ID: 1088246192

View in Genome Browser
Species Human (GRCh38)
Location 11:107820396-107820418
Sequence CACTTTAATCAAGGAGACTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3778
Summary {0: 1, 1: 0, 2: 4, 3: 171, 4: 3602}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088246184_1088246192 15 Left 1088246184 11:107820358-107820380 CCTGGAAGTCTCAGAATTGCAGA 0: 1
1: 0
2: 0
3: 17
4: 255
Right 1088246192 11:107820396-107820418 CACTTTAATCAAGGAGACTGGGG 0: 1
1: 0
2: 4
3: 171
4: 3602
1088246183_1088246192 16 Left 1088246183 11:107820357-107820379 CCCTGGAAGTCTCAGAATTGCAG 0: 1
1: 0
2: 0
3: 17
4: 204
Right 1088246192 11:107820396-107820418 CACTTTAATCAAGGAGACTGGGG 0: 1
1: 0
2: 4
3: 171
4: 3602
1088246186_1088246192 -9 Left 1088246186 11:107820382-107820404 CCTTGGCACTAACCCACTTTAAT 0: 1
1: 0
2: 0
3: 16
4: 106
Right 1088246192 11:107820396-107820418 CACTTTAATCAAGGAGACTGGGG 0: 1
1: 0
2: 4
3: 171
4: 3602
1088246182_1088246192 24 Left 1088246182 11:107820349-107820371 CCTCTCTTCCCTGGAAGTCTCAG 0: 1
1: 0
2: 2
3: 31
4: 343
Right 1088246192 11:107820396-107820418 CACTTTAATCAAGGAGACTGGGG 0: 1
1: 0
2: 4
3: 171
4: 3602

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088246192 Original CRISPR CACTTTAATCAAGGAGACTG GGG Intronic
Too many off-targets to display for this crispr