ID: 1088246184

View in Genome Browser
Species Human (GRCh38)
Location 11:107820358-107820380
Sequence TCTGCAATTCTGAGACTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 255}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088246184_1088246192 15 Left 1088246184 11:107820358-107820380 CCTGGAAGTCTCAGAATTGCAGA 0: 1
1: 0
2: 0
3: 17
4: 255
Right 1088246192 11:107820396-107820418 CACTTTAATCAAGGAGACTGGGG 0: 1
1: 0
2: 4
3: 171
4: 3602
1088246184_1088246189 13 Left 1088246184 11:107820358-107820380 CCTGGAAGTCTCAGAATTGCAGA 0: 1
1: 0
2: 0
3: 17
4: 255
Right 1088246189 11:107820394-107820416 CCCACTTTAATCAAGGAGACTGG 0: 1
1: 0
2: 0
3: 7
4: 121
1088246184_1088246191 14 Left 1088246184 11:107820358-107820380 CCTGGAAGTCTCAGAATTGCAGA 0: 1
1: 0
2: 0
3: 17
4: 255
Right 1088246191 11:107820395-107820417 CCACTTTAATCAAGGAGACTGGG 0: 1
1: 0
2: 1
3: 14
4: 116
1088246184_1088246187 6 Left 1088246184 11:107820358-107820380 CCTGGAAGTCTCAGAATTGCAGA 0: 1
1: 0
2: 0
3: 17
4: 255
Right 1088246187 11:107820387-107820409 GCACTAACCCACTTTAATCAAGG 0: 1
1: 0
2: 0
3: 8
4: 59

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088246184 Original CRISPR TCTGCAATTCTGAGACTTCC AGG (reversed) Intronic
902581278 1:17409375-17409397 TCTGCCAATCAGAGCCTTCCAGG + Intronic
905448425 1:38042548-38042570 TGTGCCATGCTGAGAGTTCCTGG - Intergenic
905513052 1:38538977-38538999 TCAGCAAGCCTGATACTTCCAGG - Intergenic
907471812 1:54679259-54679281 TCAGGAATTTGGAGACTTCCTGG + Exonic
909663696 1:78110985-78111007 TCTGCAATACTGAGGATTGCTGG + Intronic
912204084 1:107491594-107491616 TCTGCAATGCTATGACTTCCAGG - Intergenic
912683235 1:111742056-111742078 TCTCCATCTCTGAGACTTCATGG + Intronic
916801547 1:168220945-168220967 TCTGCAATTCTGAACACTCCTGG + Intergenic
918772961 1:188587846-188587868 TCTGCCATTCTGTGAATTTCTGG - Intergenic
921790224 1:219281479-219281501 CCTCCAATTCTGAGCCTTTCTGG - Intergenic
921822925 1:219638264-219638286 TCTGCTAATCTGAGTTTTCCTGG - Intergenic
924678014 1:246200940-246200962 CTTGCATTTCTGAGACTTCATGG - Intronic
1063712400 10:8492377-8492399 TCGCAAATTCTGAGACCTCCTGG + Intergenic
1065298003 10:24294877-24294899 TCTCCAATTCCCAGACTTTCAGG - Intronic
1065427281 10:25618915-25618937 CCTGCAATTCTTAGAATTTCTGG - Intergenic
1067729265 10:48797635-48797657 TCTGTTATGCTGAGAGTTCCTGG + Intronic
1068814357 10:61293055-61293077 ATTGCAATTCTGCTACTTCCTGG + Intergenic
1069518696 10:69100721-69100743 TCTGCATTTCTCAGGCTCCCAGG + Intronic
1069952024 10:72025616-72025638 CCTGAAATGCTGAGACGTCCAGG - Intergenic
1070425221 10:76280637-76280659 GCTAGAATTCTGAGAATTCCAGG - Intronic
1070641222 10:78171774-78171796 TTTGCATTTCTGAGACCTCTGGG + Intergenic
1070736150 10:78865182-78865204 TCCGCAGTTCTGAGGCATCCGGG + Intergenic
1071215274 10:83393770-83393792 GGTGAAATTCTGAGACTTGCTGG - Intergenic
1072000153 10:91187046-91187068 TCTGCATTTCTGAGTTTCCCAGG + Intronic
