ID: 1088246182

View in Genome Browser
Species Human (GRCh38)
Location 11:107820349-107820371
Sequence CTGAGACTTCCAGGGAAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 377
Summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 343}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088246182_1088246189 22 Left 1088246182 11:107820349-107820371 CCTCTCTTCCCTGGAAGTCTCAG 0: 1
1: 0
2: 2
3: 31
4: 343
Right 1088246189 11:107820394-107820416 CCCACTTTAATCAAGGAGACTGG 0: 1
1: 0
2: 0
3: 7
4: 121
1088246182_1088246191 23 Left 1088246182 11:107820349-107820371 CCTCTCTTCCCTGGAAGTCTCAG 0: 1
1: 0
2: 2
3: 31
4: 343
Right 1088246191 11:107820395-107820417 CCACTTTAATCAAGGAGACTGGG 0: 1
1: 0
2: 1
3: 14
4: 116
1088246182_1088246187 15 Left 1088246182 11:107820349-107820371 CCTCTCTTCCCTGGAAGTCTCAG 0: 1
1: 0
2: 2
3: 31
4: 343
Right 1088246187 11:107820387-107820409 GCACTAACCCACTTTAATCAAGG 0: 1
1: 0
2: 0
3: 8
4: 59
1088246182_1088246192 24 Left 1088246182 11:107820349-107820371 CCTCTCTTCCCTGGAAGTCTCAG 0: 1
1: 0
2: 2
3: 31
4: 343
Right 1088246192 11:107820396-107820418 CACTTTAATCAAGGAGACTGGGG 0: 1
1: 0
2: 4
3: 171
4: 3602
1088246182_1088246185 -7 Left 1088246182 11:107820349-107820371 CCTCTCTTCCCTGGAAGTCTCAG 0: 1
1: 0
2: 2
3: 31
4: 343
Right 1088246185 11:107820365-107820387 GTCTCAGAATTGCAGAACCTTGG 0: 1
1: 0
2: 0
3: 12
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088246182 Original CRISPR CTGAGACTTCCAGGGAAGAG AGG (reversed) Intronic
900576161 1:3383477-3383499 CTGAGGCTTCCAGGGAAAGTTGG - Intronic
900702879 1:4058932-4058954 CAGAGCCATCCGGGGAAGAGAGG - Intergenic
900772699 1:4558433-4558455 CTGAGAATGCGAGGGAAGTGGGG + Intergenic
900835537 1:5000573-5000595 CTGTGACTCTCAAGGAAGAGAGG - Intergenic
901680836 1:10911863-10911885 CTGAGACTTCCAGGCAGGGCAGG - Intergenic
902374589 1:16024304-16024326 CTGAGGCCTCCCTGGAAGAGGGG + Intronic
902379532 1:16046076-16046098 CTGAGGCCTCCCTGGAAGAGGGG + Intronic
902383770 1:16065031-16065053 GTGAGACCTCCTGGGGAGAGAGG - Intronic
903480276 1:23648030-23648052 CTGAGACTGCCAGGGTGGTGGGG - Intergenic
903812728 1:26043844-26043866 CTGAGGCTTCTGGGGAAGACAGG + Intronic
905219069 1:36431420-36431442 GTGAGAGTTCCATGGAGGAGGGG + Intronic
905295067 1:36949003-36949025 CTCAGACTGCCTGGGAAGAAGGG + Intronic
905313069 1:37064075-37064097 CAGAGAGTGACAGGGAAGAGAGG + Intergenic
905326830 1:37159015-37159037 CTCAGAATTTCAGGGAAGACTGG + Intergenic
905468147 1:38171395-38171417 CAGAAACTTCAAGGGGAGAGGGG - Intergenic
906388114 1:45389539-45389561 CTGAGAAGTCCAGGGTTGAGAGG - Intronic
908611594 1:65866811-65866833 GAGAGACTTCCAGGGAATATTGG + Intronic
909092348 1:71242090-71242112 CAGAGGCTTCCAGGTAATAGTGG + Intergenic
909578460 1:77204020-77204042 CTGCGATTTTCAGGGAAGAAGGG + Intronic
910861575 1:91747431-91747453 CTGAGATTGCTGGGGAAGAGGGG - Intronic
911406383 1:97445613-97445635 CAGAAACTTCAAGGGAAGAAAGG - Intronic
912333484 1:108841400-108841422 CTGAGACTCTCAGGGAGAAGTGG + Intronic
913153179 1:116066028-116066050 CTGAGAGTTCCAGGGATTAAAGG - Intronic
914257812 1:145974980-145975002 GAGAGACTCACAGGGAAGAGTGG - Exonic
915828842 1:159106122-159106144 CTGAGACTGCAGGGGGAGAGGGG + Intronic
918758646 1:188372406-188372428 CTGAGACTTCCAGTCAGCAGTGG + Intergenic
919776760 1:201199311-201199333 CTGCAACATCCAGGGAGGAGAGG - Intronic
919850433 1:201668585-201668607 CTGAGACTCCAAGGGTAGAGAGG + Intronic
920340895 1:205274535-205274557 CTGAGACTGACAGCGAACAGAGG + Intergenic
