ID: 1088246353

View in Genome Browser
Species Human (GRCh38)
Location 11:107821783-107821805
Sequence TCCCCAAGGCAGCTTCACAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 160}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088246348_1088246353 28 Left 1088246348 11:107821732-107821754 CCACTAAAATGAACTTCAATGGC 0: 1
1: 0
2: 0
3: 13
4: 156
Right 1088246353 11:107821783-107821805 TCCCCAAGGCAGCTTCACACTGG 0: 1
1: 0
2: 1
3: 20
4: 160
1088246350_1088246353 -5 Left 1088246350 11:107821765-107821787 CCAACTCCAAGACAAATTTCCCC 0: 1
1: 0
2: 1
3: 13
4: 162
Right 1088246353 11:107821783-107821805 TCCCCAAGGCAGCTTCACACTGG 0: 1
1: 0
2: 1
3: 20
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088246353 Original CRISPR TCCCCAAGGCAGCTTCACAC TGG Intronic
900603397 1:3512912-3512934 TCCCCAAGGCTGCTTGGCCCAGG + Intronic
903390275 1:22959066-22959088 TCCCAAAGGCAGCTCCACAGAGG - Intronic
903813200 1:26046164-26046186 CGCCGACGGCAGCTTCACACGGG - Intergenic
904043604 1:27598074-27598096 TCCCCAAGGCACCCTCCCCCAGG + Intronic
904796606 1:33061016-33061038 GCCCCACAGCAGCTGCACACAGG + Intronic
906686271 1:47765419-47765441 TCCCAAATCCAGCTTCACAAAGG + Exonic
907195933 1:52686927-52686949 TTCCCAAGGCAGCTTCAGCTAGG - Exonic
907715922 1:56925992-56926014 TCCCCAAGGAAGCTTTACCAAGG - Intergenic
911545958 1:99217433-99217455 TTCTAAAGACAGCTTCACACAGG + Intergenic
912632092 1:111254825-111254847 TGCCCATGGCAAATTCACACAGG + Intergenic
915528163 1:156488747-156488769 GCCCCAGGCCACCTTCACACAGG - Intronic
922856980 1:228783818-228783840 TCCCCAAGCCCGCTTCCCCCAGG + Intergenic
1063063520 10:2584714-2584736 TCCCCACCTCATCTTCACACAGG - Intergenic
1064352413 10:14588507-14588529 TCTGTAAGCCAGCTTCACACAGG + Intronic
1069713569 10:70506560-70506582 TCCCCCAGGCAGTGTCACTCAGG - Intronic
1069756992 10:70779524-70779546 TCCCCAAGGCTGCCTCACTTGGG - Intronic
1070109293 10:73467347-73467369 TCCCCCAGACAGCCTCACATGGG + Intronic
1074008643 10:109454897-109454919 TCCCCAGGGCATTGTCACACAGG - Intergenic
1075212997 10:120507631-120507653 TCACCAAGGAAGCATCACAGCGG - Intronic
1075323530 10:121511505-121511527 TCACAAAGGCTGCTTCACACTGG + Intronic
1076126807 10:127981008-127981030 TCAGCATGGCAGCCTCACACTGG - Intronic
1076882144 10:133244877-133244899 TCCCCAAGGCAGGGTCTCAGAGG + Intergenic
1078089350 11:8254702-8254724 TCCCCAAGTCATCTTCTCACAGG + Intronic
1078480787 11:11673513-11673535 ACCCCAAGGATGCTTCCCACAGG - Intergenic
1079993839 11:27274597-27274619 TCCCCAAGACAGCATCATAACGG + Intergenic
1080041040 11:27759674-27759696 TGCCCAAGGCATCATCACACTGG - Intergenic
1084003527 11:66311750-66311772 TCCCTAAGGGAGCTTCGCACTGG - Intergenic