1073250867 10:102119791-102119813 GCTGAAATTCTCAGAATTCCAGG - Intronic
1074316715 10:112367981-112368003 TCTGCATTTCTAACAATTCCAGG - Intergenic
1074685277 10:115956341-115956363 ACTGAAAGTCTAAGACTTCCTGG - Intergenic
1076928437 10:133508075-133508097 TCTGCATTTCTGAGTCTCCGTGG + Intergenic
1077243304 11:1523282-1523304 TATGCCATGCTGAGACTTGCAGG - Intergenic
1077882544 11:6362826-6362848 TCTGGAATACTGAGAGTGCCGGG + Intergenic
1078322763 11:10351660-10351682 GCAGACATTCTGAGACTTCCCGG - Intronic
1079079745 11:17405940-17405962 TCTGTAGTTCTGAAACTCCCTGG - Intronic
1079520517 11:21321123-21321145 TCTGCAACTCTGAAATTCCCTGG + Intronic
1080069348 11:28060779-28060801 TCTGGAATTTTGATACATCCTGG + Intronic
1080970975 11:37276410-37276432 AATTCAATTCTGAGACTACCTGG - Intergenic
1081047374 11:38293198-38293220 TGTGCAATGCTGATGCTTCCAGG - Intergenic
1084752111 11:71210825-71210847 TCTTCAGTCCTGAGGCTTCCGGG - Intronic
1084955838 11:72691073-72691095 TCCTCAAGTCTGAGACTTCCAGG + Intronic
1085126066 11:74003551-74003573 TTAGCAATCCTGAGACCTCCTGG - Intronic
1085152731 11:74265148-74265170 CCTGTAATTCTGAGAAGTCCAGG + Intronic
1085374341 11:76044990-76045012 CCTCCAATTCTGAGACTTTCTGG - Intronic
1086127157 11:83360683-83360705 TCAGGAATTCTGAAACTTCTGGG + Intergenic
1086333071 11:85773192-85773214 TCTGCCATTGTAAGACTCCCTGG + Intronic
1087178653 11:95120285-95120307 GATGCGACTCTGAGACTTCCTGG - Intronic
1088246184 11:107820358-107820380 TCTGCAATTCTGAGACTTCCAGG - Intronic
1088360658 11:108985718-108985740 TCTGCATCTCTGAGACTAACTGG + Intergenic
1089360790 11:117885123-117885145 TCTGCTTTTCTGAGGCTGCCTGG - Intergenic
1090593497 11:128295976-128295998 TCTGAAAGTCTGTGACTACCAGG + Intergenic
1090614656 11:128504034-128504056 TCAGAAATCCTGAGACTTCGGGG + Intronic
1094304487 12:29002295-29002317 TCTCCAAGTCTGAGATTTCTAGG + Intergenic
1094454528 12:30617618-30617640 TCTGCTTTTCAGAGACTTCTGGG - Intergenic
1097907385 12:64934174-64934196 TCTGGGATTCTAAGAATTCCAGG - Intergenic
1100091926 12:90983521-90983543 TCTGCTTTTCTTATACTTCCGGG + Intronic
1101456766 12:104840432-104840454 TCAGCATTTATGAGACTACCAGG - Intronic
1107082907 13:36394184-36394206 TCTGCAGTGCAGAGCCTTCCAGG + Intergenic
1107430138 13:40332912-40332934 CCTACAATTCTGACACTACCTGG - Intergenic
1107939148 13:45369047-45369069 TCTGAAATTCAGAGACGTCCAGG - Intergenic
1108362123 13:49677421-49677443 TCTGTGATTCTGAGACTGGCTGG + Intronic
1108479004 13:50848124-50848146 TTGGCAATTCAGAGACTTCAGGG - Intergenic
1111044207 13:82794081-82794103 AATTCAATTCTGAGACTACCTGG + Intergenic
1112937456 13:104819044-104819066 TCTGCGATTCTGAGAATCCCTGG - Intergenic
1113272897 13:108694570-108694592 TCTGCAGTTCTAAGAGTTCTTGG + Intronic
1114642429 14:24232510-24232532 TCTGCGATTCTGAGAGTCCCTGG + Intronic
1117011983 14:51480331-51480353 ACTGCAAATCTGAGATTTACGGG + Intergenic
1117388306 14:55238812-55238834 TCTGCAGTTTTGAGATTTCCTGG + Intergenic