920433782 1:205935508-205935530 CTGAGACCCCCAGGGAGGATGGG - Intronic
920850665 1:209625997-209626019 CTGTGATTTCCGGGGAACAGAGG - Exonic
922983014 1:229844484-229844506 CTGAGAATTGCAGGCAAGAGGGG - Intergenic
922992377 1:229925354-229925376 CTGGGCTTTCCAGGGAAGAAAGG + Intergenic
1065434648 10:25694366-25694388 CTGAGACTTCCAGGTGAGGTCGG - Intergenic
1067142413 10:43668377-43668399 CTCAGCCTTTCAGGGAAGATGGG + Intergenic
1069577200 10:69539236-69539258 CGGAGACTTGCAGGAAAGGGTGG + Intergenic
1069708605 10:70474967-70474989 CTGAACCTGCCAGGGCAGAGGGG - Intergenic
1070262128 10:74867467-74867489 CTGAGATTTCCAGGCCAGATGGG - Intronic
1070471643 10:76786264-76786286 CAAAGACATCAAGGGAAGAGTGG + Intergenic
1070756894 10:78998806-78998828 CTGAGGCTCCAAGGGAACAGTGG + Intergenic
1070913423 10:80137386-80137408 CTGAGCCTTACACGGGAGAGTGG + Intronic
1071253315 10:83842659-83842681 CTGGGACTTCGAGGGACTAGGGG + Intergenic
1072694257 10:97591144-97591166 CTGATGTTGCCAGGGAAGAGGGG + Intronic
1072804432 10:98415616-98415638 CTGAGTCTGCCAGTGCAGAGTGG + Intergenic
1074024970 10:109625034-109625056 TTGAGTCTTGGAGGGAAGAGAGG + Intergenic
1077460287 11:2705657-2705679 CTCAGCCTGCCAGGGAAAAGTGG + Intronic
1078858387 11:15225144-15225166 CTGAGACCTTAAGGGAAGAAAGG - Intronic
1078866907 11:15306674-15306696 ATGTCACTGCCAGGGAAGAGAGG - Intergenic
1078921272 11:15832906-15832928 TGGAGACTTGCGGGGAAGAGTGG + Intergenic
1079356399 11:19733583-19733605 CTGAGACTTCCAGGGGAAATGGG + Intronic
1080563039 11:33481905-33481927 CTGAGAATTACAGGGAACATGGG - Intergenic
1081190914 11:40102074-40102096 CTGAAATGTCCAGAGAAGAGAGG + Intergenic
1081758363 11:45560364-45560386 GAGAGACTTCCAGGGAGGCGAGG - Intergenic
1082061889 11:47867983-47868005 CTGACACTACCAGGGAATAAAGG - Intergenic
1083304239 11:61754439-61754461 TTGAGACCTTCAGGGAAGAGGGG + Intronic
1084396952 11:68917540-68917562 CTGTGACTTCAAGGCAAGTGAGG + Intronic
1084878573 11:72152921-72152943 ATAAGACTTCCACGGAAGATGGG - Intergenic
1084970441 11:72768491-72768513 CTGAGGGTTCAGGGGAAGAGGGG + Intronic
1085152644 11:74264451-74264473 ATGAAACTTCCAGGGGTGAGGGG + Intronic
1085251435 11:75146649-75146671 CAGACACTTCAAGGGAGGAGGGG - Intronic
1085310704 11:75515063-75515085 CAGAGACTTCCTGAGAAGGGAGG - Intronic
1085435077 11:76493064-76493086 CGGAGACTGCAAGGGAAGGGGGG - Intronic
1085645386 11:78219154-78219176 CTGAGACTGGCAGAGTAGAGAGG + Exonic
1086578441 11:88368023-88368045 CTGAGACTTTCAGAAAACAGAGG - Intergenic
1088246182 11:107820349-107820371 CTGAGACTTCCAGGGAAGAGAGG - Intronic
1088739256 11:112753389-112753411 CTGAGAGTAACAGAGAAGAGGGG - Intergenic
1088899502 11:114104518-114104540 CTGGGGCCTCTAGGGAAGAGTGG + Intronic
1089453506 11:118612542-118612564 CCAAGACTGCCAGGGAAGAGGGG - Intronic
1089625855 11:119750373-119750395 CTGAGATTTGCAGGTCAGAGAGG - Intergenic
1089642399 11:119856452-119856474 TTGAGAACTCCAGGGAACAGGGG + Intergenic
1091358487 11:134956450-134956472 CTGAGACCTAGAGGGGAGAGAGG - Intergenic
1091508631 12:1099034-1099056 CTGAGAGTTCCAGGGAGATGAGG + Intronic
1091908222 12:4206614-4206636 CTGAGTCTTGCAGGGTTGAGGGG - Intergenic
1092196462 12:6552428-6552450 ATGAGAATGCCAGGGAGGAGGGG - Intronic
1092997918 12:13967809-13967831 CTGAAACTTGCAGGCATGAGGGG + Intronic
1093088181 12:14890045-14890067 CTGAAACTTCCAGGGAAAGTTGG + Intronic
1099033639 12:77559700-77559722 CTGAGACTGTGGGGGAAGAGGGG - Intergenic
1099295249 12:80821819-80821841 CTGAGCCTGCAAGGGGAGAGGGG - Intronic
