ID: 1088246653

View in Genome Browser
Species Human (GRCh38)
Location 11:107825014-107825036
Sequence AAATAGCCATATATGGAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 482
Summary {0: 1, 1: 1, 2: 3, 3: 49, 4: 428}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088246653 Original CRISPR AAATAGCCATATATGGAGAA TGG Intronic
901900717 1:12359523-12359545 AAATAGCCACATATGGCTACTGG + Intronic
901941982 1:12669407-12669429 AAATAGACATATGTGGAAACTGG + Intergenic
903633499 1:24796072-24796094 AAATAGCCACATATGACTAATGG - Intronic
904923833 1:34030223-34030245 AAATAGCCATATGTGGCTGATGG + Intronic
905475415 1:38223617-38223639 AAATGGCCAGATATGGTGCAGGG + Intergenic
906013982 1:42556582-42556604 TAAAAACCACATATGGAGAATGG + Intronic
906076279 1:43054503-43054525 AAATAAATAAATATGGAGAAGGG - Intergenic
906263837 1:44413204-44413226 AAATAGCCTGATGTGGACAAGGG - Intronic
906349572 1:45046471-45046493 GAGTTGCCATATATGGAGACAGG + Intronic
906917679 1:50028973-50028995 TAATAGCCATATATGGCTAGTGG + Intergenic
906932676 1:50184916-50184938 AAATAGCCATATATTGCTAGTGG - Intronic
907783054 1:57584827-57584849 ACATAGCCATATCTTGACAAGGG - Intronic
908873987 1:68648678-68648700 AAAGGGTCATATATGGATAATGG + Intergenic
909173130 1:72319803-72319825 AAATAGCCACACATGGCGAGTGG + Intergenic
909726536 1:78842819-78842841 AAATAGCAAAGTATGAAGAAAGG - Intergenic
911261096 1:95686735-95686757 AAATACACATATGTGGATAAGGG + Intergenic
911627861 1:100146411-100146433 ACAAAGCCACATATGCAGAAAGG - Intronic
913429716 1:118777166-118777188 GAATGGCCATATGTGTAGAAAGG + Intergenic
913702853 1:121390295-121390317 AAATAGACATTTATGGAAAATGG + Exonic
913711229 1:121485733-121485755 ATATGGCCATATTTGGAGATAGG - Intergenic
914043416 1:144070799-144070821 AAATAGACATTTATGGAAAATGG + Intergenic
914134670 1:144889696-144889718 AAATAGACATTTATGGAAAATGG - Exonic
916078876 1:161219627-161219649 GAAAAGCCAAATATGCAGAACGG + Intronic
916120226 1:161522968-161522990 AAATAGCCATCTATGGAGTAAGG + Intronic
916129987 1:161604617-161604639 AAATAGCCACCTATGGAGTAAGG + Intronic
916336986 1:163684034-163684056 AAATTTCCATATATTCAGAAAGG - Intergenic
917156740 1:172009457-172009479 TAATAGCCACATGTGGATAAAGG - Intronic
917460656 1:175226250-175226272 AAGTGGCCATATATGCAGTATGG - Intergenic
918115566 1:181493747-181493769 AAATAGCCACATATGGCTAGTGG + Intronic
918333895 1:183488309-183488331 AAATAGCCATATGTGGCCAGTGG - Intronic
920490284 1:206409036-206409058 AAATAGACATTTATGGAAAATGG + Intronic
920923158 1:210315061-210315083 AGAAAGCCCTAGATGGAGAAAGG - Intergenic
921220627 1:212971186-212971208 AAATATCCATCGATGGATAAAGG - Intronic
921504192 1:215946679-215946701 CAATAGCCATATGTGGATAGGGG - Intronic