1118377210 14:65187830-65187852 TTTGGAAATCTCAGACTTCCTGG + Intergenic
1118985648 14:70752557-70752579 TTGGCAATGCTGAGAGTTCCTGG - Intronic
1119966338 14:78920541-78920563 TATTCAATTCTGATACTACCTGG + Intronic
1120749714 14:88186387-88186409 TCTCCAAATCTGAGGCTTCTTGG - Intronic
1121241038 14:92430421-92430443 TCTGCCATTCGGAGGCCTCCAGG - Intronic
1122324540 14:100874704-100874726 TCTGCAGCTCTCTGACTTCCTGG + Intergenic
1123985585 15:25643309-25643331 TTTGCAACTCTGTGGCTTCCTGG + Intergenic
1124378168 15:29141681-29141703 CCTGTAATTCTGAGTCTTTCTGG - Intronic
1125326505 15:38540948-38540970 ACTGCAAATCTGAGAAATCCTGG - Intronic
1125350792 15:38765480-38765502 TCTGCAAATCTCAGTCTTCTTGG - Intergenic
1125881633 15:43200727-43200749 TCTGCAAATCTGACAGTACCTGG + Intronic
1126098168 15:45103923-45103945 TTTCTAATCCTGAGACTTCCTGG - Intronic
1127977270 15:64006931-64006953 CCTGCATTTCAGTGACTTCCTGG - Intronic
1129190733 15:73936131-73936153 GCTGCCACTCTGAGACTTCTAGG + Intronic
1129709760 15:77814791-77814813 TCTGAAACTCTGAGACTTTGGGG - Intronic
1129902608 15:79162852-79162874 TCTGCAATTCATAGACTTTTAGG + Intergenic
1129977708 15:79836275-79836297 TCTGCATTTCTGACAAATCCTGG - Intronic
1130841683 15:87706720-87706742 TCAGAAATTCTGAGCCTTCTGGG + Intergenic
1131581731 15:93649810-93649832 TCTGCCCTCCTGAGACTTCCAGG - Intergenic
1133404446 16:5511800-5511822 TCTGCAATTCTGAGAACTTTGGG - Intergenic
1134318737 16:13143403-13143425 TCTGGAATTCAGAGCCATCCAGG + Intronic
1134384624 16:13760193-13760215 TCTGCCATTGGGTGACTTCCAGG + Intergenic
1134594775 16:15487379-15487401 ACTGTAATTCTAAGACATCCAGG - Intronic
1135100460 16:19600686-19600708 TCTCAAATTCTGAGGCTTCTAGG + Intronic
1135873342 16:26172498-26172520 TCTGCAATTCTAACACATTCAGG - Intergenic
1136691447 16:32034025-32034047 CCAGCAATTCTGAGAATTCAAGG + Intergenic
1136792035 16:32977590-32977612 CCAGCAATTCTGAGAATTCAAGG + Intergenic
1136877782 16:33876318-33876340 CCAGCAATTCTGAGAATTCAAGG - Intergenic
1138117851 16:54374531-54374553 TCTGCAAAGATGATACTTCCAGG + Intergenic
1138897772 16:61229413-61229435 TCTGGACTTCAGTGACTTCCTGG + Intergenic
1138903113 16:61297954-61297976 TCTGTAAATGTGAGAGTTCCTGG - Intergenic
1140689995 16:77472873-77472895 TCTTCAACTCAGAGTCTTCCAGG - Intergenic
1142120607 16:88384762-88384784 CCTGAAATCCTGGGACTTCCTGG - Intergenic
1203094245 16_KI270728v1_random:1239054-1239076 CCAGCAATTCTGAGAATTCAAGG + Intergenic
1143950029 17:10625039-10625061 TCAGCAATGCTGAGACATTCTGG - Intergenic
1144607842 17:16683660-16683682 CCTGCCCTTCTGAAACTTCCGGG - Intergenic
1145196992 17:20902496-20902518 CCTGCCCTTCTGAAACTTCCGGG + Intergenic
1146825446 17:36018700-36018722 GCTTCACTTCTGAGACTACCTGG + Intergenic
1149165511 17:53747321-53747343 TCAGTATTTCTGAGACTTACAGG + Intergenic
1152347983 17:79765931-79765953 TCTCCCAGTCTGAGGCTTCCTGG + Intergenic
1152444317 17:80332238-80332260 TCAGCAACTCTGCGGCTTCCTGG - Exonic