1100351684 12:93789629-93789651 CAGAGACTTTGAGGGATGAGGGG + Intronic
1100801598 12:98237230-98237252 CTGCCACTTCCATGGAAGCGTGG - Intergenic
1100912525 12:99381642-99381664 CTGAGACTTCAGTGCAAGAGTGG + Intronic
1103862696 12:124027102-124027124 CTGAGGTTCCCCGGGAAGAGGGG - Intronic
1103939682 12:124495018-124495040 CTGAGCCTCCCAGGGCAGAGGGG - Intronic
1104088582 12:125495349-125495371 CGGCCATTTCCAGGGAAGAGGGG - Intronic
1104989263 12:132615870-132615892 CTGGAACTCCCAGGGGAGAGTGG - Intergenic
1106657812 13:31765885-31765907 ATGTGGCTTCTAGGGAAGAGTGG + Intronic
1107937482 13:45357264-45357286 CTGAGCCTTCCAGGAAGAAGTGG - Intergenic
1108664433 13:52615934-52615956 CTGGTACTTTCAGGGAAGTGTGG + Intergenic
1110484642 13:76023951-76023973 TTGGCACTTCCATGGAAGAGTGG + Intergenic
1111785833 13:92785529-92785551 TTGAGACTACCACGGTAGAGTGG + Intronic
1112472539 13:99701979-99702001 CTGCTACTTACAGGGGAGAGGGG - Intronic
1114525247 14:23364087-23364109 CTAAGATTCCCAGGGAAGCGAGG - Intronic
1114604597 14:23986662-23986684 CTGAGGGTTCCAGGAAAGTGAGG - Intronic
1116176076 14:41471933-41471955 CTAAGACTTCAAGGAAAGAGAGG + Intergenic
1117574269 14:57082543-57082565 GTGAGACTTACAGGGAAGGCAGG - Intergenic
1118367371 14:65107599-65107621 CTGAGGCCTACAGGGGAGAGGGG + Intergenic
1118507045 14:66424893-66424915 CTGAAAGTTCTAGGGAAGAATGG + Intergenic
1118920022 14:70141674-70141696 CTCAGACTTAGTGGGAAGAGTGG + Intronic
1120959544 14:90111939-90111961 CTTAGACTCCCCGGGAGGAGTGG - Intronic
1121144626 14:91573669-91573691 GGGAGACTGGCAGGGAAGAGGGG + Intergenic
1121658393 14:95615735-95615757 CAGAGACATACAGGGCAGAGGGG - Intergenic
1121753106 14:96375760-96375782 CTGAGAAGTCCAAGGTAGAGGGG + Intronic
1123052250 14:105550360-105550382 CTGAGAATTCAAGGGAGGAGAGG + Intergenic
1124441280 15:29687995-29688017 CTGGGACTTCCTGGGAGGAAGGG + Intergenic
1124468530 15:29962252-29962274 CTGAGGCTTCCTGGGAACATTGG - Intronic
1124609368 15:31197734-31197756 TTGAGAATTCAAGGCAAGAGGGG + Intergenic
1125086017 15:35730246-35730268 ATAATACTTCCAGGGAAAAGTGG - Intergenic
1126565402 15:50092089-50092111 CAGAGCCTAGCAGGGAAGAGAGG + Intronic
1128730810 15:70019612-70019634 CTGAGGCTTCCTGGACAGAGAGG + Intergenic
1128783148 15:70376182-70376204 TTGAGACTCCCAGGGCAGGGAGG - Intergenic
1128932614 15:71718794-71718816 CAGAGATTTGCAGGGAGGAGTGG - Intronic
1129962195 15:79697427-79697449 CTGAGATTTCCAGGGAGGAGAGG - Intergenic
1130042661 15:80418208-80418230 CTCAGAGTGCCAGGGAAGATGGG - Intronic
1130094189 15:80844077-80844099 CTCTGCCTTCCAGGGAAGTGGGG - Intronic
1130581881 15:85144880-85144902 CTCATACTTCCAGCAAAGAGAGG + Intergenic
1130645657 15:85724478-85724500 GTGGCACATCCAGGGAAGAGTGG + Intronic
1134106601 16:11489749-11489771 CTGAAACTGCCAAGGCAGAGAGG + Intronic
1135329907 16:21552234-21552256 CTGAGATTTTGAGTGAAGAGGGG - Intergenic
1136340248 16:29638208-29638230 CTGAGATTTTGAGTGAAGAGGGG - Intergenic
1138158998 16:54735760-54735782 CTGCGACCTACAGGGAAGGGGGG - Intergenic
1140237244 16:73170762-73170784 CTGACACTTCCTGGGGAGACAGG - Intergenic
1140760426 16:78104013-78104035 CTGAGACTGTGAGGGGAGAGGGG - Intronic
1140989183 16:80191775-80191797 CTGAGAGAGGCAGGGAAGAGGGG - Intergenic
1141228851 16:82145622-82145644 CTGCGACTCCTAGGGAAGAGAGG + Intergenic
1141361915 16:83403307-83403329 CTGAGACTTGGAGGAAATAGAGG + Intronic
1141371480 16:83490463-83490485 GTGAGACATCCTGGGAAGGGAGG - Intronic
1141467233 16:84214368-84214390 CTGAGATTTGCAGGGAGGTGGGG + Intergenic
