ID: 1088237522

View in Genome Browser
Species Human (GRCh38)
Location 11:107741673-107741695
Sequence CTGCTCTTGTAGGAGTGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088237517_1088237522 5 Left 1088237517 11:107741645-107741667 CCTGGGCAGTGGAGGCCGTGCTG No data
Right 1088237522 11:107741673-107741695 CTGCTCTTGTAGGAGTGGCCAGG No data
1088237518_1088237522 -10 Left 1088237518 11:107741660-107741682 CCGTGCTGTGTACCTGCTCTTGT No data
Right 1088237522 11:107741673-107741695 CTGCTCTTGTAGGAGTGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088237522 Original CRISPR CTGCTCTTGTAGGAGTGGCC AGG Intergenic
No off target data available for this crispr