ID: 1088246186

View in Genome Browser
Species Human (GRCh38)
Location 11:107820382-107820404
Sequence ATTAAAGTGGGTTAGTGCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 106}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088246186_1088246191 -10 Left 1088246186 11:107820382-107820404 CCTTGGCACTAACCCACTTTAAT 0: 1
1: 0
2: 0
3: 16
4: 106
Right 1088246191 11:107820395-107820417 CCACTTTAATCAAGGAGACTGGG 0: 1
1: 0
2: 1
3: 14
4: 116
1088246186_1088246195 29 Left 1088246186 11:107820382-107820404 CCTTGGCACTAACCCACTTTAAT 0: 1
1: 0
2: 0
3: 16
4: 106
Right 1088246195 11:107820434-107820456 TGTTTTGCCTAAGATCACACAGG 0: 1
1: 0
2: 6
3: 66
4: 401
1088246186_1088246192 -9 Left 1088246186 11:107820382-107820404 CCTTGGCACTAACCCACTTTAAT 0: 1
1: 0
2: 0
3: 16
4: 106
Right 1088246192 11:107820396-107820418 CACTTTAATCAAGGAGACTGGGG 0: 1
1: 0
2: 4
3: 171
4: 3602

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088246186 Original CRISPR ATTAAAGTGGGTTAGTGCCA AGG (reversed) Intronic
901622906 1:10603413-10603435 ATTAATGTGGGCTAGAGTCAGGG + Intronic
902842737 1:19085747-19085769 ACGAAAGTGGCTTAGTGGCAGGG - Intronic
903582981 1:24386263-24386285 ATTAAAGTGTGTTAAAGCCCAGG - Intronic
905870665 1:41402558-41402580 ATTCCTGTGGGTTAGTTCCATGG + Intergenic
911696837 1:100897911-100897933 ATTAAAGTGTGTTAATACTATGG - Intronic
917444646 1:175096838-175096860 ATTAAAGTGGGTTAGAACCTGGG - Intronic
918864115 1:189872338-189872360 TTTAATATGAGTTAGTGCCAAGG - Intergenic
919120088 1:193328700-193328722 ATCAAACTGGCTTGGTGCCAGGG - Intergenic
920422338 1:205843598-205843620 TTTAAAGTGGGAAAGTGCCAGGG + Intronic
921571205 1:216780750-216780772 CCTACAGTGAGTTAGTGCCAAGG + Intronic
921655790 1:217735391-217735413 ATTGAATGGGATTAGTGCCATGG - Intronic
1063244355 10:4202949-4202971 GAAAAAGTGGGTCAGTGCCAAGG - Intergenic
1063774444 10:9245122-9245144 ATTAAAGTGATTTATAGCCATGG + Intergenic
1064253632 10:13726008-13726030 CTGGAAGTGAGTTAGTGCCAAGG + Intronic
1065970281 10:30800538-30800560 ACCAAAGTGGGTTAGAGACAGGG + Intergenic
1066335833 10:34477503-34477525 TTTACAGTGCATTAGTGCCATGG - Intronic
1069043514 10:63718889-63718911 ATAAAAGTAGGTTAGACCCAGGG + Intergenic
1073947687 10:108769860-108769882 ATCAAAATGGGTTAGTGTCAAGG - Intergenic
1074742168 10:116496082-116496104 ATTAAAGCGGTTCATTGCCATGG - Intergenic
1079345565 11:19648763-19648785 ATTTAATTGTGTTACTGCCAGGG - Intronic
1079529278 11:21429886-21429908 ATTAAAGTAGATAAGTGCTAGGG - Intronic
1080261905 11:30358551-30358573 ATTAAAGTGTATTAATGCCAAGG + Intergenic
1086283138 11:85214038-85214060 ATTATAGTAGGTTAGTTCCAGGG + Intronic
1088246186 11:107820382-107820404 ATTAAAGTGGGTTAGTGCCAAGG - Intronic
1093710902 12:22328938-22328960 ATTATAGTGGGTAAGAGCAAAGG - Intronic
1093757066 12:22864381-22864403 ACTAAAGGGGGTAAATGCCATGG - Intergenic
1095232257 12:39753292-39753314 ATTAGAGAGGGTTAATGTCACGG + Intronic
1095999834 12:48119685-48119707 TTTGAATTGGGTGAGTGCCAGGG - Intronic
1100757673 12:97769881-97769903 ATAAAAATGGGTAAGTTCCAAGG - Intergenic
1101171989 12:102107060-102107082 ATTTTAGTGGGTTAGTGAGATGG + Intronic
1101330347 12:103752624-103752646 ATTAAAGTGAGTTTCTGCCCAGG - Intronic
