ID: 1088235438

View in Genome Browser
Species Human (GRCh38)
Location 11:107718358-107718380
Sequence TGATGCATTTTGAGTGATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 168}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088235436_1088235438 7 Left 1088235436 11:107718328-107718350 CCAAAATGCATAGCATTGATGCA 0: 1
1: 1
2: 1
3: 13
4: 159
Right 1088235438 11:107718358-107718380 TGATGCATTTTGAGTGATGGAGG 0: 1
1: 0
2: 1
3: 18
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088235438 Original CRISPR TGATGCATTTTGAGTGATGG AGG Intronic
902260654 1:15222513-15222535 TGAGGAATTTTGAGTAAAGGTGG - Intergenic
905187391 1:36206353-36206375 TGATGCACTTTGAGTGTTAGTGG + Intergenic
908706126 1:66956871-66956893 ACATGGATTTTGAGTGATGCAGG + Intronic
908915554 1:69121701-69121723 AGAAGCATTTTGAGGGCTGGTGG + Intergenic
909845143 1:80384213-80384235 TGATACATATAGGGTGATGGTGG + Intergenic
910155955 1:84219603-84219625 TAATTCATTTTGAGTGATTTGGG + Intronic
918500155 1:185185875-185185897 TTATGAATTTTGAGTGAAGATGG + Intronic
918893175 1:190302329-190302351 TGATACATTTAGAGTTATAGAGG - Intronic
919955878 1:202415103-202415125 TGCTGCATTTTGAGGTATGATGG - Intronic
923123014 1:231011518-231011540 TGATGTAGATTGAGTGATGATGG + Intergenic
923790018 1:237104049-237104071 CGATGCATTTGCAGTGAAGGCGG - Intronic
924442984 1:244102317-244102339 TGATGCGTTTGGAGAGATGATGG - Intergenic
1064824892 10:19387247-19387269 TGTTGCATTTGGGGAGATGGAGG + Intronic
1067130473 10:43559835-43559857 AGATGGATTAGGAGTGATGGAGG + Intronic
1067143170 10:43673206-43673228 TGTGGGATTTTGAGCGATGGAGG - Intergenic
1067802960 10:49372016-49372038 TTATGCATTTTGAGTGTTTTTGG - Intronic
1069453512 10:68535887-68535909 TGATGCATTTGTAGTGACGTAGG - Intergenic
1072523343 10:96249669-96249691 TGAGGGATTTTCAGTGGTGGGGG + Intronic
1074525591 10:114260531-114260553 TGATGAGTTATCAGTGATGGTGG + Intronic
1076434339 10:130429877-130429899 TGCTGTATTTTGAGTGGAGGAGG + Intergenic
1080122540 11:28693850-28693872 TCATGCACTTTGAATGATGGAGG + Intergenic
1081803807 11:45878328-45878350 TTATCCATTTTCAGGGATGGGGG - Intronic
1082189265 11:49223072-49223094 AGCTGCATTTTGAGTGGTGCAGG - Intergenic
1082792564 11:57356845-57356867 TGATGCAATTAGAGTGATCTTGG + Intronic
1085510142 11:77084013-77084035 AGATGGAGTTTGAGGGATGGGGG + Intronic
1086438319 11:86802935-86802957 TGGCTCATATTGAGTGATGGAGG + Intronic
1086677258 11:89623518-89623540 AGCTGCATTTTGAGTGGTGCAGG + Intergenic
1086875262 11:92088114-92088136 TGATGTATTTTCAGAGTTGGTGG + Intergenic
1087249720 11:95884120-95884142 TGTTGCATTTTGACTGACTGTGG - Intronic
1087818152 11:102681410-102681432 TGTTTAATTTTGAGTGTTGGTGG + Intronic
1088235438 11:107718358-107718380 TGATGCATTTTGAGTGATGGAGG + Intronic
