ID: 1088231082

View in Genome Browser
Species Human (GRCh38)
Location 11:107673927-107673949
Sequence TGTGATACAAAATTATAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088231075_1088231082 18 Left 1088231075 11:107673886-107673908 CCCTTCACTCAGTTTCCCCCAGT 0: 4
1: 17
2: 79
3: 258
4: 832
Right 1088231082 11:107673927-107673949 TGTGATACAAAATTATAGCCAGG No data
1088231079_1088231082 2 Left 1088231079 11:107673902-107673924 CCCCAGTGGTAACAACTTGCATA No data
Right 1088231082 11:107673927-107673949 TGTGATACAAAATTATAGCCAGG No data
1088231076_1088231082 17 Left 1088231076 11:107673887-107673909 CCTTCACTCAGTTTCCCCCAGTG 0: 6
1: 19
2: 86
3: 277
4: 846
Right 1088231082 11:107673927-107673949 TGTGATACAAAATTATAGCCAGG No data
1088231078_1088231082 3 Left 1088231078 11:107673901-107673923 CCCCCAGTGGTAACAACTTGCAT No data
Right 1088231082 11:107673927-107673949 TGTGATACAAAATTATAGCCAGG No data
1088231081_1088231082 0 Left 1088231081 11:107673904-107673926 CCAGTGGTAACAACTTGCATAAC No data
Right 1088231082 11:107673927-107673949 TGTGATACAAAATTATAGCCAGG No data
1088231074_1088231082 25 Left 1088231074 11:107673879-107673901 CCATCTACCCTTCACTCAGTTTC No data
Right 1088231082 11:107673927-107673949 TGTGATACAAAATTATAGCCAGG No data
1088231080_1088231082 1 Left 1088231080 11:107673903-107673925 CCCAGTGGTAACAACTTGCATAA No data
Right 1088231082 11:107673927-107673949 TGTGATACAAAATTATAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088231082 Original CRISPR TGTGATACAAAATTATAGCC AGG Intergenic
No off target data available for this crispr