ID: 1088246183

View in Genome Browser
Species Human (GRCh38)
Location 11:107820357-107820379
Sequence CTGCAATTCTGAGACTTCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 204}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088246183_1088246187 7 Left 1088246183 11:107820357-107820379 CCCTGGAAGTCTCAGAATTGCAG 0: 1
1: 0
2: 0
3: 17
4: 204
Right 1088246187 11:107820387-107820409 GCACTAACCCACTTTAATCAAGG 0: 1
1: 0
2: 0
3: 8
4: 59
1088246183_1088246192 16 Left 1088246183 11:107820357-107820379 CCCTGGAAGTCTCAGAATTGCAG 0: 1
1: 0
2: 0
3: 17
4: 204
Right 1088246192 11:107820396-107820418 CACTTTAATCAAGGAGACTGGGG 0: 1
1: 0
2: 4
3: 171
4: 3602
1088246183_1088246189 14 Left 1088246183 11:107820357-107820379 CCCTGGAAGTCTCAGAATTGCAG 0: 1
1: 0
2: 0
3: 17
4: 204
Right 1088246189 11:107820394-107820416 CCCACTTTAATCAAGGAGACTGG 0: 1
1: 0
2: 0
3: 7
4: 121
1088246183_1088246191 15 Left 1088246183 11:107820357-107820379 CCCTGGAAGTCTCAGAATTGCAG 0: 1
1: 0
2: 0
3: 17
4: 204
Right 1088246191 11:107820395-107820417 CCACTTTAATCAAGGAGACTGGG 0: 1
1: 0
2: 1
3: 14
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088246183 Original CRISPR CTGCAATTCTGAGACTTCCA GGG (reversed) Intronic
902792861 1:18780911-18780933 CTACATTCCTGAGCCTTCCAGGG + Intergenic
905002675 1:34685365-34685387 CTGCCTGTCTGTGACTTCCAAGG - Intergenic
905346680 1:37315807-37315829 CTGCAGATCTGAGACCTTCATGG - Intergenic
905500735 1:38434241-38434263 CTGACATGCTGAGAATTCCATGG + Intergenic
906026279 1:42676681-42676703 CTGAATCTCTGACACTTCCATGG - Exonic
906532190 1:46530288-46530310 CCTCAATTCTGAGGCTTTCAGGG + Intergenic
907308772 1:53527803-53527825 CTGCACTTCCCAGGCTTCCAGGG + Intronic
910661189 1:89674756-89674778 CTGCAATTATCAAACTTTCATGG + Intronic
911239999 1:95454762-95454784 CTGCATTTCTCAGACTTGCCTGG + Intergenic
912204083 1:107491593-107491615 CTGCAATGCTATGACTTCCAGGG - Intergenic
913518058 1:119622117-119622139 CTGCTATTTTGAGGCATCCAAGG - Exonic
913527036 1:119703428-119703450 CTCTGATTATGAGACTTCCAAGG + Intronic
914460310 1:147877708-147877730 CTATAATTCTGGAACTTCCAAGG + Intergenic
916264529 1:162877315-162877337 CTGGAATTCTGGCACTGCCATGG + Intergenic
919008487 1:191929436-191929458 CAGCATTTCTGGGCCTTCCATGG + Intergenic
919120434 1:193333894-193333916 CTGGAATTCTGCGTCCTCCAAGG + Intergenic
920367016 1:205453522-205453544 CCTCAGTTCTGAGACTTCCCAGG + Intronic
921413225 1:214859085-214859107 CTGCAATCCTGAAACCTCCATGG - Intergenic
921599237 1:217089506-217089528 CTGCAGTTCTGACCCTGCCAAGG - Intronic
921790223 1:219281478-219281500 CTCCAATTCTGAGCCTTTCTGGG - Intergenic
923657844 1:235933644-235933666 CTGCAAATCTGCCACTGCCAGGG - Intergenic
1069518697 10:69100722-69100744 CTGCATTTCTCAGGCTCCCAGGG + Intronic
1071197423 10:83177379-83177401 CTGCAAGGCAGAAACTTCCATGG - Intergenic