1088246353 11:107821783-107821805 TCCCCAAGGCAGCTTCACACTGG + Intronic
1088815876 11:113420398-113420420 TCTCCAAGGCAGCTTCCCCTGGG - Intronic
1089788535 11:120925358-120925380 TGCCCAGGCCAGCTTTACACAGG + Intronic
1089822616 11:121241753-121241775 TCCCCAGTGCAGCTTCACGGGGG - Intergenic
1092239281 12:6827545-6827567 TCCACCAGGCAGCCTCGCACAGG + Intronic
1094408504 12:30145188-30145210 TCTCAAAGGCACCTTCTCACAGG - Intergenic
1098376491 12:69821032-69821054 TCCTAAAGGCAGCTTCTCAAGGG + Exonic
1098984430 12:76996405-76996427 AACCCCAGGCAGTTTCACACTGG + Intergenic
1100331185 12:93583657-93583679 TGCCCAACGCAGCTTCAAACTGG - Intergenic
1103940361 12:124498228-124498250 ACCCCCAGGCAGCATCTCACTGG - Intronic
1104079236 12:125415691-125415713 TCCCCAAGGCACCTCCGCAGTGG + Intronic
1107740883 13:43449235-43449257 TGCCCAAGGGAGTCTCACACTGG - Intronic
1112503741 13:99961044-99961066 TCCCCAGGGCAGTTTCACCTAGG + Intergenic
1112731817 13:102371296-102371318 TCCCCATGCCATCTTCTCACTGG + Intronic
1113895879 13:113764313-113764335 TCCCCAAGGCAGCTTCTGCAGGG - Intronic
1113910649 13:113839746-113839768 CCCCCCAGCCAGCTTTACACAGG + Exonic
1113961956 13:114131249-114131271 TCCCGGAGGCCTCTTCACACGGG + Intronic
1116683723 14:48011239-48011261 TCCCCATGGGTGCCTCACACAGG - Intergenic
1118315321 14:64722532-64722554 TCCACACGGCACCTGCACACAGG - Intronic
1120896354 14:89536321-89536343 TCCTCACAGCAGCTTCACAAAGG - Intronic
1122236695 14:100334593-100334615 TCCCCAAAGCAGCCCCACAGTGG - Exonic
1122370449 14:101226392-101226414 CCCCCTAGGCAGCTTCCCCCTGG - Intergenic
1124143924 15:27103391-27103413 TCCCCACAGCAGGTTCACCCAGG + Intronic
1125492433 15:40158260-40158282 GCCCCAGGGCCGCTGCACACAGG + Intergenic
1125537621 15:40451328-40451350 CCCCCAAGGCAGCTTCTCAGAGG - Intronic
1127764902 15:62175677-62175699 GCCCCATGGCATCTACACACTGG + Intergenic
1128130137 15:65221623-65221645 TCACCAAGGCAGGAGCACACTGG - Intergenic
1128144840 15:65327253-65327275 TTCCCAAAGCAGCTTCTCTCGGG - Exonic
1132425439 15:101712215-101712237 TCAGCAGAGCAGCTTCACACTGG - Intronic
1132516626 16:368982-369004 GCCCCAGGTCAGCATCACACCGG - Intronic
1134517128 16:14896237-14896259 TGCCCCAGCCAGCTTCACTCAGG - Intronic
1134704796 16:16294891-16294913 TGCCCCAGCCAGCTTCACTCAGG - Intergenic
1134962746 16:18417223-18417245 TGCCCCAGCCAGCTTCACTCAGG + Intergenic
1134967041 16:18499822-18499844 TGCCCCAGCCAGCTTCACTCAGG + Intronic
1136364102 16:29800843-29800865 TCCCCAAGGCAGCAGCACTGAGG - Intronic
1137339947 16:47591719-47591741 TTCACAAGGCAGCTGCATACAGG - Intronic
1137764524 16:50967652-50967674 TCCCCATGGAAGCTTCGCCCAGG - Intergenic
1138100905 16:54251760-54251782 TCCCCAGGGGAGCTCCCCACTGG - Intronic
1139614428 16:68080329-68080351 TCCTCCAGCCAGCCTCACACAGG - Intergenic