1153466565 18:5394800-5394822 TCTGCCCTTCTGTGATTTCCCGG - Intronic
1155135636 18:22989478-22989500 TCTACATTTCTGAGACTGCTGGG - Intronic
1155271078 18:24141763-24141785 TCTGCAACTCTGAGAATTACAGG + Intronic
1155949513 18:31895014-31895036 TCTGCCATTCTGAGAATCCCAGG + Intronic
1156548370 18:37988442-37988464 TCTGTAATTCTGCCACTTGCTGG + Intergenic
1156865026 18:41879506-41879528 TCTACAATTCTGAGATTCCTTGG - Intergenic
1158121278 18:54050750-54050772 TCTGCAATCTTGAGAATGCCAGG + Intergenic
1159954692 18:74510928-74510950 TCTGCATTTCTGACAATTACTGG + Exonic
1166736786 19:45090643-45090665 TCTGGACTCCTGAGACCTCCTGG + Exonic
1166917579 19:46206100-46206122 TCAGCAATCCTGAGACTTTGTGG - Intergenic
1166919867 19:46221923-46221945 TCAGCAATCCTGAGACTTTGCGG - Intergenic
1168349432 19:55667659-55667681 GATGCTGTTCTGAGACTTCCCGG + Intronic
926538236 2:14141315-14141337 ATTGCAAATCTGAGATTTCCAGG - Intergenic
926765519 2:16319973-16319995 GCTGCACTTCTGAGACATCGGGG - Intergenic
928300514 2:30120051-30120073 TCTGCATTTCAGAGACATCTAGG + Intergenic
928920769 2:36524550-36524572 CATGCAATTCTCAGACCTCCTGG - Intronic
930169136 2:48233208-48233230 CCTGCATTTCTGAGGTTTCCAGG + Intergenic
931852357 2:66264586-66264608 TCTGCCATGCTGACATTTCCAGG - Intergenic
932634209 2:73373755-73373777 TCTGCATTTCTAAGGCTCCCAGG + Intergenic
933387837 2:81634253-81634275 GGTGAAATTCTGAGACTTGCTGG + Intergenic
935626264 2:105174673-105174695 TCTGCACTTCAGAGTCCTCCTGG + Intergenic
937228314 2:120382450-120382472 TTTGCATTTCTGAAAGTTCCTGG - Intergenic
939426717 2:142047848-142047870 CCTGGAACTCTGAGACCTCCAGG + Intronic
940797811 2:158099204-158099226 TCAGCACTTCCTAGACTTCCTGG + Intronic
942262149 2:174177559-174177581 TCTGCACTTCTTAGACTGCTTGG + Intronic
942668735 2:178350891-178350913 GTTGCAATTCTGAAGCTTCCAGG + Intronic
943841470 2:192588039-192588061 TAAACAATTTTGAGACTTCCTGG - Intergenic
944008828 2:194945912-194945934 TATGCATTTCTGAAAATTCCAGG + Intergenic
944927363 2:204478984-204479006 CCTGCAACTCTGAGTGTTCCTGG - Intergenic
944928478 2:204491064-204491086 TCTGCAAGTCTTAGTCTTCAGGG - Intergenic
945411945 2:209520157-209520179 ACTGCAATTATGAGATTTCTGGG + Intronic
945570847 2:211465715-211465737 TCTGCTTTTCTAAGACTTGCCGG + Intronic
1170544331 20:17421475-17421497 ACTGAAATGCAGAGACTTCCTGG - Intronic
1171252144 20:23656493-23656515 TCTGCATTTCTGATGCTCCCAGG + Intergenic
1174334715 20:49851360-49851382 TATGCAATTCTGGGAAATCCTGG - Intronic
1174706826 20:52664900-52664922 TGTTCATTTATGAGACTTCCAGG + Intergenic
1175229835 20:57466749-57466771 TCTGCATTTCTAAGATTCCCTGG + Intergenic
1177471946 21:21570704-21570726 ACTGAAATTCTGAGAAATCCAGG - Intergenic
1180023909 21:45147781-45147803 TCAGCAACTGTGAGCCTTCCTGG + Intronic
1182013820 22:27022529-27022551 CCTGGAATTCTGACAGTTCCAGG + Intergenic
1183856024 22:40635976-40635998 TCTGCAAATCTGAAACTTGATGG - Intronic
1184593013 22:45498356-45498378 TCTCCAGTTCTGAGACTCCTGGG + Intergenic