1090673400 11:128967494-128967516 TGATGTATTTTGGGGGGTGGAGG + Exonic
1091333162 11:134746469-134746491 TACCGCATTTTCAGTGATGGTGG + Intergenic
1092566888 12:9674961-9674983 TGATACATTTTGAGTCATTTTGG + Intronic
1093137928 12:15474196-15474218 TGCTAAATTTTCAGTGATGGTGG + Intronic
1093324961 12:17762024-17762046 TCATGAATGTTGAGTGATGCTGG - Intergenic
1093911619 12:24754271-24754293 TGATGCAGTTTAAGTGATGAAGG - Intergenic
1098509665 12:71296911-71296933 TTATGCTTTTTGAGGGGTGGTGG - Intronic
1099509005 12:83510477-83510499 TGATGTATTTTGAGAGAAGTTGG + Intergenic
1101274695 12:103186372-103186394 TCATAAATTTTCAGTGATGGTGG + Intergenic
1102037960 12:109782932-109782954 GGAGGCATTTAGAGTGTTGGTGG - Intergenic
1102084173 12:110122757-110122779 TGATCCTTTTTAAGAGATGGGGG + Intergenic
1106756846 13:32830247-32830269 GGAAGAATCTTGAGTGATGGGGG - Intergenic
1107512860 13:41102523-41102545 TGAGCCAGTATGAGTGATGGAGG - Intergenic
1108357378 13:49640297-49640319 TTATACATTTTTAGAGATGGGGG + Intergenic
1108519157 13:51230252-51230274 TGCAGCATTTTGAGTGATGTAGG + Intronic
1108961972 13:56245819-56245841 TGATGTATTTAAAGTGATGAAGG - Intergenic
1108995656 13:56731208-56731230 TGATGCATTTTCAGTGACAGTGG - Intergenic
1110710890 13:78649661-78649683 TGATGGATGAAGAGTGATGGGGG + Intronic
1110827540 13:79990110-79990132 AGATGCATTTTCAGTGGGGGTGG + Intergenic
1111566269 13:90020783-90020805 TGATGCATTTTCAATAATGCAGG + Intergenic
1113873205 13:113577017-113577039 TGATACATTTAAAGTGAAGGGGG + Intergenic
1116194758 14:41709932-41709954 TGATGCTTTTTATTTGATGGTGG - Intronic
1116594818 14:46827616-46827638 TGAAGCAATGTGAGTGAAGGTGG + Intergenic
1116978953 14:51147416-51147438 TGATGGATTTTGAAAGCTGGTGG - Intergenic
1117348591 14:54858753-54858775 TAGTGAATTTTGAGTGATGGAGG - Intronic
1117767202 14:59095469-59095491 AGGTGCATTTTGAATGGTGGGGG - Intergenic
1118059891 14:62124407-62124429 TCATGCATTTTGGGTGAAGGAGG - Intergenic
1118075129 14:62289792-62289814 TGCTGCATTTTGATTGATGGGGG - Intergenic
1118849977 14:69575710-69575732 TTTTCCATTTTGAGTGATAGTGG + Intergenic
1121471518 14:94158602-94158624 TGAGGCATTTTGAGTTTTTGGGG + Intronic
1121934822 14:98008491-98008513 TGATTCATTTTGAGTCTTTGAGG - Intergenic
1128537634 15:68502825-68502847 TGCTGCATGTTGAGTGTTTGGGG - Intergenic
1129248002 15:74291711-74291733 TGCTGCATTTTGCATGATTGGGG + Intronic
1132959611 16:2614534-2614556 TGTTCCATTCTGAGTGATCGTGG + Intergenic
1132972672 16:2696509-2696531 TGTTCCATTCTGAGTGATCGTGG + Intronic
1133045369 16:3085623-3085645 TTAAGCATTTTGTGGGATGGGGG - Intergenic
1133656177 16:7866737-7866759 TGATCTATTTTCAGTCATGGTGG - Intergenic
1135525705 16:23212238-23212260 TGTTGCCTTTTGCGTGAGGGAGG + Intronic
1138781644 16:59795763-59795785 TGAAGCATTTTGTGGGCTGGTGG - Intergenic