922134689 1:222813614-222813636 ACATTGCAATATATGGAGATAGG - Intergenic
923313945 1:232761093-232761115 ACATAGCCAGATATGGGGAAAGG - Intergenic
923804067 1:237239102-237239124 AAATATGCATATATAGAGATGGG - Intronic
1067933301 10:50585304-50585326 AGGTAGCCATGTCTGGAGAAGGG - Intronic
1068171464 10:53400399-53400421 CAATAGCCATATGTGGCTAATGG + Intergenic
1068242664 10:54324376-54324398 AAATAGCAAAATCTAGAGAAGGG - Intronic
1068302739 10:55165892-55165914 AAATAGAAATTTATGGAAAAAGG - Intronic
1068417351 10:56741161-56741183 GCATAACCACATATGGAGAAGGG - Intergenic
1069170340 10:65220036-65220058 TAATAGCCATATAGGGAGTTCGG + Intergenic
1069184213 10:65402526-65402548 AGATACCCATATATACAGAATGG + Intergenic
1070694861 10:78554669-78554691 AAATAGCCATATGTGGCTAGTGG - Intergenic
1071932681 10:90490506-90490528 AAATAGCCAGAAAAGGAGACAGG + Intergenic
1071947088 10:90657729-90657751 AAATAGTTATCTATGGATAAAGG + Intergenic
1071972320 10:90920873-90920895 AAAATGTCATATATGGAAAAAGG - Intronic
1072353642 10:94583959-94583981 AAATAGCCAGAAATGGGCAAAGG - Intronic
1072994943 10:100235007-100235029 AAATAGCCATACCTGGCTAATGG - Intronic
1073225507 10:101915031-101915053 AAATAGCCATCTATGTCAAATGG - Intronic
1074183341 10:111081830-111081852 GAATAGCCACTTATGGAGGAGGG + Intergenic
1074244842 10:111679053-111679075 AAAAAGCAATATATGCAGTAAGG + Intergenic
1075929192 10:126280372-126280394 AAATAGCCATATGCGGCTAATGG - Intronic
1075959245 10:126553222-126553244 ATCAAGCCATAAATGGAGAAAGG + Intronic
1078048652 11:7942019-7942041 AAATAGGCACAAATGCAGAAGGG + Intergenic
1078309410 11:10224656-10224678 AACCAGCCATGTATGCAGAAAGG - Intronic
1078496302 11:11820664-11820686 AAATAGCCAAATGGGGAGATGGG - Intergenic
1079154530 11:17932598-17932620 AAGGAGCCATAGAAGGAGAAAGG + Intronic
1079424504 11:20327260-20327282 AAATGGACCTATACGGAGAAAGG - Intergenic
1079634692 11:22721599-22721621 AAATAGCCACATGTGGATAGTGG - Intronic
1080467100 11:32507877-32507899 AATGAGCCATTTTTGGAGAATGG - Intergenic
1080655520 11:34254993-34255015 AAATAGCCACATATGGTTAGTGG + Intronic
1080889292 11:36395453-36395475 CAATAGCCATATATGGCTAGTGG + Intronic
1081229967 11:40574258-40574280 AAACAGCCATAATTGGAGGAAGG - Intronic
1081824362 11:46033670-46033692 CAATAGCCATATATGGCTAGTGG - Intronic
1083078293 11:60064743-60064765 AAATAGCTATCCATGGAGGAGGG - Intronic
1084409630 11:68999149-68999171 ATGTAACCATATTTGGAGAAAGG + Intergenic
1085875478 11:80402243-80402265 GATTACCCACATATGGAGAACGG - Intergenic
1086559433 11:88150221-88150243 AAATAGCCATATGTGGCTACTGG - Intronic
1086748382 11:90458693-90458715 AAATTGAAATATTTGGAGAATGG - Intergenic
1086912855 11:92493161-92493183 AAATATTCATTTCTGGAGAATGG - Intronic
1087266955 11:96071125-96071147 ATTTAGGCATATATGCAGAATGG + Intronic