1141744627 16:85917219-85917241 TCCACAAGGCAGCCTCGAACCGG + Intronic
1142356961 16:89605822-89605844 TCCCCAAGGGCCCTTCCCACCGG - Intergenic
1142872234 17:2828471-2828493 TTCCCCAGACAGCTTCACACTGG - Intronic
1143876854 17:9998142-9998164 TCCCCTAGGCAGCTTCAGGATGG - Intronic
1144774961 17:17780785-17780807 TCCCCCAGCCAGCTAGACACTGG - Intronic
1150824450 17:68462381-68462403 TCACCGAGGCATCTTCGCACTGG + Intergenic
1151603838 17:75124038-75124060 TCTTCAGGGCAGGTTCACACAGG + Intronic
1152756036 17:82087493-82087515 TCCCCGAGTCACCTGCACACAGG + Exonic
1158387223 18:57008502-57008524 TCCCCTAGGCAGAGTGACACGGG + Intronic
1161738142 19:6004284-6004306 TCCCCCAGGTACCTTGACACAGG - Exonic
1163062059 19:14768096-14768118 TCCCCAGGACAGCTGCTCACTGG + Intronic
1163696055 19:18764112-18764134 TGCCCAGGGCAGCTGCTCACCGG - Intronic
1163834748 19:19566357-19566379 TCCCCTGGGCAGATTCACATGGG + Intronic
1164565577 19:29323702-29323724 TCCCCACCGGAGCTTCCCACCGG - Intergenic
1164727625 19:30476910-30476932 GCCCCAAGGCAGGACCACACTGG - Intronic
926274801 2:11395681-11395703 TCCCAAAGGCCGGCTCACACTGG - Intergenic
926365107 2:12125832-12125854 TCTCCAATGCAGCTTCACAATGG - Intergenic
926608862 2:14925091-14925113 TCCCCAAGGAATTTTCACAAAGG + Intergenic
927256619 2:21045096-21045118 TCCCCAAGGCACCTCCACTCTGG + Intergenic
927827168 2:26316929-26316951 TCCCCAAGGCCTCTTCTCACTGG - Exonic
932399159 2:71467615-71467637 CCTCCAAGGCAGATTCCCACTGG + Intronic
932515119 2:72338788-72338810 TACCCAAGGCTGCTACAGACAGG + Intronic
932581349 2:72994575-72994597 TCCCCCAGGCAGCTCCTGACTGG + Intronic
933391590 2:81675801-81675823 TCCTCAAGGCAGCTTAACTGTGG + Intergenic
933626250 2:84603873-84603895 TCCCCAAGCCAGCATCATAAGGG + Intronic
934521750 2:95024369-95024391 TCCCCAGGGCAGCATCTCTCTGG - Intergenic
934747598 2:96769791-96769813 GCCCGAAGGCAGCTTTGCACCGG + Intronic
940346820 2:152637135-152637157 TCCCTATGACAGCCTCACACAGG - Intronic
940710060 2:157152131-157152153 TCTTCAAGTCAGCTTCCCACAGG + Intergenic
940959100 2:159762244-159762266 TCCCCAAGGCAGCTTGGAAGTGG + Intronic
941660226 2:168188940-168188962 TTCTCAAGGCAGCTACAAACTGG + Intronic
941870979 2:170385332-170385354 CCCCCTAGACAGCTTCAGACTGG - Intronic
944305055 2:198169698-198169720 TCCCCAGGGTACCTTGACACTGG - Intronic
945415190 2:209562358-209562380 TCACAAAGGTAGCTACACACTGG + Intronic
948261571 2:236607845-236607867 TCTCTAAGACACCTTCACACTGG + Intergenic
948387968 2:237593421-237593443 TCTTCAAGGCCCCTTCACACAGG + Intronic
1175701731 20:61142993-61143015 TCCCCAGGGCAGCTGAAGACTGG - Intergenic
1176102410 20:63370475-63370497 TCCCAAAGGCACCTTCACCCAGG - Intronic
1183742286 22:39675428-39675450 GCCCCATGCCAGCTCCACACTGG - Intronic