1073858156 10:107701971-107701993 CTGCAATAATGATACATCCATGG - Intergenic
1077243303 11:1523281-1523303 ATGCCATGCTGAGACTTGCAGGG - Intergenic
1079531555 11:21460653-21460675 CTCCAATTCTTAGCCCTCCATGG + Intronic
1084649778 11:70482395-70482417 CTGCAAGGCTGAGACTGCCGCGG - Intronic
1084748099 11:71186030-71186052 CTGCCTTTCTGAGTCATCCATGG + Intronic
1084774840 11:71368451-71368473 CTGCATTTCTGACAATCCCACGG + Intergenic
1085131036 11:74038839-74038861 CTTCTATTCTGAGACGCCCATGG - Intronic
1085315065 11:75539832-75539854 CTGGAAATCTGAGACTTCCTAGG - Intergenic
1088246183 11:107820357-107820379 CTGCAATTCTGAGACTTCCAGGG - Intronic
1088569848 11:111212766-111212788 CTGCAATTCTTAGAGTCCTAGGG + Intergenic
1090482437 11:127080241-127080263 CAGCATTTTGGAGACTTCCAAGG + Intergenic
1090593498 11:128295977-128295999 CTGAAAGTCTGTGACTACCAGGG + Intergenic
1090655693 11:128842851-128842873 CTGAAATACTGAGTTTTCCAAGG + Intronic
1092584352 12:9881362-9881384 CTACAATTCTGTGAATTTCAAGG - Intergenic
1094304488 12:29002296-29002318 CTCCAAGTCTGAGATTTCTAGGG + Intergenic
1098448507 12:70592520-70592542 CTTCAGATTTGAGACTTCCATGG + Exonic
1100624358 12:96315900-96315922 CTACACTTTTGAGACTTACAGGG + Intronic
1102632167 12:114290610-114290632 CTGACCTTCTGGGACTTCCAAGG + Intergenic
1102757900 12:115358185-115358207 ATATAATTCTCAGACTTCCAGGG - Intergenic
1103331620 12:120158306-120158328 CTGCAATTCACAGACTACGAAGG + Intronic
1106827863 13:33543346-33543368 CTACCTTTCTGAAACTTCCATGG - Intergenic
1106918368 13:34539517-34539539 ATGCAATTCGGAGACCACCATGG - Intergenic
1109268053 13:60223564-60223586 CAGCAATACTGTGACTTCCCTGG - Intergenic
1110111707 13:71755559-71755581 CTGAAATTCAGACAGTTCCAGGG + Intronic
1110925038 13:81140397-81140419 CAGGAATTCTGTGACTCCCATGG + Intergenic
1111372004 13:87332153-87332175 CTGTGATTCTGAGACCTCCCTGG - Intergenic
1112605002 13:100895836-100895858 GTGAAATTCTGAGCCTGCCATGG - Intergenic
1112937455 13:104819043-104819065 CTGCGATTCTGAGAATCCCTGGG - Intergenic
1114334645 14:21675802-21675824 CAGCCATTCTGAGACATCAAAGG - Intergenic
1114702058 14:24688744-24688766 CTGCAATCCTCACCCTTCCACGG + Intergenic
1116965436 14:51010162-51010184 CTACAAGTCTGAGAGGTCCATGG - Intronic
1117011984 14:51480332-51480354 CTGCAAATCTGAGATTTACGGGG + Intergenic
1118692518 14:68353546-68353568 GTGCCAGTCTGAGTCTTCCAAGG - Intronic
1120177391 14:81309548-81309570 CTGCAAATCTGATCCTTCCTTGG + Intronic
1120360268 14:83492028-83492050 CTTCAATTCTCATACTTTCATGG + Intergenic
1124218697 15:27831377-27831399 CTGCATTTCGGAAATTTCCAGGG + Intronic
1127569821 15:60231026-60231048 CTGCACTTTTGAGACTTCTCAGG - Intergenic
1128366023 15:67003760-67003782 CTGCAATTCTGAAGATTTCACGG + Intergenic
1128369668 15:67031288-67031310 CTGCATTTCTGCTACTCCCAGGG - Intergenic