1184956134 22:47887542-47887564 TCTGCACCCCTGACACTTCCAGG - Intergenic
950730569 3:14953033-14953055 CCTTCTATTCTAAGACTTCCAGG - Intronic
952697057 3:36277984-36278006 TCTGAGATTCTAAGACTACCAGG + Intergenic
952911916 3:38197443-38197465 TGTGTAGTTCTGAGACTTTCTGG + Intronic
953009315 3:39009487-39009509 TCAGCAATTCTCAAACTTTCTGG - Intergenic
953222948 3:40989822-40989844 TCTGCAATTCTTAGTCAGCCTGG + Intergenic
953729625 3:45435709-45435731 GCTGCAATTCTGGGGCTTACCGG + Intronic
954563650 3:51580028-51580050 TATTCAATTCTGACACTGCCGGG + Intronic
955750319 3:62179956-62179978 TCTGCATCTCTGCTACTTCCTGG - Intronic
956090660 3:65663215-65663237 TCTGTGCTTCTGAGACTACCAGG + Intronic
956362150 3:68460224-68460246 TCTGGAATTCTGAGATTTGAAGG - Intronic
956700611 3:71955673-71955695 TCTGGAATTCTGAGACCAGCAGG + Intergenic
957837626 3:85618213-85618235 ACTGGAATTCTGAGATATCCCGG + Intronic
958835976 3:99145488-99145510 ACTGAAATTCTTAGACCTCCTGG - Intergenic
959658847 3:108842613-108842635 TAAGCAATTCTGAGAATTTCGGG + Intronic
960062922 3:113341532-113341554 TCTGTAATTCTTAGAGTTTCCGG - Intronic
963294839 3:143534619-143534641 TCTGCCCTTCTGACACTTCCTGG - Intronic
963803791 3:149702809-149702831 ACTGCATTTCTGAGACTGCAAGG + Intronic
964438256 3:156675549-156675571 TCTGCAATTCCGGGTGTTCCCGG - Intronic
964512437 3:157467588-157467610 GCTGCATTTCTGGGACCTCCAGG + Intronic
965860829 3:173147292-173147314 TTAGCATTTCTGAGACTTGCTGG - Intergenic
965929232 3:174022324-174022346 TTTGCAATTCTGAGATTTTCTGG - Intronic
967369109 3:188723298-188723320 TCTGCAAGGCTGAGAGTTGCAGG + Intronic
968949776 4:3684417-3684439 TCTGCGGATCTGAGACCTCCAGG + Intergenic
969263785 4:6050957-6050979 TTTGTAATTCTGTGATTTCCTGG - Intronic
970248732 4:14092056-14092078 TCTGGATTTCTGAGCCTGCCTGG + Intergenic
971973639 4:33654054-33654076 TTTGCTATTCTGAGGTTTCCTGG + Intergenic
973826887 4:54716663-54716685 GATGCAATTTTGAGACATCCAGG + Intronic
975020309 4:69478670-69478692 TCTACAATTTTTATACTTCCAGG - Intergenic
976303963 4:83541068-83541090 ATTGCAATTCTGCCACTTCCTGG - Intronic
978212670 4:106156981-106157003 TATGCCACTCTGAGACTTGCTGG - Intronic
978328475 4:107586272-107586294 TCTGCAAATCTAATATTTCCTGG - Intergenic
979307786 4:119167729-119167751 TTTACCATTCTGAGAATTCCAGG + Intronic
980237411 4:130127122-130127144 GCTGTAATTATTAGACTTCCAGG - Intergenic
981482239 4:145250832-145250854 TCTGTATTTCTGAGACTGCTAGG + Intergenic
982800194 4:159696896-159696918 TCTGCAATTCGGAGATTTCTTGG + Intergenic
983936227 4:173504463-173504485 TCTGCAAATGTGGGACTCCCAGG + Intergenic
984115721 4:175678620-175678642 TCTGCAATATTTAGACTTTCAGG - Intronic
985962743 5:3315127-3315149 TCTGCATTCCTGAGGCTTCGTGG - Intergenic
986046633 5:4044424-4044446 CATGAAACTCTGAGACTTCCTGG + Intergenic
987726142 5:21702246-21702268 ACTGCAATTCTGTGACTACATGG + Intergenic
990368256 5:55091383-55091405 TATGTAATAATGAGACTTCCTGG - Intergenic