1087593787 11:100227541-100227563 AAAAAGCAATCTTTGGAGAAAGG - Intronic
1087743932 11:101921233-101921255 AAATAGCAATATAACTAGAATGG - Intronic
1088246653 11:107825014-107825036 AAATAGCCATATATGGAGAATGG + Intronic
1088546834 11:110967671-110967693 AAGTAGCCAAAAATGCAGAAAGG - Intergenic
1089909965 11:122088205-122088227 AAATAGCCACATATGATGAGTGG + Intergenic
1089927439 11:122273264-122273286 AAACAGACAGAAATGGAGAATGG - Intergenic
1090102440 11:123813898-123813920 AAATATATATATATGCAGAAAGG - Intergenic
1090341545 11:126025901-126025923 AATTGGCCATATCTGGAGAATGG - Intronic
1095586341 12:43853874-43853896 AAATAGTCAGATATGATGAAAGG + Intronic
1095783036 12:46081642-46081664 AAATGGCTATATATGGGGGAGGG - Intergenic
1096605568 12:52763163-52763185 AAATAAACATATATGTAAAAAGG + Intergenic
1097456129 12:59800883-59800905 AACTAGCCATATACAGAAAATGG + Intergenic
1098165091 12:67688046-67688068 TGATAATCATATATGGAGAATGG - Intergenic
1098391569 12:69974952-69974974 AAATAGCTATCAATGGAGAGTGG - Intergenic
1098423864 12:70336568-70336590 AAATAACAGTATATGAAGAAGGG + Intronic
1099923294 12:88985585-88985607 AATTAGCCAGGTATGGTGAAAGG + Intergenic
1100332049 12:93592267-93592289 AAATAGATATATAGAGAGAAAGG - Intergenic
1100580317 12:95932931-95932953 ACATATCCATACATGGGGAAAGG + Intronic
1100952958 12:99873039-99873061 CAATTTCCATATCTGGAGAATGG + Intronic
1101901104 12:108791895-108791917 GAATAGTCATATATCGATAAAGG + Intronic
1102398485 12:112608262-112608284 AAATAGCCAGATGTGGTGACGGG - Intronic
1102761189 12:115386833-115386855 AAATAGCCATATGTGGCTAGTGG + Intergenic
1103525793 12:121567316-121567338 ATGTAGCCATATTTGGAGATAGG + Intronic
1106526517 13:30545608-30545630 AAATAGCCACATATGGCTAGTGG - Intronic
1106568184 13:30905136-30905158 AAAGATCCATGTCTGGAGAAAGG + Intergenic
1108272917 13:48780341-48780363 AAGTAGCCAGATTTAGAGAAAGG - Intergenic
1108495370 13:51019387-51019409 AAAAAGGCATTTTTGGAGAATGG - Intergenic
1108830233 13:54468660-54468682 ATGGAGGCATATATGGAGAAAGG + Intergenic
1108935893 13:55879381-55879403 AAATAGCCAGAGATGGATAAAGG - Intergenic
1109206547 13:59489101-59489123 AAAGAGTCAAATATGTAGAAAGG - Intergenic
1109213982 13:59566409-59566431 AAATAGCCACATGTGGACAATGG - Intergenic
1109261316 13:60148338-60148360 AAATAGCCATATGTGGCTAATGG - Intronic
1109582046 13:64352956-64352978 AAATAAACATATATAGAGAGAGG - Intergenic
1109825510 13:67715854-67715876 AAAGTCACATATATGGAGAATGG + Intergenic
1110092142 13:71466240-71466262 AAATAGTGATATATGGAAACTGG - Intronic
1110154483 13:72297916-72297938 GTAGAGCCATAGATGGAGAAGGG - Intergenic
1113630891 13:111883015-111883037 AAATAGTCATAAATGCAGAGAGG - Intergenic