1128811986 15:70579655-70579677 CTGGATTCCTGTGACTTCCAGGG - Intergenic
1130031697 15:80320442-80320464 TTGCAATTCTCTGACTTCAAAGG + Intergenic
1130957949 15:88640216-88640238 CTGCCCTTCTGAGATTTCCCAGG - Intronic
1133328882 16:4958943-4958965 TTGCAATTCTTACACTCCCACGG - Intronic
1134002681 16:10794891-10794913 CTGCTAATCTGAGGGTTCCAGGG - Intronic
1134384625 16:13760194-13760216 CTGCCATTGGGTGACTTCCAGGG + Intergenic
1135100461 16:19600687-19600709 CTCAAATTCTGAGGCTTCTAGGG + Intronic
1135873341 16:26172497-26172519 CTGCAATTCTAACACATTCAGGG - Intergenic
1139443103 16:66978984-66979006 CTGCCATTCAGAGCCTCCCAGGG - Intergenic
1140272496 16:73479525-73479547 CTGCACTCCTGAGACATCCCAGG + Intergenic
1140861159 16:79019241-79019263 ATGCAATTCTGAGAAATGCATGG + Intronic
1141879341 16:86847490-86847512 CTGCCTTTCCGAGTCTTCCAAGG + Intergenic
1142591762 17:1009385-1009407 CTGCCATTCTGAGCATTCTATGG + Intronic
1143966858 17:10761696-10761718 CTGCATTTCTGAGTTTTACATGG - Intergenic
1144669072 17:17121625-17121647 CTGCACTACTGAGACTTGGAGGG + Intronic
1146946464 17:36877091-36877113 CTGGAATCCTGAGAAGTCCATGG + Intergenic
1147436215 17:40417771-40417793 CTGCAATGGTGACACTTCCATGG + Exonic
1147596053 17:41718303-41718325 CAGCAATTTTTAGACTTCCAAGG + Intronic
1147920873 17:43916266-43916288 CTGCAGTTCTGAGACCCCCAAGG + Intergenic
1148540033 17:48472963-48472985 CAGCAATTCTGAGTCTGCCCAGG + Intergenic
1150145794 17:62768074-62768096 CAGCACTTCTCAGACTTTCAGGG - Intronic
1150190904 17:63237903-63237925 CTGGATTTTTGAGACTGCCAAGG - Exonic
1150974674 17:70071395-70071417 CTGCAATGTTGGGAATTCCATGG + Intronic
1153733776 18:8043616-8043638 CTACAATCCTGATGCTTCCATGG + Intronic
1155949514 18:31895015-31895037 CTGCCATTCTGAGAATCCCAGGG + Intronic
1156727748 18:40149426-40149448 GTGGAATTCTGTGACCTCCATGG - Intergenic
1156890399 18:42184256-42184278 CTGTAAATCTGTCACTTCCATGG + Intergenic
1157618270 18:49000770-49000792 CTGCCATTCTCAGCCTCCCAAGG + Intergenic
1158501451 18:58005829-58005851 CTGTGTTTCTAAGACTTCCAAGG - Intergenic
1158820282 18:61151160-61151182 CTGCAGTTTGGAGACTTGCAGGG - Intergenic
1161531536 19:4792744-4792766 CAGCAATTCCAAGGCTTCCACGG - Exonic
1164442515 19:28290106-28290128 TTGCTATTCACAGACTTCCAGGG + Intergenic
1165110442 19:33499073-33499095 CTCCACTTCTGAGACATACAAGG + Intronic
1166376909 19:42332757-42332779 CAGAAATTCTGAAACTTCCAAGG - Intronic
1168349433 19:55667660-55667682 ATGCTGTTCTGAGACTTCCCGGG + Intronic
926443167 2:12911296-12911318 ATCCAATTCTGAAAATTCCATGG - Intergenic
926849895 2:17184747-17184769 CTGTAATACTGAATCTTCCAGGG + Intergenic
927037909 2:19200157-19200179 CTGCAATTCTGAAAATTAGAAGG + Intergenic
927193431 2:20532408-20532430 CTGAAATTCTGAAACTGTCAAGG - Intergenic
928920768 2:36524549-36524571 ATGCAATTCTCAGACCTCCTGGG - Intronic