1104191839 12:126489258-126489280 ATGAATGTGGGTTAGTAACATGG + Intergenic
1110171583 13:72506988-72507010 AAGAAAGTGAGTTAGTGCCTGGG + Intergenic
1115848306 14:37562659-37562681 CTTAAAGTGTGTTAATGTCATGG - Intergenic
1117496474 14:56310480-56310502 ATTAAAGTGGCTTTAAGCCAAGG - Intergenic
1118678476 14:68214344-68214366 GTTAAAGTTGGTAAGTACCAGGG - Intronic
1119828176 14:77675639-77675661 ATTCAGGTGAGTTAGTTCCAGGG - Exonic
1121542692 14:94740476-94740498 ATTAAAGTAGGATAGGGCCTGGG - Intergenic
1121618945 14:95332775-95332797 ACTACAGTGGGTAAGTGCCCTGG + Intergenic
1122814339 14:104304921-104304943 ATTCAAGAGGGTTACTGCAAGGG - Intergenic
1123507671 15:20961054-20961076 ATTAAGGTGGGATAGTGCAAAGG - Intergenic
1123564892 15:21534797-21534819 ATTAAGGTGGGATAGTGCAAAGG - Intergenic
1123601151 15:21972088-21972110 ATTAAGGTGGGATAGTGCAAAGG - Intergenic
1130808456 15:87352069-87352091 TTTAAATGAGGTTAGTGCCAAGG + Intergenic
1202973259 15_KI270727v1_random:261907-261929 ATTAAGGTGGGATAGTGCAAAGG - Intergenic
1135274918 16:21103842-21103864 AGTGAAGTGGGCCAGTGCCATGG - Intronic
1139085768 16:63583854-63583876 TTCAAAGTTGGTTATTGCCATGG + Intergenic
1144865215 17:18331233-18331255 ATTAAGCTGGGGTAGTGCCTTGG + Intronic
1147399497 17:40171641-40171663 AGAGAAGTGGTTTAGTGCCATGG - Exonic
1151173878 17:72270976-72270998 ATTAAAATCGGTTAGAGCCTAGG + Intergenic
1154105296 18:11517674-11517696 ATTAGAGTGGCTTAGAGCTACGG + Intergenic
1155633200 18:27919912-27919934 ATTAAACTGCATTATTGCCAAGG - Intergenic
1160111302 18:76034372-76034394 ATGCAAGTGGGGCAGTGCCATGG - Intergenic
1164863849 19:31587485-31587507 ATAAAAAGGGGTAAGTGCCAGGG - Intergenic
1166000556 19:39875222-39875244 ATTTCAGTGTGTGAGTGCCAAGG + Intronic
1166003354 19:39891479-39891501 ATTTCAGTGTGTCAGTGCCAAGG + Intronic
927135935 2:20096613-20096635 ATTAAAGTGGGAAGGGGCCAGGG - Intergenic
932912065 2:75817007-75817029 ATCAAAGTGGGTCAATGCCATGG + Intergenic
933025402 2:77251735-77251757 AGTATAGTGGGTGAGTGCAAGGG - Intronic
933984416 2:87578708-87578730 ATTTAAATGGATCAGTGCCAGGG - Intergenic
936309438 2:111372091-111372113 ATTTAAATGGATCAGTGCCAGGG + Intergenic
936645087 2:114359515-114359537 ATTAATCTGGGTTAGGGCCCAGG - Intergenic
944712954 2:202352031-202352053 ATTAATGTGGTTTAGTGACTAGG + Intergenic
944749012 2:202689143-202689165 ATTAAAGTGGTTTTCTGCCTGGG + Intronic
944929415 2:204501245-204501267 GTAAAAGTGGGTTATTGCAATGG + Intergenic
945197743 2:207253066-207253088 ATGAAAGTGGGTTGTTCCCATGG + Intergenic
945934643 2:215890641-215890663 TTCAAATTGGGTAAGTGCCAAGG - Intergenic
946966001 2:225038874-225038896 TTTTAGGTGGGTTAGTGCAATGG - Intronic
1173855763 20:46249734-46249756 ATGAAAGTGGGGTGGTGCCCCGG - Intronic
1178779822 21:35591434-35591456 ACCAAAGTGGTTTATTGCCACGG + Intronic
951160651 3:19416917-19416939 ATAAAACTGGGTTAGTGAAAGGG - Intronic
952846511 3:37692105-37692127 TATAAAGTGGGATTGTGCCAAGG + Intronic
953213254 3:40894867-40894889 ATCAAAGCTGGTTATTGCCATGG - Intergenic
957606273 3:82403492-82403514 ATAAAAGTGAGGTAGTGACACGG + Intergenic
958885297 3:99719862-99719884 ATTTAAGTGAGTGAGTGACATGG + Intronic
960585684 3:119319653-119319675 ATTAAAGTCTGTTAGAGCCAGGG - Intronic
960867192 3:122213629-122213651 ACTAAAGTGGGTTATTAACAAGG - Intronic