1140488686 16:75315896-75315918 TGATGCATTTTGAGAGAGAATGG - Intronic
1140857947 16:78994153-78994175 TGATGCAGTTTGTCTGAAGGGGG - Intronic
1143263997 17:5622013-5622035 TTATGCATTTTGGGGGATGGGGG + Intergenic
1144229648 17:13188849-13188871 TATTGTATTTGGAGTGATGGTGG - Intergenic
1144599002 17:16596894-16596916 TTATGCATCCTGAGTGGTGGGGG - Intergenic
1145886827 17:28387869-28387891 TGTTGAATTTGGAGTGATTGTGG + Intronic
1148933567 17:51146816-51146838 TGATGTAATGTGAATGATGGAGG - Intergenic
1149674663 17:58448575-58448597 TGATGTATTCTGAGTGTTGAAGG + Intronic
1151459808 17:74247777-74247799 TGATGTATTATGAATGCTGGTGG + Intronic
1154067924 18:11126493-11126515 TGGAGTATTTTGAATGATGGCGG - Intronic
1154146594 18:11871600-11871622 TGATTCCTTTGAAGTGATGGAGG + Intronic
1156524029 18:37749600-37749622 TGAGGAATTTTGAGGGCTGGGGG + Intergenic
1156633124 18:38994570-38994592 TCAAGCAATTTCAGTGATGGAGG - Intergenic
1156876274 18:42016936-42016958 CTAAACATTTTGAGTGATGGGGG - Intronic
1158202405 18:54955547-54955569 AAATGCATTTTGAGTGGTGGGGG - Intronic
1165165529 19:33851586-33851608 TGATATATTTTAAGTGATGGAGG + Intergenic
1166589978 19:43988484-43988506 TGATGCAGTTTGAATGAAGGAGG - Exonic
927249153 2:20982543-20982565 AAATGCATTTTGAATGAGGGAGG + Intergenic
928156002 2:28877474-28877496 TGATCCATTCTGAATGATGGTGG - Intergenic
928869784 2:35962662-35962684 TGAAGAATTCTGAGGGATGGAGG - Intergenic
929336819 2:40758253-40758275 TGATGCCTGTTGGGGGATGGAGG + Intergenic
930738915 2:54809330-54809352 ATAAGCATTTTGTGTGATGGTGG + Intronic
931482813 2:62659347-62659369 TAATGTAATTTGAGTGAGGGTGG + Intergenic
932145002 2:69308617-69308639 TGTGGCATTTGGAGTGGTGGAGG + Intergenic
935190990 2:100778763-100778785 TGCTGCATTTTCACTGCTGGGGG + Intergenic
936903036 2:117505541-117505563 TGATGCAGTTTGATTCATAGTGG - Intergenic
940584632 2:155630420-155630442 TGACACCTTTTGAGTCATGGTGG - Intergenic
948226440 2:236313854-236313876 TGATGCAATTTTAGAAATGGAGG + Intergenic
948305930 2:236946783-236946805 GGATGCATTCAGAGTGGTGGTGG + Intergenic
1168917735 20:1505096-1505118 TCATTCAATATGAGTGATGGTGG - Intergenic
1169806757 20:9567692-9567714 TCATTCATTTTGACTGTTGGTGG - Intronic
1170231508 20:14051908-14051930 AGATGCATCCTGAATGATGGTGG - Intronic
1170498986 20:16955356-16955378 TGACTCAGTTTGAGTGCTGGAGG - Intergenic
1171323688 20:24270825-24270847 TGATGGCTGTTGAGTGATGAGGG + Intergenic
1175076927 20:56383275-56383297 GGATGCATATTGAGTGAAGTTGG - Intronic
1177521553 21:22234287-22234309 TGAGACATCTTGAGTTATGGAGG + Intergenic
1177943582 21:27440663-27440685 TGTGAGATTTTGAGTGATGGAGG - Intergenic
1183482674 22:38073815-38073837 AGCTGCATTGTGAGTGTTGGAGG + Exonic
1184998990 22:48230768-48230790 TGATGAATTTTCAGTGGAGGTGG + Intergenic