929980202 2:46671332-46671354 ATGGAACGCTGAGACTTCCAAGG + Intergenic
931852356 2:66264585-66264607 CTGCCATGCTGACATTTCCAGGG - Intergenic
932947850 2:76258285-76258307 CTGCAACTTTGAGACTGGCAGGG - Intergenic
935556303 2:104513237-104513259 CTGCCATTCTGGGTCCTCCAGGG - Intergenic
941429468 2:165395477-165395499 CTTTAATTCAGAGAATTCCAAGG + Intergenic
942034234 2:171995256-171995278 CTGAAATTCTGAGGATTTCAGGG - Intronic
944049465 2:195451077-195451099 CTGCATTCCTGAGGCTTCTAAGG + Intergenic
945123795 2:206486455-206486477 CAGACCTTCTGAGACTTCCAAGG - Intronic
945143495 2:206712752-206712774 CTGCAACTCTCCCACTTCCATGG + Intronic
946049772 2:216852874-216852896 CTGCAATGCAAAGAATTCCAAGG - Intergenic
946888018 2:224243950-224243972 CTGGAATTCTCAGCCTTCCTTGG - Intergenic
948469178 2:238166479-238166501 CTGCATTTCTGGGAGTTCCCAGG + Intronic
1171245125 20:23604571-23604593 CTCAATCTCTGAGACTTCCAAGG + Intronic
1171252145 20:23656494-23656516 CTGCATTTCTGATGCTCCCAGGG + Intergenic
1173535561 20:43809709-43809731 CTCTACTTCTGAGACTCCCATGG + Intergenic
1174706827 20:52664901-52664923 GTTCATTTATGAGACTTCCAGGG + Intergenic
1176004652 20:62854087-62854109 CTGCAATGCCGAGACTGACAAGG - Exonic
1176454654 21:6898164-6898186 CAGCAATTCCAAGGCTTCCATGG - Intergenic
1176832827 21:13763212-13763234 CAGCAATTCCAAGGCTTCCATGG - Intergenic
1177471945 21:21570703-21570725 CTGAAATTCTGAGAAATCCAGGG - Intergenic
1182013821 22:27022530-27022552 CTGGAATTCTGACAGTTCCAGGG + Intergenic
1182437487 22:30340149-30340171 CTGTAATTCGGAGACTACCATGG + Intronic
1184105553 22:42365676-42365698 CTGCAAGCCTGAGACTTCACAGG + Intergenic
1185361236 22:50408422-50408444 CTGTAAATCTGAGAGTTGCAAGG + Intronic
950330785 3:12154518-12154540 CTGCAATTCTGGGCTTTTCAAGG - Intronic
952326660 3:32326329-32326351 CTGCCATTCTGAGCACTCCAGGG + Intronic
952732005 3:36648428-36648450 ATGCAATTATGAGACTTCAAAGG + Intergenic
953498246 3:43407441-43407463 CTGCACTTCTCTGACTCCCAGGG + Intronic
953729626 3:45435710-45435732 CTGCAATTCTGGGGCTTACCGGG + Intronic
954475904 3:50745477-50745499 ATGCAAGTCTTATACTTCCATGG + Intronic
955688306 3:61565745-61565767 CTCCAATTCTGACACATCCAAGG - Intronic
956090661 3:65663216-65663238 CTGTGCTTCTGAGACTACCAGGG + Intronic
956362149 3:68460223-68460245 CTGGAATTCTGAGATTTGAAGGG - Intronic
956700612 3:71955674-71955696 CTGGAATTCTGAGACCAGCAGGG + Intergenic
957837627 3:85618214-85618236 CTGGAATTCTGAGATATCCCGGG + Intronic
958835975 3:99145487-99145509 CTGAAATTCTTAGACCTCCTGGG - Intergenic
962090621 3:132240675-132240697 CAGCAATTCTGAAATCTCCAAGG - Intronic
962431458 3:135324269-135324291 GAGCAATTCTGAGCCTTCGATGG - Intergenic
962654913 3:137533340-137533362 CTGCATTTCCAAGACTTACAAGG + Intergenic
963294838 3:143534618-143534640 CTGCCCTTCTGACACTTCCTGGG - Intronic