1141535445 16:84676614-84676636 CTGAGCCTTACAGGGTAGAAGGG - Intergenic
1141865946 16:86749848-86749870 CTGAGACTTGGAGAGAAGAGGGG + Intergenic
1142042931 16:87906749-87906771 CTGAGATTTTGAGTGAAGAGGGG - Intronic
1144328498 17:14204369-14204391 CTGAGACAAGCAGGGAAGAAGGG - Intronic
1144726342 17:17504442-17504464 CTGAGCCTTCCAGGCAAGCCTGG - Intergenic
1145775154 17:27522567-27522589 CTGAGAGCTCCAGGGAAAAGTGG + Intronic
1145923158 17:28626571-28626593 CCCACACTTCCTGGGAAGAGAGG + Intronic
1146985999 17:37218695-37218717 CTGAGCCTTACAGGACAGAGTGG + Intronic
1147441931 17:40452794-40452816 CTGAGAGATCCAGGGGAGAGGGG + Intronic
1148974090 17:51511610-51511632 TGGAGACTTGCGGGGAAGAGTGG - Intergenic
1149064552 17:52464847-52464869 CTGAGACTGGGAAGGAAGAGAGG - Intergenic
1149104688 17:52948412-52948434 CTGCTAATTCCAGGGAAGACAGG - Intergenic
1149431612 17:56598528-56598550 CTGAGACTCCCTGGGAAAGGGGG + Intergenic
1149553145 17:57554945-57554967 CTGAGACTTCCAAGGGAGCCTGG + Intronic
1150440719 17:65189325-65189347 CTTACACTTCCAGTGAAGAATGG + Intronic
1150641452 17:66952613-66952635 CAGAGAGGTCCAGGGCAGAGGGG + Intergenic
1151492181 17:74439345-74439367 CTGAAAGTCCCAGGGCAGAGAGG + Intronic
1152606837 17:81295569-81295591 CTGTGCCTTCCGGGGAGGAGCGG + Intergenic
1152890422 17:82878451-82878473 CTGAGACCTCCAGAGACGACTGG + Intronic
1153084693 18:1271192-1271214 CAGAGAGTGACAGGGAAGAGGGG - Intergenic
1153087622 18:1306443-1306465 CTCAGAGTACCAGGGAAGAATGG + Intergenic
1153530661 18:6042427-6042449 CTGAGAAGTTCAGGGGAGAGAGG - Intronic
1153824231 18:8860587-8860609 CTGAGTTTTCCAGAGAAGACAGG + Intergenic
1154496463 18:14964768-14964790 CTGAGACCTAGAGGGAAGAGAGG + Intergenic
1155119529 18:22804141-22804163 CATAGAGTTCCAGAGAAGAGTGG + Intronic
1155989428 18:32264446-32264468 CTGAGAAGTCCAGGGATGGGAGG - Intronic
1156971721 18:43164749-43164771 CTAAAACTTCCAGAAAAGAGAGG + Intergenic
1157688996 18:49665464-49665486 CTGAGAAGTCCAAGGAGGAGGGG - Intergenic
1158235036 18:55302821-55302843 CTGTGACCTCCTGGGAATAGAGG + Intronic
1158641077 18:59204270-59204292 CTGAGACATCCATAAAAGAGAGG + Intergenic
1158903440 18:61987587-61987609 CTGAGAAGTCCAGGGTTGAGGGG - Intergenic
1159117102 18:64127393-64127415 CTGAGGCTTTCAGGGACGTGAGG + Intergenic
1159158301 18:64610979-64611001 CTGAGACTGCAAGGGAAGTGGGG + Intergenic
1160779734 19:872467-872489 CTGAGAGGACCAGGGAAGGGAGG + Intronic
1161220469 19:3115897-3115919 CCGAGGCTGTCAGGGAAGAGGGG + Intronic
1161453671 19:4359999-4360021 CTGAGCCTTCCAGGGCAGGGTGG + Exonic
1161676734 19:5655014-5655036 CTGACACTTTCAGGGTAGACAGG - Intronic
1161769592 19:6223996-6224018 GTGAGAGTACCAGGGAGGAGGGG + Intronic
1162045952 19:8000599-8000621 CTGAGTCTTCCAGGTAAAAAAGG + Intronic
1162932386 19:13963472-13963494 CTGAGACCCCCAGGGACGCGGGG + Intronic
1163126818 19:15248714-15248736 CTGAGCCTTCCAGGGTCTAGAGG + Intronic
1164442518 19:28290114-28290136 CACAGACTTCCAGGGAACTGGGG + Intergenic
1165094278 19:33402079-33402101 CTGTGTCTTCCAGGGAAAAAGGG + Intronic
1165398905 19:35585133-35585155 CTGAGTCTTCCTGGCAAAAGAGG - Intergenic
1165830613 19:38728589-38728611 TGGAGACTTCTAGGGAAGAAGGG - Intronic
1165937616 19:39398652-39398674 CTGAAGCTTCCAGGGAAGCAGGG - Exonic
1166064238 19:40347741-40347763 CTGGGAATTCCAGGGAAGCTGGG - Intronic
1166234031 19:41442900-41442922 CTGAGACAGGCAGGGAAGGGTGG + Intergenic
1166293695 19:41878824-41878846 CTGATACATCCTGGGGAGAGGGG - Intronic
1166512422 19:43418080-43418102 CTGAGCTCTCCAGGGATGAGGGG + Intronic