951222528 3:20083884-20083906 TGAGTCATTTTCCGTGATGGTGG + Intronic
952178390 3:30891765-30891787 TGATGAATTTTGCCTGTTGGGGG + Intronic
952530297 3:34256140-34256162 TGATGCTTTTTCAGTGTGGGAGG - Intergenic
953291141 3:41664437-41664459 TGCTGCATTTTGATTGCTGGGGG - Intronic
953318415 3:41950041-41950063 TGATGAGTTTTGATTGATGCAGG + Intronic
953542216 3:43831309-43831331 TGATGAAAATTGAGTGGTGGAGG - Intergenic
953646234 3:44758208-44758230 TGATGGATGTTGACTGATGAGGG + Intronic
954443320 3:50533571-50533593 TGAGTCAGTTTGAGTAATGGCGG + Intergenic
956541621 3:70346436-70346458 TGATACATTTTGATTAATTGTGG + Intergenic
957483532 3:80829212-80829234 TGATGAATATTGATTGATTGTGG - Intergenic
960396638 3:117145674-117145696 TGATGTATTTTTAGAGATAGCGG - Intergenic
960920505 3:122742535-122742557 TGATTAATTTTGAGTCAAGGTGG + Intronic
961903155 3:130234404-130234426 TTATGCATTTTGAATGTTGGAGG + Intergenic
963919077 3:150888530-150888552 TGATGCATTTTGATAGTTGATGG + Intronic
965369388 3:167841768-167841790 TAATGCAAGTTGTGTGATGGAGG + Intergenic
968454723 4:691419-691441 TGTTGCATTTTTAGTGAAGACGG - Intergenic
971073500 4:23122160-23122182 TTATTCATTATGTGTGATGGAGG - Intergenic
971608400 4:28688151-28688173 TGATAAATTTGGGGTGATGGTGG - Intergenic
971894945 4:32580207-32580229 TAATGCATTTACAGTGAAGGAGG - Intergenic
973057242 4:45676187-45676209 TTATGCATGTTGAGAGATAGGGG + Intergenic
973291223 4:48472691-48472713 TGATAAATTATGAGGGATGGAGG - Intergenic
975651020 4:76593221-76593243 TGAAGCATTTCCAGTGATGAAGG - Intronic
976493294 4:85696959-85696981 GGATGCATATGGAGTGATAGTGG + Intronic
978278554 4:106981480-106981502 TAATGCATTTTGAATGCTGGTGG - Intronic
980640510 4:135571518-135571540 TGATGTATTTGGAGTGCTGAAGG + Intergenic
980688473 4:136260797-136260819 TTATGTGTTTTGAGTGTTGGTGG - Intergenic
981664385 4:147206608-147206630 CTATACATTTTGAGTGGTGGAGG + Intergenic
981857971 4:149317744-149317766 ATGTGCATTTTGAGGGATGGAGG - Intergenic
982609461 4:157555301-157555323 AGAAGCAGTTTGAGTCATGGTGG - Intergenic
993160584 5:84285727-84285749 TGCTGCACTTTCAGTGATAGTGG + Intronic
993433586 5:87862761-87862783 TGTTGAATTGTGAGTGTTGGAGG + Intergenic
997352657 5:133242059-133242081 TGATGCATTTTCAGTTTTGATGG - Intronic
997400802 5:133600387-133600409 AGATGCATTTTGACTTATGACGG - Intronic
998019535 5:138757775-138757797 AGATGCTTGTTGAGTGAAGGAGG + Intronic
998237238 5:140408705-140408727 TTATGTGTTTTGAGAGATGGGGG + Intronic
998400155 5:141844520-141844542 TGTAGCATTTTGAGGGTTGGGGG + Intergenic
998553548 5:143101243-143101265 GGATGCATTTTTAGAGATGAGGG + Intronic
1002533594 5:179863923-179863945 TGATGCAGTTCGGGTGCTGGTGG + Exonic
1009557779 6:65196714-65196736 TGAAGGACTTTTAGTGATGGTGG + Intronic
1009985165 6:70773055-70773077 TGATGCATTGATAGTGGTGGTGG + Intronic