964512438 3:157467589-157467611 CTGCATTTCTGGGACCTCCAGGG + Intronic
968949777 4:3684418-3684440 CTGCGGATCTGAGACCTCCAGGG + Intergenic
973220733 4:47723257-47723279 CTGAAACTCTCTGACTTCCAGGG - Intronic
973412988 4:49852408-49852430 GTTCAATTCTGTGACTTCAATGG - Intergenic
974706432 4:65522500-65522522 CTGGAGTACTGAGACTTACAAGG + Intronic
979307787 4:119167730-119167752 TTACCATTCTGAGAATTCCAGGG + Intronic
979322553 4:119341446-119341468 CTGCAATTCTATGAATTCCATGG - Intergenic
979734498 4:124065682-124065704 CTGCTTTTCAGAGATTTCCATGG - Intergenic
981482240 4:145250833-145250855 CTGTATTTCTGAGACTGCTAGGG + Intergenic
982090685 4:151877522-151877544 AAGGAATTCTGAAACTTCCAAGG + Intergenic
982103018 4:151986984-151987006 CTGCCATTTTCTGACTTCCATGG - Intergenic
983240526 4:165227052-165227074 CTGCAATTCTATGAATTCTATGG - Intronic
986319726 5:6620296-6620318 CTGCAATTCTGTGCCTTCAGAGG - Exonic
986732492 5:10645555-10645577 CTGCCAACCTCAGACTTCCAGGG - Intronic
987626165 5:20403739-20403761 TTGCCATTCTGAAAATTCCAAGG - Intronic
989169939 5:38464017-38464039 CTTCTATTCTGAGAATCCCAGGG + Exonic
993607808 5:90015464-90015486 CTATTATTCTGAAACTTCCATGG + Intergenic
993896618 5:93542761-93542783 CTTCAATTCTGAAACATCAAAGG + Intergenic
993999490 5:94761832-94761854 GTGACATTCTGGGACTTCCAAGG + Intronic
998648909 5:144095278-144095300 CTGCATTTCTGAGACAGACATGG - Intergenic
998679423 5:144449830-144449852 CTGAAATTATAAGACTTCTAAGG + Intronic
999803948 5:155064609-155064631 CTTCAATTCAGACATTTCCAGGG - Intergenic
1001325567 5:170721250-170721272 CTGCAATTCTGGGGCCTGCATGG - Intronic
1004349549 6:14879198-14879220 CAGCAATTCTGACAATGCCATGG - Intergenic
1007090558 6:39181921-39181943 CTGGAGTTCTGAGACTGCCGAGG - Intergenic
1007306088 6:40906239-40906261 CTGCATCTCTGAGGATTCCATGG + Intergenic
1011651757 6:89512683-89512705 TGGCATTTCTGACACTTCCAGGG - Intronic
1011872291 6:91910943-91910965 CTGGAATCCTGACAATTCCATGG + Intergenic
1012023994 6:93965016-93965038 CTGCAATTCTGAAAGTTACATGG - Intergenic
1014574800 6:123057067-123057089 GTGTAATTCTCAGACTTCCCAGG + Intronic
1015580529 6:134719518-134719540 CTGCAATATTGGGAGTTCCAAGG + Intergenic
1020422069 7:8018615-8018637 CTGGACTTTGGAGACTTCCAGGG + Intronic
1022052384 7:26689844-26689866 CTGCCATTCAGAGACTAACAGGG - Intronic
1023543463 7:41292061-41292083 CTGCAATTTTGAGAATTCACAGG - Intergenic
1027437156 7:78176083-78176105 CTCCGATTCTGAGATTACCAGGG - Intronic
1028281587 7:88936429-88936451 CTGCAAATCTAAGACTTGAAGGG + Intronic
1029435720 7:100562973-100562995 CTGACCATCTGAGACTTCCAAGG + Intronic
1030218314 7:107069738-107069760 CTATAAATCTGAGACTTTCAAGG + Intronic
1031405185 7:121376837-121376859 CTGCATTTCTGACAGCTCCAAGG - Intronic
1033431411 7:141292990-141293012 CTGCAATAGTGAGATTGCCAGGG + Intronic