1185072813 22:48666677-48666699 TCCCCGTGACAGCGTCACACCGG + Intronic
949377185 3:3403934-3403956 TCCCCAAGGGAAATTCACTCAGG + Intergenic
950765995 3:15273426-15273448 TCTCAAAGGCAGCTTCACATGGG - Intronic
952231440 3:31435071-31435093 TCTCCAGGTCAGCTTCACCCTGG + Intergenic
952440119 3:33318140-33318162 TCCCCATGGCTGTTTCTCACTGG + Intronic
953092917 3:39747462-39747484 TGGCCAAGGCAACTTCACTCTGG + Intergenic
954831426 3:53424657-53424679 TCCTCAAGCCAGTTTCACATTGG + Intergenic
955405068 3:58620762-58620784 TGCCCAGGGCTGCTTCAAACAGG - Intronic
955476341 3:59340266-59340288 GCCCCATGGCAGGTGCACACTGG - Intergenic
961408313 3:126699121-126699143 TCCCCAAGGATTCTTCACAGTGG + Intergenic
961721933 3:128902842-128902864 TCCCCCAGTCAGCATCACCCGGG - Intronic
962827417 3:139110146-139110168 GCCAAAAGGCAGGTTCACACTGG + Intronic
963222536 3:142827410-142827432 GCCAGAGGGCAGCTTCACACGGG + Intronic
964639351 3:158892183-158892205 TCCCTAAGGCAACTTCACAGTGG - Intergenic
964793877 3:160477529-160477551 TTCCAAAGGTAGCTTCCCACAGG + Intronic
967824673 3:193868934-193868956 TCCCGCAGGCAGCTTCTCCCCGG - Intergenic
968567831 4:1323823-1323845 TCCCCACAGCAGCTTCAGACAGG - Intronic
976848314 4:89515372-89515394 TCCTCAAGGCAGTCTCCCACTGG - Intergenic
977611860 4:99043831-99043853 TTCCCAAGGTAGCTTAACATAGG - Intronic
977948539 4:102942444-102942466 TCACCAAAGCAGCATAACACTGG + Intronic
978840643 4:113208121-113208143 CCCCCAAGCCAGCTTCATATTGG - Intronic
979011043 4:115368845-115368867 TTCCCAAGGCTGCTTTATACTGG + Intergenic
981722579 4:147816235-147816257 TCCCACAGGCAGCTCCACACTGG - Intronic
982374721 4:154677238-154677260 TCACCAAAGCAGCTCCCCACTGG - Intronic
984214644 4:176895346-176895368 GCCGCAAAGCAGCTTCACAAAGG + Intergenic
992396413 5:76373029-76373051 ACTCCAAGGCAGCTTCCCACTGG - Intergenic
995222881 5:109670863-109670885 ACCCCAAGGAAGATTCACATTGG + Intergenic
997336250 5:133110826-133110848 TCCTCATGGCAGCCTTACACGGG - Intergenic
998482760 5:142476586-142476608 TCCCCCATGCAGCCTCACTCTGG - Intergenic
1000882519 5:166714487-166714509 TTTGCAAGGCAACTTCACACTGG - Intergenic
1001416125 5:171545737-171545759 TCCCCAAGGCCGCTCAACAAGGG - Intergenic
1002318385 5:178360414-178360436 TTCCCATGGCAGCTTCTCCCTGG - Intronic
1002896661 6:1383675-1383697 TCCCCAAAGCAGCTTCTCGGAGG + Intergenic
1005911710 6:30316009-30316031 TCCCAAAGTCTGCTGCACACTGG + Intergenic
1006604974 6:35249614-35249636 TCCCCCAGGGAGCATCACATGGG - Exonic
1007125054 6:39418972-39418994 GGCCCAGGGCAGCTTCACAGAGG - Intronic
1015800825 6:137060800-137060822 TTCTCAAGGCTGCTTCAAACGGG + Intergenic
1018759788 6:166884042-166884064 TCCCCTAGGTAGCTTCAGAATGG + Intronic
