
931178057 2:59873193-59873215 CTAAAATGGGAGGAGGAACAGGG + Intergenic
931650060 2:64459989-64460011 CAAAAAAGGAAAGCAGGACAAGG - Exonic
932332790 2:70907556-70907578 GGGGAATGGAAGGCGGGACAGGG - Intronic
933735806 2:85493210-85493232 CCAAAATAGGAGGCTGGGCATGG - Intergenic
933851449 2:86369975-86369997 CCAAAATGGGGAGCGGGAGATGG + Intergenic
934575980 2:95401912-95401934 CTCAAATAGAAGTCGGGACATGG + Intergenic
937304486 2:120862771-120862793 CCAAAGTGGAAGGCTGGCCCCGG + Intronic
940910562 2:159206229-159206251 CCAACATGGAAGGGGTAACAGGG + Intronic
942291672 2:174478508-174478530 CTAAAAAAGAAGGCTGGACATGG - Intronic
947107730 2:226685345-226685367 CCAAAATGGGAGGGGGGAAATGG - Intergenic
948449973 2:238063167-238063189 CCAGAAAGGAAGGCGGGAAGGGG + Intronic
948572713 2:238927538-238927560 CCAACATGGAGGGCGGGAGCAGG + Intergenic
1170498622 20:16951456-16951478 TCAAAATGGAAGGCCAGGCACGG + Intergenic
1173111096 20:40191314-40191336 CCAGAAGAGAAGGAGGGACAGGG + Intergenic
1174179509 20:48666065-48666087 CCAAAATGGCTGGAAGGACATGG - Intronic
1177578533 21:22989550-22989572 TCAAAATGGAAGGAGGGGCAGGG + Intergenic
1178592799 21:33925525-33925547 CCAAAATGGAAGGCCGGGGGCGG - Intergenic
1184058505 22:42067878-42067900 ACAGGATGGATGGCGGGACATGG - Exonic
1184386339 22:44177442-44177464 CCAAAATAAGAGGCAGGACAAGG + Intronic
949189034 3:1229146-1229168 CCTAAATAGAAGGTGGGAAAGGG + Intronic
951765463 3:26193328-26193350 CCAAAAGGGAAGGAGGAAGATGG - Intergenic
953350141 3:42209396-42209418 ACAAAATGGAAGGGGGAAAATGG - Intronic
961216217 3:125162613-125162635 GCCAAGTGGCAGGCGGGACATGG + Intronic
964904149 3:161697377-161697399 CCAAAATTAAAGGGTGGACAGGG + Intergenic
967854856 3:194109592-194109614 CAAAAAAGGAATGCAGGACAAGG + Intergenic
974504417 4:62749647-62749669 CCATAAAAGAAGGCAGGACACGG + Intergenic
977109178 4:92930011-92930033 CCAAGATGGAGGGAGGGAGAAGG - Intronic
978333128 4:107636789-107636811 TCAAAATGGAAGGCAGAACATGG + Intronic
980259367 4:130427803-130427825 TCAAAATGAAAGGCAGCACAGGG + Intergenic
982492490 4:156046401-156046423 GCAGAATGGAAGGCTGGAGAGGG + Intergenic
983413099 4:167423258-167423280 ACAAAATAGATGGCGGGTCATGG + Intergenic
984636925 4:182120971-182120993 ACAAAATGGAAGTCAGAACATGG - Intergenic
985559527 5:575870-575892 CCACAAGGGAAGGTGGGACGTGG + Intergenic
987292762 5:16524027-16524049 CTCAGATGGAAGGCGGGGCAGGG - Intronic
987543340 5:19283317-19283339 CCAATATGGAAGGTGGGACCTGG - Intergenic
988098887 5:26653516-26653538 CCAAAGTGGAAGGTGGGGCCTGG - Intergenic
990126123 5:52519547-52519569 CAAAAATAGAAGGCTGGGCATGG + Intergenic
994879118 5:105462981-105463003 CCCAAATGGAAAGCTGGACAGGG + Intergenic
995429808 5:112061442-112061464 CCAAAGGGGAAGGCAGAACAAGG - Intergenic
1001616088 5:173044835-173044857 TCAAAATGGAGGGCCGGGCACGG - Intergenic
1003418189 6:5931951-5931973 CCACGATGGCAGGAGGGACAAGG - Intergenic
