ID: 1088238611

View in Genome Browser
Species Human (GRCh38)
Location 11:107750795-107750817
Sequence AACTACGGAGTACTATTGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088238611_1088238616 19 Left 1088238611 11:107750795-107750817 CCTATCAATAGTACTCCGTAGTT No data
Right 1088238616 11:107750837-107750859 TTATACAGTCTACCGTTGATGGG No data
1088238611_1088238615 18 Left 1088238611 11:107750795-107750817 CCTATCAATAGTACTCCGTAGTT No data
Right 1088238615 11:107750836-107750858 TTTATACAGTCTACCGTTGATGG No data
1088238611_1088238617 27 Left 1088238611 11:107750795-107750817 CCTATCAATAGTACTCCGTAGTT No data
Right 1088238617 11:107750845-107750867 TCTACCGTTGATGGGCATTTAGG 0: 25
1: 691
2: 5826
3: 12157
4: 21512

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088238611 Original CRISPR AACTACGGAGTACTATTGAT AGG (reversed) Intergenic
No off target data available for this crispr