1114376672 14:22153746-22153768 AAATAAGCACATATGGAGAATGG - Intergenic
1114585893 14:23813352-23813374 AAGAAGCTGTATATGGAGAAAGG - Intergenic
1114840336 14:26255710-26255732 GAATAGCCAGTTCTGGAGAATGG - Intergenic
1115666537 14:35555376-35555398 AAGTGGCCATTTATAGAGAAGGG + Intronic
1115935775 14:38550678-38550700 AAATAGCCATATGTAGCTAATGG + Intergenic
1116538231 14:46063381-46063403 AAATGGACATACATTGAGAATGG - Intergenic
1116565043 14:46433793-46433815 ATATAGACATATATGGATATAGG - Intergenic
1116689843 14:48091548-48091570 AAATAGCTCTAAATGTAGAAAGG + Intergenic
1116693662 14:48144427-48144449 ACATAGCCATGCATGGAGTAAGG + Intergenic
1117097131 14:52310397-52310419 AAATAGCCAGATGTGGCTAATGG + Intergenic
1117618750 14:57562169-57562191 AAGTAGCCAAATATGGCGATTGG - Intergenic
1117982941 14:61359745-61359767 AAATAGCCACATATGGCTAGTGG - Intronic
1118140015 14:63070647-63070669 AAATAGCACTATATGTAGAATGG - Intronic
1119010897 14:70987387-70987409 AAATAGCCACATATGGCTAATGG + Intronic
1119995795 14:79252499-79252521 AGAAAGCCATATATGCAAAATGG - Intronic
1121208963 14:92192185-92192207 AATTAGCCATATATGGTGGCGGG - Intergenic
1121672945 14:95726900-95726922 CAATAGCCACATATGGACAATGG - Intergenic
1121756022 14:96402788-96402810 ATATGGCCATATTTGGAGATAGG + Intronic
1122333379 14:100945169-100945191 AAATAGCCACATGTGGATAGAGG - Intergenic
1124395197 15:29294619-29294641 AAACAGCCATATATAAACAAGGG + Intronic
1125250201 15:37692793-37692815 AAATAGCCACATTAGAAGAAAGG + Intergenic
1126233078 15:46350469-46350491 AAATAGCCAAATGTCGAAAATGG + Intergenic
1126302438 15:47213091-47213113 AAATAGCCATACATGGCTAATGG - Intronic
1126314989 15:47360687-47360709 GAATTGCCATATGAGGAGAATGG - Intronic
1128726049 15:69989380-69989402 AGATATACATATATGGAGGAAGG + Intergenic
1129316353 15:74747596-74747618 AAATAAGCATTCATGGAGAATGG + Intergenic
1130248513 15:82277461-82277483 AAATAGCCCTATATCTATAAAGG + Intronic
1130552712 15:84901356-84901378 AATTAGCCAGATATGGTGACGGG + Intronic
1131266249 15:90917104-90917126 AAATAGCCATATAGGGCTACTGG - Intronic
1131377316 15:91936330-91936352 AAATAGCCATATGTGGTTAGTGG - Intronic
1133894172 16:9909546-9909568 AAATAGCCACATATGGCTAGTGG + Intronic
1135115540 16:19719995-19720017 AAATAGCCACATTTGGATAGTGG + Intronic
1135582291 16:23639205-23639227 AAAAAGGCATGTATGGAGGATGG - Intronic
1136109155 16:28053796-28053818 AAACAGACAGAGATGGAGAAAGG - Intronic
1139056856 16:63196130-63196152 AAATACCCACATATACAGAAAGG + Intergenic
1140323655 16:73978598-73978620 AAACAGCCATATGTGGCTAATGG + Intergenic
1140771043 16:78204347-78204369 AAATAATCACATATGAAGAATGG + Intronic
1140837384 16:78807785-78807807 AAATAGCCACATGTGGCTAATGG - Intronic
1143711236 17:8736634-8736656 AAAGAGGCATATTTGGGGAAAGG - Intronic