1003476177 6:6485711-6485733 CCAAAGTAGAAGGCAGGAGATGG - Intergenic
1003498910 6:6687804-6687826 CCCAAAAGGAAGGAGGGAGAGGG - Intergenic
1003653326 6:7982754-7982776 GCAAAATGGAAGGGGGGAGGAGG - Intronic
1005475885 6:26207369-26207391 AGACAATGGAAGGCAGGACAAGG + Intergenic
1005742150 6:28802183-28802205 ACAAAATGGAAGGCCGGGCGCGG + Intergenic
1006027704 6:31158070-31158092 CCAAAGGGGAAGGGGGTACAGGG - Intronic
1008133206 6:47741526-47741548 CCAAGAGAGAAGGCAGGACAGGG - Intergenic
1011706024 6:90002478-90002500 ACAAAATAGAAGGCCGGGCATGG + Intronic
1012333265 6:98020438-98020460 CCGAAATGGAGGGAGGGGCAAGG + Intergenic
1015751839 6:136568361-136568383 CCAAAATGTAAGGGGATACAGGG + Intronic
1015915337 6:138210527-138210549 CCTAAAAGGAAGGCGGTACTTGG - Intronic
1018257925 6:161941048-161941070 CCAATATGGAAGGTGGGGAAGGG + Intronic
1019613845 7:1949925-1949947 CCAAACTCAAAGGCGGGACCTGG - Intronic
1020908231 7:14093177-14093199 CCAAAATGGACTGTGGAACAGGG - Intergenic
1025859686 7:65315009-65315031 CAAAAATTGAGGACGGGACATGG - Intergenic
1027319191 7:77001635-77001657 CCAAATGGGAAGGACGGACAGGG - Intergenic
1028129159 7:87149965-87149987 GCAAAATGCAAGGCGGGAAAAGG + Intergenic
1029248838 7:99221844-99221866 CCGAAATGGAAGATGGGACCTGG - Intergenic
1030273310 7:107693124-107693146 AGAAAATGGAAGGAAGGACAAGG + Intronic
1032408398 7:131674456-131674478 CCAAAAGGGAAGACTGGAAAGGG - Intergenic
1033651555 7:143347328-143347350 CTAAAATGGGAGGCCGGGCATGG + Intronic
1037721351 8:21447054-21447076 GCAAAATGTAAGGCTGGAGACGG + Intergenic
1037751166 8:21683304-21683326 CCAAAAAGGAAGGAGGCTCACGG + Intergenic
1039068133 8:33627152-33627174 ACAAAATGGAAGGCCTGGCATGG - Intergenic
1045509496 8:102803762-102803784 CCAGAATGGTAGGTGGGCCAGGG + Intergenic
1046306829 8:112379177-112379199 ACAAAATAGTAGGCGGGACGTGG + Intronic
1055840165 9:80493988-80494010 CCAAAATAGAATGCTGGATAAGG + Intergenic
1056451672 9:86722616-86722638 CCAAAATGGAAGGTGGGTTTGGG + Intergenic
1057900003 9:98941373-98941395 GCAAAATTGAAGGCTGGGCATGG + Intergenic
1060623431 9:125088840-125088862 CCAAAATGGCAGGAGTGAGAAGG - Intronic
1185555203 X:1015798-1015820 GCAAACTGGAAGGCTGGGCACGG - Intergenic
1185847086 X:3447736-3447758 CCAAGATGGCAGAAGGGACACGG + Intergenic
1185966280 X:4607626-4607648 CCAAAGTTGAGGGAGGGACATGG + Intergenic
1187185772 X:16983793-16983815 ACAAAATGGAGGGCCGGGCATGG - Intronic
1192538272 X:71947128-71947150 CCAGAATGGAAGGGAGGAGAGGG - Intergenic
1195252589 X:103063554-103063576 CCAAAATGGAGGACGGGAGATGG + Intronic
1196853430 X:119960861-119960883 CCTAGATGGAAGGCTAGACAGGG + Intergenic
1197903774 X:131401354-131401376 CCATCATGGAAGGTGGGAGAGGG + Intergenic
1198861866 X:141079558-141079580 GCAAAATGGAAGGAGGGGGAGGG - Intergenic
1198900824 X:141507814-141507836 GCAAAATGGAAGGAGGGGGAGGG + Intergenic