992875414 5:81049723-81049745 TCTCCAATACTCAGATTTCCTGG - Intronic
993764359 5:91837279-91837301 TCTGAAAATCAGAGACTTCTTGG - Intergenic
995173956 5:109151980-109152002 ACAGCATTTCTGAGACTTTCGGG + Intronic
995458723 5:112379689-112379711 TCAGCCATTCTGAGAAGTCCTGG + Intronic
998653521 5:144148406-144148428 TCTGCTACTATAAGACTTCCGGG - Intergenic
999803949 5:155064610-155064632 TCTTCAATTCAGACATTTCCAGG - Intergenic
999844550 5:155464611-155464633 TCTGCATTTCTGAAGGTTCCTGG - Intergenic
1000263654 5:159614351-159614373 TTTGCAATTGTGAGGCCTCCAGG - Intergenic
1002347044 5:178555340-178555362 GCCCCAATTCTGAGACTTTCGGG + Intronic
1004436829 6:15604011-15604033 TCTTCAACTCTGAGTCTGCCAGG + Intronic
1004539102 6:16532344-16532366 TGGGCAAATCTGAGAATTCCAGG + Intronic
1006214493 6:32428664-32428686 TCTGCAATCCTGGCTCTTCCTGG - Intergenic
1006757505 6:36429338-36429360 TCATGAATTCTGAGATTTCCTGG - Intronic
1008016283 6:46523818-46523840 TCGGGAATTCTGAGACTTTAGGG - Intergenic
1010181897 6:73096283-73096305 TCTGAATTTCTGTTACTTCCAGG - Intronic
1010364650 6:75035279-75035301 TATATACTTCTGAGACTTCCAGG - Intergenic
1011651758 6:89512684-89512706 TTGGCATTTCTGACACTTCCAGG - Intronic
1014844129 6:126255477-126255499 ATTCCAATTTTGAGACTTCCAGG + Intergenic
1015815061 6:137201212-137201234 TCTGCAATTCTAGAACTTTCTGG + Intronic
1015844049 6:137499098-137499120 TGTGCTATTCTGGGACTGCCTGG - Intergenic
1019378988 7:711809-711831 TCTGCAGTTCTGAGGATTCCGGG + Intronic
1019917721 7:4144271-4144293 CCGGGAGTTCTGAGACTTCCTGG - Intronic
1020422068 7:8018614-8018636 TCTGGACTTTGGAGACTTCCAGG + Intronic
1021215069 7:17905887-17905909 CCTCCAATTCTGAGACTCACAGG + Intronic
1021602503 7:22378279-22378301 TCTGCCTTTCTCAGACATCCTGG - Intergenic
1021639269 7:22722240-22722262 TCTGTAATTCTGAGACATTGGGG - Intergenic
1022052385 7:26689845-26689867 TCTGCCATTCAGAGACTAACAGG - Intronic
1022807741 7:33839547-33839569 TTTGCAATTTTGAGCCTCCCAGG + Intergenic
1023004306 7:35846772-35846794 TCTGGACTCCTGAGACCTCCTGG - Intronic
1023527047 7:41115659-41115681 TCTCTAATTCTGAGAGATCCAGG + Intergenic
1023664919 7:42513081-42513103 GCTGATATTCTGTGACTTCCAGG + Intergenic
1023922209 7:44638568-44638590 ACTGCAATTCCGGGACATCCAGG + Intronic
1024438137 7:49382588-49382610 TCTGCAAACCTTATACTTCCTGG + Intergenic
1024828722 7:53422481-53422503 TCTGCAGTTCAGTGAGTTCCGGG - Intergenic
1025219291 7:57092023-57092045 TCTGGACTCCTGAGACCTCCTGG + Intergenic
1025630081 7:63263594-63263616 TCTGGACTCCTGAGACCTCCTGG + Intergenic
1025652189 7:63480441-63480463 TCTGGACTCCTGAGACCTCCTGG - Intergenic
1025795269 7:64733795-64733817 TCTGGAAGTAAGAGACTTCCAGG + Intergenic
1027437157 7:78176084-78176106 TCTCCGATTCTGAGATTACCAGG - Intronic
1027650235 7:80857467-80857489 TAAGCAATTCTGAGATGTCCTGG - Intronic
1029962839 7:104706888-104706910 TCTGCAATTGTGACACTCCAGGG + Intronic
1031241505 7:119248218-119248240 TCTGCCATTCTGAGACTTGAAGG - Intergenic