1019345033 7:525464-525486 TCCCAGAGGCAGCTTGACCCTGG - Intergenic
1019657902 7:2207340-2207362 GCCCCCAGGCAGCTTCAGATAGG + Intronic
1023472895 7:40544177-40544199 TCCACATGACAGCTTAACACAGG - Intronic
1024853275 7:53745742-53745764 TCCCCAAGGCACATTCACCAAGG + Intergenic
1026455809 7:70571694-70571716 TCCCCAAGGCTCCTCCACAGAGG - Intronic
1028400677 7:90422104-90422126 TCCCCAGAGCACCCTCACACAGG - Intronic
1029272303 7:99384575-99384597 TCCCCAAGGCTGGGTCACCCTGG + Intronic
1032267583 7:130380018-130380040 TCCCCAAGGCAGCTTCAGGCAGG - Intergenic
1032268719 7:130385375-130385397 TCCCCAAGGTGGCTTCGGACAGG + Intronic
1033266504 7:139891794-139891816 TCTCCAAGGAAACTTCAAACAGG + Intronic
1034142229 7:148831738-148831760 TCCCCAAAGCAGGTTCACCAAGG + Intronic
1034218108 7:149423033-149423055 TCCCTACGGCAGCGGCACACCGG - Intergenic
1035110207 7:156475556-156475578 TCCCCAAGGCAGCTGGTCACTGG + Intergenic
1036623813 8:10447611-10447633 TCCCCCAGGCAGCTTCATCCTGG - Intergenic
1036761680 8:11513843-11513865 ACCCCAAGCCCCCTTCACACAGG - Intronic
1036776541 8:11616860-11616882 ACCACAAGGCAGCTTCCCAGGGG - Intergenic
1037930896 8:22879676-22879698 TGCCCAGGGGTGCTTCACACCGG + Intronic
1041710264 8:60887979-60888001 TCCCCAAAGCACCATCACTCAGG - Intergenic
1043019709 8:74984894-74984916 TCTCCCAGGAAACTTCACACTGG + Exonic
1043832594 8:85007531-85007553 TCCCCATTGCATCTTCACATAGG - Intergenic
1045297375 8:100883831-100883853 TGCTCAAGGCTGCTCCACACCGG + Intergenic
1048031035 8:130632588-130632610 TCAACAAGGTATCTTCACACTGG - Intergenic
1048447198 8:134500168-134500190 CCCTCCAGGCAGCTTCACCCTGG - Intronic
1049487338 8:142873418-142873440 GGCCCAAGGCAGGTTCACGCAGG + Exonic
1049635445 8:143685857-143685879 TCCCCTAGGCAAATTAACACAGG - Intronic
1049844000 8:144791317-144791339 GCCGGAGGGCAGCTTCACACGGG + Exonic
1051735832 9:20198325-20198347 TGCCAGAGGCAGCTGCACACAGG + Intergenic
1057866501 9:98686084-98686106 TAGCTAAGACAGCTTCACACGGG - Intronic
1059392336 9:114007130-114007152 TCCCCAAGGCTGCTCATCACCGG + Intronic
1059412900 9:114144415-114144437 TCACCAAGGTAGCTTCAAACAGG - Intergenic
1061633081 9:131885918-131885940 CCCCCAAGGCAGGTTCCCAGAGG - Intronic
1062109624 9:134774801-134774823 TTCCCCAGGCACCTCCACACTGG + Intronic
1186846418 X:13535187-13535209 TCACCAAGGCAGCTTCCTAGAGG - Intergenic
1190492239 X:50993752-50993774 TCTCCAAGGCACCATCAGACAGG - Intergenic
1190889209 X:54554304-54554326 TCCACAAGCCCTCTTCACACTGG - Intronic
1201411450 Y:13703071-13703093 TCCCCAAGGCAGCTTTCCCGGGG - Intergenic
1202127987 Y:21585502-21585524 TCCCCATGGGAGTCTCACACAGG - Intergenic
1202151307 Y:21845997-21846019 TCCCCATGGGAGTCTCACACCGG + Intergenic
1202151935 Y:21851433-21851455 TCCCCATGGCTGTCTCACACAGG + Intergenic