1033719099 7:144037945-144037967 GTGCACTTCTGAGCCTTCCCAGG - Intergenic
1034093251 7:148383110-148383132 CTGTAAATCTCAGAATTCCAAGG + Intronic
1034249825 7:149680152-149680174 CTAAAATTCTAAAACTTCCAAGG + Intergenic
1034591534 7:152144141-152144163 ATTCCATTCTGAGACATCCAAGG + Intronic
1035972757 8:4269801-4269823 TTGTAATTCTGAGACTTCATTGG - Intronic
1036684422 8:10899725-10899747 CTGGTTTTCTGAGGCTTCCAAGG + Intronic
1038350549 8:26772280-26772302 CTCTGATTCTCAGACTTCCAAGG + Intronic
1038616932 8:29104059-29104081 CTGGACTTCTGAGACTCCCTTGG + Intronic
1038673457 8:29601205-29601227 ATGAAATTCTGGGACCTCCAAGG + Intergenic
1040755208 8:50765057-50765079 CTTCTCTTCTGAGAGTTCCATGG - Intronic
1041772883 8:61491059-61491081 CTGTAATTTTGAGACTTTCTAGG + Intronic
1042582500 8:70296312-70296334 CAGCAAATCTCAGACTTACAGGG - Intronic
1043161269 8:76850982-76851004 ATTCCATTCTGAGACTTCCAAGG - Exonic
1044488649 8:92785271-92785293 CTGCAATTCTCAGACATCACTGG + Intergenic
1047082103 8:121474070-121474092 TTGAAATTCTAAGACATCCATGG - Intergenic
1047403393 8:124564544-124564566 CTGCAACTCTGAGGCTGCCGGGG - Intronic
1048810106 8:138277863-138277885 CAGAAATACTGAGAATTCCAGGG + Intronic
1048859218 8:138711542-138711564 CTGCATTTCTGAAAAGTCCACGG + Intronic
1048869086 8:138782642-138782664 GTGGGACTCTGAGACTTCCAGGG - Intronic
1050583968 9:7090652-7090674 CTGCAGTTCTGAACCTTCTATGG - Intergenic
1051011946 9:12427166-12427188 CTGAAATACTCAGACTTCAAAGG + Intergenic
1053167122 9:35852887-35852909 CTGCAGTTCTGTGATTTCCTGGG + Exonic
1056180178 9:84075460-84075482 GTGCAATTATGAGACTTCTGTGG - Intergenic
1057057491 9:91974929-91974951 CTGCAACTCTGACTCTTCCTTGG - Intergenic
1059458316 9:114413515-114413537 CTGCATGACTGACACTTCCAGGG - Intronic
1060003816 9:119981996-119982018 TTGCAATTCTTAGACTGACAGGG - Intergenic
1062342181 9:136098679-136098701 CTCCAATTCTGAGACTCCTCAGG - Intergenic
1062714885 9:138004284-138004306 CTGCAGTGCTGAGATTACCAGGG - Intronic
1187177144 X:16906134-16906156 CTGCATTTCTAACACTTTCAGGG - Intergenic
1187616630 X:21001525-21001547 ATGCAAATCTGAGACATCTATGG - Intergenic
1188594128 X:31876146-31876168 CTACAAATGTGAAACTTCCAAGG - Intronic
1190153878 X:47972240-47972262 TTTCTATTCTGAGACTTCTAGGG + Intronic
1190406489 X:50093222-50093244 ATGCAGTTCTGAGTCTTCCCTGG - Exonic
1194966857 X:100298067-100298089 CTGCAATTCAGAGTCTTACTTGG + Intronic
1196090085 X:111731399-111731421 TAGCAATTCTGAGACCTTCATGG + Intronic
1196902641 X:120401055-120401077 CTGCAATTCAGAACTTTCCAGGG + Intergenic
1196923743 X:120611127-120611149 CTGTAATTCTGATGCTTCCTGGG - Intronic
1197097642 X:122614263-122614285 GTGCCTTTCTGAGACTTCCTCGG - Intergenic
1199340840 X:146675479-146675501 GTGCACTTCAGAGACATCCACGG + Intergenic
1199882057 X:151981705-151981727 CTGCATTTCTTCAACTTCCACGG - Intergenic