1032411024 7:131693347-131693369 TCTGCACTCCTGAGCTTTCCAGG + Intergenic
1034715483 7:153237666-153237688 TCTGGAAGTCTGGGACTTGCTGG + Intergenic
1034850052 7:154485070-154485092 TCTGCAATTCTAAGGCTTAATGG - Intronic
1035588254 8:793599-793621 ACTCCTCTTCTGAGACTTCCTGG + Intergenic
1037162354 8:15788884-15788906 TCTGCAATTCTCAGACATTTGGG + Intergenic
1037542617 8:19887062-19887084 TAGGCAATTCTCTGACTTCCTGG - Intergenic
1037577257 8:20219200-20219222 TTTGCATTTCTGTGAATTCCTGG + Intronic
1039339680 8:36633874-36633896 TTTATAATTCTGAGTCTTCCTGG + Intergenic
1039397464 8:37238838-37238860 TCTCCAATTCTGTGACTTTGCGG - Intergenic
1041585337 8:59510859-59510881 TCAGTAATTCAGAGAATTCCTGG - Intergenic
1042051909 8:64718848-64718870 ACTGGAATGCTGGGACTTCCGGG - Intronic
1042241660 8:66669922-66669944 TCTGCAATTCTAACACTGTCAGG + Intronic
1043393532 8:79814104-79814126 TCAGCAATTCTGACAAATCCAGG + Intergenic
1043711746 8:83427940-83427962 TCTGCACTTTTGTGAATTCCTGG - Intergenic
1044072024 8:87772830-87772852 TCTGCCTTTCTGACAATTCCTGG + Intergenic
1046082374 8:109386899-109386921 ACTGCAATTCTGTGATTTCATGG - Intronic
1047403394 8:124564545-124564567 TCTGCAACTCTGAGGCTGCCGGG - Intronic
1047650922 8:126919788-126919810 TCTACAATTCTGGAACTTTCTGG + Intergenic
1047918959 8:129613142-129613164 GCTGCATTTCTGAGAATTCTGGG - Intergenic
1048810105 8:138277862-138277884 TCAGAAATACTGAGAATTCCAGG + Intronic
1049158411 8:141081761-141081783 TCTTCAGTTCTGACACTACCTGG + Intergenic
1050616680 9:7408436-7408458 TCTTAAATTCTGAGGCTTCGGGG + Intergenic
1052823879 9:33161357-33161379 TCTGTAAGTCAGAGACCTCCAGG - Intronic
1053167121 9:35852886-35852908 GCTGCAGTTCTGTGATTTCCTGG + Exonic
1057044297 9:91872987-91873009 TCTGAAATTCTTAAACTTCTTGG + Intronic
1059507400 9:114812445-114812467 TCTGCAATTCTGAGCCAGCCGGG + Intergenic
1059786932 9:117596544-117596566 TGTGCAACTTTGAGACTGCCTGG + Intergenic
1060003817 9:119981997-119982019 TTTGCAATTCTTAGACTGACAGG - Intergenic
1186256695 X:7729498-7729520 GCTGCAATTCTGAGATTGCAAGG - Intergenic
1186398294 X:9232765-9232787 TCTCCAATTCTGAGATTCCAAGG + Intergenic
1186460051 X:9740883-9740905 TCTGATATTGTGAGACTGCCAGG + Intronic
1187177145 X:16906135-16906157 TCTGCATTTCTAACACTTTCAGG - Intergenic
1187610172 X:20934060-20934082 TCTGCAACGCTGAGACCTCATGG - Intergenic
1188296102 X:28451150-28451172 TCTGAAACTCTAAGACTTCAAGG + Intergenic
1193995612 X:88363643-88363665 TAGGCAATTCTGCTACTTCCTGG + Intergenic
1194323203 X:92477715-92477737 GGTGAAATTCTGAGACTTGCTGG - Intronic
1195805758 X:108763476-108763498 TCTACAAGTCTGAGACCTCAGGG + Intergenic
1196393403 X:115233729-115233751 TCGGAAACTCCGAGACTTCCCGG - Exonic
1196923744 X:120611128-120611150 CCTGTAATTCTGATGCTTCCTGG - Intronic
1197288083 X:124619956-124619978 TCTGCAATCAGGAGACTGCCTGG + Intronic
1199547389 X:149020277-149020299 TCTGCAAAACTGACACTTGCAGG + Intergenic