1167949591 19:53015598-53015620 CTGGGACCTCCAAGGAAGATTGG - Exonic
1168253094 19:55152005-55152027 CTTAGGCATCCAGGGTAGAGTGG - Intronic
925083869 2:1092343-1092365 GTAAGACCTCCAGGGAAGGGAGG + Intronic
925766291 2:7238815-7238837 ATGAAGCTTCCAGGGAAGGGGGG + Intergenic
926223665 2:10952516-10952538 CTGAGGCTCCCTGGGAAGACAGG - Intergenic
927855228 2:26523582-26523604 CTGAGTCCTTCAGAGAAGAGGGG + Intronic
928616183 2:33041753-33041775 CTGAGACTTCCAGTAAACTGTGG - Intronic
929533600 2:42767220-42767242 CTGAGTCTGCCAGAGAAGATGGG + Exonic
930712330 2:54560350-54560372 CTGAGACTTCCAGGCTAGGCTGG - Intronic
931646489 2:64426410-64426432 CTAAGGCCTCCAGGGAAAAGGGG - Intergenic
932043813 2:68326986-68327008 CTCAGATTTCCAGAGAACAGTGG + Intergenic
937092800 2:119217746-119217768 TTGGGGCCTCCAGGGAAGAGGGG - Intergenic
937279432 2:120707284-120707306 GTGAGGCTTCCAGGGGTGAGTGG + Intergenic
938724417 2:134094512-134094534 CTGAGAATTTCAGAGAAGGGAGG - Intergenic
940618215 2:156078395-156078417 TGGGGACTTGCAGGGAAGAGTGG - Intergenic
940642864 2:156365443-156365465 CTGAGACTTCCCTGGAAGGTGGG - Intergenic
941141575 2:161789223-161789245 CTGGGATTTCAAGGGCAGAGGGG + Intronic
942061134 2:172229630-172229652 CTTATGCTTCCAGCGAAGAGGGG + Intergenic
943419846 2:187656478-187656500 CTGAAACATCCAGAAAAGAGAGG + Intergenic
943485646 2:188476362-188476384 CTGAGACCTCTAGGCAATAGTGG + Intronic
944318606 2:198310339-198310361 CTGAGACTTCCAGAAAAAAGAGG + Intronic
945813694 2:214577740-214577762 CAGATGCTTCCAGGGAGGAGAGG - Exonic
946439382 2:219682121-219682143 ATCCTACTTCCAGGGAAGAGAGG + Intergenic
946765301 2:223035294-223035316 CTGTGACAAGCAGGGAAGAGTGG - Intergenic
947792729 2:232877108-232877130 CTGAGGCTCCCTGGGCAGAGGGG - Intronic
948080556 2:235202224-235202246 CTGGGGGTTCCAGGGAAGAACGG + Intergenic
948179979 2:235972126-235972148 CAGAGCCTTGCAGGAAAGAGAGG - Intronic
948678930 2:239618836-239618858 CAGAGTCCACCAGGGAAGAGGGG - Intergenic
948712287 2:239832769-239832791 CTGAGACGCCCAGGGCAGGGAGG + Intergenic
1169218694 20:3808065-3808087 CTGAACTTTCCAGGGCAGAGGGG - Intergenic
1170095980 20:12646494-12646516 CTGAGAATTCCAAGGTTGAGGGG - Intergenic
1172028608 20:31966697-31966719 CTCAGAGTGGCAGGGAAGAGAGG - Intergenic
1172381123 20:34492971-34492993 CCCAGTCTCCCAGGGAAGAGTGG - Intronic
1172790958 20:37505183-37505205 AGGAGACTTCCAGGTAAGAGAGG - Intronic
1173458762 20:43224985-43225007 CTGTGACTTCCAGGGACAAATGG - Intergenic
1174193751 20:48758309-48758331 CTGTCACTTTCAGGGAAGATGGG - Intronic
1174408535 20:50318844-50318866 CTGATATTTCCAGAGCAGAGCGG - Intergenic
1174458780 20:50668278-50668300 CTGAGACCAGCAGGAAAGAGAGG + Intronic
1174675573 20:52350870-52350892 CAGAGACATACAGGAAAGAGGGG - Intergenic
1175892027 20:62319879-62319901 CCGAGGGTCCCAGGGAAGAGGGG + Intronic
1176135032 20:63518785-63518807 CTGAGGCTTCCTGTGCAGAGGGG + Intergenic
1177475806 21:21620470-21620492 TTGAGAGTTCCAGAGAGGAGGGG + Intergenic
1177785172 21:25663741-25663763 CTGAGAAGTCCAAGGTAGAGGGG - Intronic
1178470440 21:32887535-32887557 CTGAGGCATGCAGGGAAGAGTGG - Intergenic
1179508790 21:41858739-41858761 CTGAGGGTTCTGGGGAAGAGGGG + Intronic
1181396667 22:22627953-22627975 CTGAGTTTTCAAGGGGAGAGGGG + Intergenic
1181704792 22:24643510-24643532 CTGAGTTTTCAAGGGGAGAGGGG + Intergenic
1183316382 22:37139217-37139239 CTGAGACTGCAAGGGAAGGAGGG + Exonic
1183484201 22:38080742-38080764 ATGGAACTTCCAGGGATGAGGGG - Intronic
1184230405 22:43155592-43155614 CTGAAAACTCCAGAGAAGAGAGG - Intronic