1010350148 6:74863907-74863929 TGCTGCATTTTCCCTGATGGAGG - Intergenic
1010560531 6:77343426-77343448 TGTTGCATCTTGTGTTATGGTGG + Intergenic
1011048972 6:83122331-83122353 TGATGCAATTTCAGTAATAGTGG + Intronic
1012465641 6:99514283-99514305 TGCTGCATTTTCACTGATGGAGG - Intronic
1013388665 6:109660200-109660222 TGATGCATTATTAATGATGATGG + Intronic
1013419584 6:109954635-109954657 TGATGGATTTTGTGTAATGTTGG - Intergenic
1016519340 6:144929228-144929250 GGAAGGATTTTGAGTGTTGGAGG + Intergenic
1017291399 6:152742740-152742762 TCATACATTATGTGTGATGGGGG - Intergenic
1018062126 6:160098425-160098447 TGGTGGATTTTGAGGGATGCAGG + Intronic
1018558348 6:165073694-165073716 TGGGGCATTTGGAGTAATGGAGG - Intergenic
1020670592 7:11104218-11104240 TCTTGCATTTTCAGTGGTGGTGG + Intronic
1022639005 7:32163770-32163792 GGATGCTTTGTGAGTGATGCTGG - Intronic
1022829372 7:34049595-34049617 AGGTGCATTTTGATTGGTGGAGG + Intronic
1023465998 7:40455885-40455907 TAATGCACTTAAAGTGATGGCGG + Intronic
1024008797 7:45250240-45250262 TGATACATTTTGAGTTATTTTGG - Intergenic
1024210753 7:47201392-47201414 TGGTGCATTCACAGTGATGGTGG - Intergenic
1027038745 7:74945643-74945665 AGATTTGTTTTGAGTGATGGTGG + Intergenic
1028430880 7:90745208-90745230 AGATGTAGTTGGAGTGATGGGGG - Intronic
1029571189 7:101370767-101370789 GGAGGCATTTTGAGTGAGGAGGG - Intronic
1030506455 7:110430290-110430312 TGTTGTATTTTGAGGAATGGAGG - Intergenic
1034878597 7:154746614-154746636 TAATGCTTTTTGGGTGATTGTGG - Intronic
1036600998 8:10260003-10260025 TGATGCATTCTCAGTGACGCAGG - Intronic
1040933113 8:52755930-52755952 TGATGCATGTTGAGGTATGTAGG - Intergenic
1044329322 8:90898161-90898183 GGCTGCATTTTGAGTGATAGTGG + Intronic
1047812101 8:128422096-128422118 TGATGCATTTAAACTGATGGTGG + Intergenic
1050980882 9:12013842-12013864 TCATATATTTTGAGAGATGGGGG + Intergenic
1055496095 9:76857218-76857240 TGGTACATTTTGATGGATGGGGG - Intronic
1056330757 9:85519339-85519361 AGATGCAATTTGGGTGTTGGGGG - Intergenic
1057445696 9:95112921-95112943 TCACACATTCTGAGTGATGGTGG + Intronic
1057777029 9:98019557-98019579 TGCTGCACTTTCAGTGAAGGAGG + Intergenic
1186459662 X:9738174-9738196 TGATGGATTTTGTTTGGTGGTGG + Intronic
1187787269 X:22905813-22905835 TGAGGGATTTTGAGTGATATTGG + Intergenic
1188372243 X:29383046-29383068 TGATGGATTTTGAATAATGAAGG + Intronic
1195728639 X:107942749-107942771 TAAAGCATTTAGAGTGATGTTGG - Intergenic
1196814625 X:119654908-119654930 TGACGAATTTGGAGTGAGGGTGG + Intronic
1198424287 X:136499330-136499352 TAAAGCATTTTAAGTGATGCTGG - Intronic
1199110864 X:143932299-143932321 GGATGCATTTTCACTGCTGGTGG - Intergenic
1199922561 X:152424531-152424553 TGAAGCATTTCAAGTGGTGGGGG - Intronic
1202578726 Y:26356075-26356097 TGCTGCATTTTGAGGTATGATGG + Intergenic