962300074 3:134231937-134231959 TTGAAAGTGGGTTAGTCTCAGGG - Intronic
963750177 3:149169716-149169738 ATTAAAATGGGTTAGTGGATGGG + Intronic
967458838 3:189721872-189721894 ATTGAACTGGGGTAGTGCCCAGG + Intronic
969493538 4:7513251-7513273 ATTAGACTGGGTTATTGCCGTGG + Intronic
971504944 4:27356359-27356381 ATTAAACTGGGTTACCTCCAAGG - Intergenic
971587315 4:28421276-28421298 ATTAAAGTGAGTTAATACCTTGG + Intergenic
972753669 4:42021307-42021329 ATTTAAGTGAGTCAGTGACAGGG + Intronic
978552927 4:109947429-109947451 ATTCAAGTGAGATTGTGCCACGG - Intronic
982108771 4:152034179-152034201 ATTAAGGTAGGCTAGTGACATGG + Intergenic
984169058 4:176339390-176339412 ATTAAAGTGGGTTGGAGGCAGGG + Intergenic
984931736 4:184853941-184853963 ATCAATGTGTGTTAGAGCCAAGG - Intergenic
985963070 5:3317847-3317869 CTTAAAGTGTGTTGGTGTCATGG + Intergenic
986190194 5:5489863-5489885 ATTAAAGTGGGTTTCTGCTAAGG - Exonic
987048022 5:14125561-14125583 ATTAAAGAGGTTTAGAGCCATGG + Intergenic
988129365 5:27082345-27082367 ATTAACGTGGGTTATTCCTAAGG + Intronic
988439697 5:31218847-31218869 ATGAGAGTGGGTTAGTGCTGTGG - Intronic
988465100 5:31482510-31482532 ATTAATGTAGGTTGGTGGCATGG + Intronic
990967439 5:61464524-61464546 AATTAAGTGGGTTAGAGCCTGGG + Intronic
993576250 5:89604653-89604675 ATTAAAGTAGGATAGAGCTAAGG - Intergenic
993805073 5:92397151-92397173 ATTAAAGAAGGTTACTGCAATGG - Intergenic
993883063 5:93385292-93385314 ATCACAGTTGGTTAGTGCAAAGG - Intergenic
997659705 5:135579668-135579690 CTTAAAGTGGGTCAGTGGCCTGG + Intergenic
1002907237 6:1459115-1459137 ATTAAAATGGATTACTGCCTAGG + Intergenic
1006543390 6:34758722-34758744 ATTGACTTGAGTTAGTGCCAGGG + Intronic
1012064140 6:94526865-94526887 ATTACAGTGTGTTACTGCCAAGG - Intergenic
1014615578 6:123594383-123594405 ATTGAAGAGAGTTAGTGCCTTGG - Intronic
1014615698 6:123596247-123596269 ATTGAAGAGAGTTAGTGCCTTGG - Intronic
1015077496 6:129177939-129177961 ATTAAAATTGCTTAATGCCAAGG - Intronic
1022997543 7:35772985-35773007 GATAAAGTGGGGTAGTGCTAAGG + Intergenic
1023118874 7:36889412-36889434 AAGAAAGTGGGTAACTGCCAGGG + Intronic
1023395720 7:39750058-39750080 ATGAAAGTGGGAGAGTTCCATGG - Intergenic
1030412516 7:109199360-109199382 CTTACAGTGGGTACGTGCCAAGG + Intergenic
1032311880 7:130795108-130795130 ATGAAAGTGGATGAATGCCATGG + Intergenic
1032846612 7:135756880-135756902 ATTAAAATGGGTTGGGGGCAGGG - Intergenic
1034817733 7:154187858-154187880 ATTAGAGTGGGTTAGAGTCTCGG - Intronic
1035362759 7:158324454-158324476 ATCCAAGTGGGTCACTGCCAGGG - Intronic
1040670368 8:49682472-49682494 ATTTAAGTGAGGTAATGCCATGG - Intergenic
1045121172 8:99036882-99036904 ATTATAGTGGTTAATTGCCATGG + Intronic
1046648892 8:116815187-116815209 ATTGATGTGGGTTATTGCCAGGG + Intronic
1051305355 9:15702880-15702902 ATTAAAGAGAGTTAGGGCCTTGG + Intronic
1052148601 9:25082331-25082353 ACTAAAGTGGGTAAATACCAAGG + Intergenic
1052636368 9:31110976-31110998 ATTACAATGGGTTAGTAACAGGG + Intergenic
1056928736 9:90857022-90857044 ATTAAAGTGGGTTTGGCCAAAGG - Intronic
1058147530 9:101428628-101428650 AGTAAAGTGTATTAGTGCGAGGG + Intronic
1188292682 X:28408534-28408556 ATCAAAGTGAGATAGAGCCAAGG + Intergenic
1197678903 X:129361198-129361220 AATAAAGTGGGCTGGTGGCAGGG + Intergenic