1185349078 22:50325032-50325054 CTGTGACTTCCAGGTGAGGGAGG + Intronic
949506189 3:4730157-4730179 CTGAGAATTATAGGTAAGAGGGG - Intronic
950521799 3:13501854-13501876 CAGAAACTGCCAGGGAGGAGAGG - Exonic
950730566 3:14953024-14953046 CTAAGACTTCCAGGTACCAGGGG - Intronic
951759791 3:26134113-26134135 CTTAGAGTTCTTGGGAAGAGAGG - Intergenic
951946181 3:28139360-28139382 CTGAGAATTACATGCAAGAGAGG - Intergenic
952645666 3:35655456-35655478 CTGTGACGTGCAGAGAAGAGGGG - Intronic
953206057 3:40830429-40830451 GAGAAACTTCCAGGGAAGAATGG - Intergenic
955003553 3:54949128-54949150 CTGAAACTTTTAGGAAAGAGGGG - Intronic
956386458 3:68724976-68724998 CTGCGGCTCCCAGGGGAGAGGGG - Intergenic
958252461 3:91286407-91286429 ATGTAATTTCCAGGGAAGAGAGG + Intergenic
960034343 3:113087278-113087300 CTGAGGCATCCACGGAGGAGAGG - Intergenic
961098379 3:124176959-124176981 GTCAGACTCCCAGGGCAGAGAGG + Intronic
961527099 3:127511348-127511370 CTGAGAAGTCCAGGGTCGAGGGG - Intergenic
963174252 3:142281604-142281626 CTGAGACTTTGAAGGAAAAGTGG + Intergenic
963975274 3:151473328-151473350 CTGAGACTCCAAGGGAGGAATGG + Intergenic
964027038 3:152087073-152087095 CAGAGCCTGCCAAGGAAGAGAGG - Intergenic
965005586 3:163018936-163018958 CTGAGCCTGCCAGGGAAGGGGGG - Intergenic
965138790 3:164808681-164808703 CTGAGAAGTCCAGGGCTGAGGGG + Intergenic
966890094 3:184400938-184400960 ATGTGACTCCCAGGGAGGAGGGG + Intronic
969301229 4:6298698-6298720 CTGAGTCTTCCACAGATGAGAGG - Intronic
969465857 4:7355967-7355989 CCGAGAAACCCAGGGAAGAGTGG - Intronic
969520092 4:7672634-7672656 GTGAGACTGTCAGGGAAGGGAGG - Intronic
970619639 4:17804043-17804065 ATGAGAGTTCTGGGGAAGAGTGG - Exonic
971257342 4:25027169-25027191 CTGAGACACACAGGGAAGAAAGG - Intronic
973706645 4:53587880-53587902 CTTGGAGTTCCAGGGTAGAGTGG - Intronic
973974462 4:56248312-56248334 CAGAGTCTTCCAGGTATGAGCGG - Intronic
974121956 4:57649611-57649633 CTGGGAAGTCCAGGGTAGAGGGG + Intergenic
975614439 4:76232709-76232731 CTGAAACATCCAGAAAAGAGAGG - Intronic
977442070 4:97080360-97080382 TGGAGACTACCAGGGGAGAGGGG - Intergenic
977565913 4:98580440-98580462 CTCAGACTTCCAGGGCAGGCAGG + Intronic
977611380 4:99036052-99036074 CTGAGACACCCAGCGAAGATAGG + Intronic
978504599 4:109443095-109443117 CTGAGAATTTGAGGGAAAAGGGG - Intronic
978538049 4:109784021-109784043 TGGAGACTTGGAGGGAAGAGTGG + Intronic
978879506 4:113684657-113684679 CTGAGACTTTCTGGGCAGAAAGG - Intronic
979178978 4:117701714-117701736 CTGTGCTTTCCAGGGATGAGGGG - Intergenic
979274128 4:118795737-118795759 CTGTGGCTGCCAGGGAAGGGAGG + Intronic
980301352 4:130998505-130998527 CTGAGACATCCAGAAAAGAGAGG + Intergenic
981773975 4:148343431-148343453 CTTAAACTTCAAGGGCAGAGAGG + Intronic
982209554 4:153023424-153023446 CTGAGACCTTCAGGCAAGAGTGG + Intergenic
985634506 5:1029237-1029259 CTGAGAATTCTAGGGAATAAGGG + Intronic
985880453 5:2635316-2635338 TTGGAACTTCCAGAGAAGAGGGG - Intergenic
985986624 5:3521697-3521719 CTGTGAGGTGCAGGGAAGAGGGG - Intergenic
986946103 5:13022864-13022886 CACAGACTTTCAGGAAAGAGGGG + Intergenic
987890191 5:23866222-23866244 CTGAGGCATCCAGAAAAGAGAGG + Intergenic
988451898 5:31351968-31351990 CTCATACTTCCAGAGAAGAGAGG - Intergenic
989598248 5:43177984-43178006 CCGAGACCTCCAGGGAGAAGAGG - Intronic
990321542 5:54634338-54634360 CTGATACATTCAGGAAAGAGGGG + Intergenic
990368254 5:55091374-55091396 ATGAGACTTCCTGGGTTGAGTGG - Intergenic
993403326 5:87480074-87480096 CTGGAACTTCCAGGAAAGAGGGG - Intergenic
996702527 5:126464703-126464725 GTGAGAGCTCCAGGGCAGAGTGG - Intronic
997512149 5:134461120-134461142 CTGAAACGTCCAGGGCAGATGGG + Intergenic
997865181 5:137455739-137455761 CAGAGACTTCCTGGGCACAGTGG + Intronic
998396672 5:141823146-141823168 GTGAAGCTTCCAGAGAAGAGAGG + Intergenic
999018417 5:148135344-148135366 ATGAGAGTTACAGGGAAGTGTGG - Intronic
999120928 5:149208891-149208913 CTGAGAGTTCCATGGAAGGTGGG + Intronic
999282223 5:150373511-150373533 CAGGGCCTTCCAGGGAAGACAGG + Intronic
999308396 5:150535561-150535583 CTGAGACTTCATGGTAAGATGGG - Intronic
999318886 5:150601217-150601239 CAGGGCCTTCCAGGGGAGAGGGG + Intronic
999715288 5:154355398-154355420 CCAGGACCTCCAGGGAAGAGAGG - Intronic
1001092668 5:168752751-168752773 CTGTGAGTTCCAGGAAGGAGGGG + Intronic
1001634007 5:173196905-173196927 CTGAGACCCACAGGGAAGTGGGG + Intergenic
1002076050 5:176709123-176709145 CGGGAAGTTCCAGGGAAGAGGGG + Intergenic
1002300811 5:178256473-178256495 CTGGGCCCTCCTGGGAAGAGGGG - Intronic
1002869037 6:1148972-1148994 CTGTCACTGCCAGGGAACAGCGG - Intergenic
1003307532 6:4943197-4943219 CTGTGTCTTCGAGGGAAGACAGG + Intronic
1004280570 6:14276289-14276311 CTCAGACATCGAGGGAAGTGTGG + Intergenic
1005852458 6:29831750-29831772 CTGAAACTTCCCGAGAGGAGAGG + Intergenic
1005877298 6:30020948-30020970 CTGAGACCTCTAGGGGAGGGTGG - Intergenic
1006096255 6:31658603-31658625 CTGAGCCATCGAGGGAAGAGTGG - Exonic
1007193234 6:40037804-40037826 CTCAGCCTTCCAAGGTAGAGTGG - Intergenic
1007619715 6:43204528-43204550 CTGGGACTTACAGGGCCGAGTGG - Exonic
1008147998 6:47915412-47915434 CTGACAATTCCTGGGTAGAGAGG + Intronic
1008515306 6:52313275-52313297 CTGAGACTTTCAGGGATGAGGGG + Intergenic
1009454199 6:63835568-63835590 TGGAGACTTGGAGGGAAGAGTGG + Intronic
1010774686 6:79871356-79871378 CTCAGACCTCCAGCGAAGAAAGG - Intergenic
1013649365 6:112178577-112178599 TGGGGACTTGCAGGGAAGAGTGG - Intronic
1013819178 6:114134738-114134760 CTGGGACTGCCAGGGCTGAGGGG + Intronic
1013839795 6:114377844-114377866 GTGAGATTGCCTGGGAAGAGAGG - Intergenic
1015202193 6:130595522-130595544 ATGAACCTTCCAGAGAAGAGTGG + Intergenic
1015370918 6:132451384-132451406 CTGCCACTTCCAGCCAAGAGGGG - Exonic
1015539716 6:134301466-134301488 CTGAGTATTCCAAGGAGGAGCGG + Intronic
1015939291 6:138432195-138432217 CTGAGCCTCCCAGGCAAGAGTGG - Exonic
1019277061 7:181400-181422 CAAAGGCTTCCAGGGAAAAGCGG - Intergenic
1021452027 7:20791449-20791471 CTAACATTTCCTGGGAAGAGAGG + Intergenic
1022850676 7:34258644-34258666 TTGTCACTTCCAGGGAAGGGGGG - Intergenic
1023125766 7:36952550-36952572 CTGAGGCTCCCAGGTAAAAGTGG + Intronic
1026097912 7:67361382-67361404 ATGAGTTTTCCAGGAAAGAGGGG - Intergenic
1026215493 7:68344704-68344726 CTGAGACTTCCATGACTGAGGGG + Intergenic
1026846823 7:73703356-73703378 CTGTGAGTTCCAGGAGAGAGGGG - Intronic
1031241797 7:119253838-119253860 CTGATACTACCAAGGTAGAGTGG + Intergenic
1033410242 7:141110984-141111006 CTCAGACTTCCAGAAATGAGAGG + Intronic
1034891597 7:154844392-154844414 CTAAGATTTCTAGAGAAGAGGGG - Intronic
1035121356 7:156570612-156570634 TGGAGACTTGCAGGGAAGAGTGG + Intergenic
1035132634 7:156669721-156669743 CTGGGACTCCCAGGGAGAAGGGG + Intronic
1035797782 8:2375392-2375414 CTGAGACAACAATGGAAGAGAGG - Intergenic
1035887668 8:3309171-3309193 CCTAGACCTCCAAGGAAGAGGGG + Intronic
1036049865 8:5184340-5184362 CTGAGAAGTCCAGGGTTGAGGGG - Intergenic
1037706868 8:21322676-21322698 ATGTGACTTACAGGGAAGAGTGG - Intergenic
1038753193 8:30315991-30316013 CTGAGACTGCCATGGCACAGAGG - Intergenic
1039212932 8:35236273-35236295 CGGAGAGTTCCTGGGGAGAGGGG + Intronic
1040463272 8:47670384-47670406 CTCAGACTTGGAGAGAAGAGAGG + Intronic
1041474629 8:58249523-58249545 ATGATACCTCCAGGGAAGGGAGG + Intergenic
1041966210 8:63680669-63680691 ATGAGACTGTCAGGGAGGAGAGG + Intergenic
1042854673 8:73254502-73254524 CTGTGACCTCCTGGGAATAGAGG - Intronic
1042865085 8:73349781-73349803 CTGAGACTTGCAGGACAGAAGGG + Intergenic
1043092652 8:75924713-75924735 GTGATACTTCCAGGGGTGAGAGG + Intergenic
1043364794 8:79520439-79520461 CTGTGCCAGCCAGGGAAGAGGGG + Intergenic
1044043363 8:87398655-87398677 CTGAGACTTGCAGTGATGAAAGG - Intronic
1045241992 8:100410657-100410679 ATGAGGCTCCCAGGGCAGAGGGG + Intergenic
1045325094 8:101112050-101112072 TAGAGACATCCAGGGAAAAGTGG - Intergenic
1046601767 8:116325423-116325445 CTGAAACTTGGAGGCAAGAGAGG + Intergenic
1046657616 8:116912682-116912704 CTGATATCTCCAGGGAAGGGAGG - Intergenic
1047199572 8:122753777-122753799 CTCAGACCTTCAAGGAAGAGAGG - Intergenic
1047516079 8:125556124-125556146 CTGGGGGATCCAGGGAAGAGTGG + Intergenic
1047742552 8:127818327-127818349 CTGAGACTTCCGGAGCAGGGTGG - Intergenic
1047973179 8:130103962-130103984 GTGGGTATTCCAGGGAAGAGGGG - Intronic
1049284576 8:141767588-141767610 CTGAGAAGTCCAGGGTTGAGGGG + Intergenic
1049524683 8:143117340-143117362 CAGAGCCTTCCTGGGCAGAGTGG + Intergenic
1049766088 8:144355861-144355883 CTGAGACCTCCAGGGGTCAGAGG - Intronic
1050196688 9:3092034-3092056 CTGTGACTTCCAGGGAGAGGAGG - Intergenic
1050437814 9:5628780-5628802 CTGAGACTCCGAGGCAAGTGGGG - Intergenic
1050552313 9:6758602-6758624 GTGACACTCCCAGGGAAGGGAGG - Intronic
1051619672 9:19037651-19037673 CTGAGACTTGGAAGGAAAAGAGG - Intronic
1053292254 9:36888876-36888898 CTGAGCCTTGCAGGGAGGGGTGG + Intronic
1056843616 9:90018696-90018718 CTCTGACTGCCAGAGAAGAGAGG + Intergenic
1058803657 9:108568997-108569019 CTGAGACTTAGAGAGAAGAGAGG + Intergenic
1059529416 9:115022217-115022239 CTGAGTCTTACAGGGATGTGAGG + Intronic
1060729914 9:126030759-126030781 CAGACACTTCCAGGAAGGAGTGG - Intergenic
1186438387 X:9563785-9563807 TTGGGAATTCCAGGGAAGAAAGG + Intronic
1186729882 X:12398413-12398435 CCATGAGTTCCAGGGAAGAGAGG + Intronic
1187059085 X:15768432-15768454 CTGACACTCCCAGGGAAGACAGG - Intronic
1188456769 X:30375288-30375310 TTTAGAGTTTCAGGGAAGAGAGG - Intergenic
1189262152 X:39686778-39686800 ATGAGGCAGCCAGGGAAGAGTGG - Intergenic
1189353394 X:40293971-40293993 CTCAGACTCCCAGGGGAGGGAGG + Intergenic
1190596849 X:52060110-52060132 CTGAGAGCACCTGGGAAGAGAGG - Intergenic
1190611975 X:52193963-52193985 CTGAGAGCACCTGGGAAGAGAGG + Intergenic
1190929435 X:54935166-54935188 CTGAGAGCACCTGGGAAGAGAGG + Intronic
1191613138 X:63137841-63137863 CTAAGACTCCCATGGAAGATGGG + Intergenic
1191623159 X:63241085-63241107 CTAAGACTCCCATGGAAGATGGG - Intergenic
1193193352 X:78600257-78600279 TTGGGACTTGGAGGGAAGAGTGG + Intergenic
1193393431 X:80956535-80956557 CTGAAACTCCAAGGGAAGAATGG - Intergenic
1193752997 X:85370616-85370638 TGTAGACTTCCAGGGAAAAGGGG - Intronic
1193817820 X:86125431-86125453 TGGAGATTTCCAGGGAAGAGGGG + Intergenic
1194542990 X:95197923-95197945 TGGGGACTTGCAGGGAAGAGTGG - Intergenic
1195711505 X:107776622-107776644 CTGAGGGGTTCAGGGAAGAGAGG - Intronic
1196471756 X:116036509-116036531 CTCTGCTTTCCAGGGAAGAGAGG - Intergenic
1198849661 X:140952801-140952823 CTGAGAGTTGCAGGCAAGTGTGG - Intergenic
1200754832 Y:6981049-6981071 GTTGGAATTCCAGGGAAGAGAGG + Intronic
1201992741 Y:20045506-20045528 CCAAGATTTCCAGGGAAGAGTGG - Intergenic