1145723833 17:27098533-27098555 AAATAGAAATTTATGGAAAAAGG + Intergenic
1148168279 17:45499377-45499399 AAATAGCCATATGTGGCTAGTGG + Intergenic
1148280535 17:46343574-46343596 AAATAGCCATATGTGGCTAGTGG - Intronic
1148302763 17:46561509-46561531 AAATAGCCATATGTGGCTAGTGG - Intronic
1148366854 17:47061841-47061863 AAATAGCCATATGTGGCTAGTGG - Intergenic
1149000419 17:51751837-51751859 ACAGAGCCATGTATGCAGAAGGG - Intronic
1149079640 17:52638805-52638827 ATATACCCATATATGCTGAAGGG - Intergenic
1149180981 17:53935974-53935996 TAATTGCAATATATGAAGAACGG + Intergenic
1149704953 17:58686581-58686603 GAAAAGCCAAATATGTAGAAAGG + Intronic
1150242919 17:63649742-63649764 AAATAGTCATATGTGGCTAATGG + Intronic
1150399467 17:64845803-64845825 AAATAGCCATATGTGGCTAGTGG + Intergenic
1150933209 17:69607712-69607734 AAATAGGCATTAATGGAAAAGGG - Intergenic
1152503556 17:80730253-80730275 AATTAGCCAGACATGGTGAAGGG - Intronic
1153545335 18:6199306-6199328 AAATAGCCACATATGGGCAGTGG - Intronic
1154086922 18:11314454-11314476 AAATACTCAGAGATGGAGAAGGG + Intergenic
1154929110 18:20973778-20973800 AAAGTGCCAAATATTGAGAAAGG - Intronic
1156113474 18:33757147-33757169 AAACTCCTATATATGGAGAATGG + Intergenic
1156123371 18:33872751-33872773 CAATAGCCACATATGGATAGTGG + Intronic
1156242744 18:35269191-35269213 ACATAGCCATAAATGGCTAATGG - Intronic
1158287723 18:55903360-55903382 AAATAGCCTCATATGGCTAATGG + Intergenic
1158333320 18:56386932-56386954 AAATAGCCTTATATGAGGAAAGG + Intergenic
1159062829 18:63533812-63533834 AAATAAACATATTTGGAGAAGGG + Intergenic
1160474856 18:79173580-79173602 CAAAAGCAATTTATGGAGAATGG - Intronic
1160625105 18:80198735-80198757 AAGTATTCACATATGGAGAATGG + Intronic
1163812593 19:19443091-19443113 AAATAGCCACATGTGGCTAATGG + Intronic
1165225472 19:34351771-34351793 ACATAGCCACATGTGGTGAATGG - Intronic
1165692841 19:37877024-37877046 AAATTGCCATTTGTTGAGAATGG + Intergenic
1165957714 19:39512123-39512145 AAAGAGCCTGAGATGGAGAATGG - Intergenic
1166802595 19:45467715-45467737 AATTAGCCATATAAGGAGCTCGG - Intronic
1167438582 19:49494879-49494901 AAATAGCCACATGTGGCTAAAGG - Intergenic
1168544381 19:57238640-57238662 AAATGAGCATAGATGGAGAAAGG - Intergenic
925717195 2:6795321-6795343 AAATAGAACTATATGAAGAAAGG + Intergenic
926012039 2:9416178-9416200 AAATAGGCATAAATGAGGAAGGG - Intronic
926666665 2:15531899-15531921 AAATAATCAGAGATGGAGAATGG - Intronic
928145284 2:28768678-28768700 AAACAGCCTTCTTTGGAGAAAGG + Intronic
929111649 2:38409989-38410011 AAAGAGCCAGAGAGGGAGAAGGG + Intergenic
929179389 2:39018627-39018649 AAATAGGCACATAAGGAAAAAGG - Intronic
930057230 2:47261361-47261383 AAATTGCCATATATGGCTAGTGG - Intergenic
930715167 2:54587330-54587352 TAATTGCAACATATGGAGAAGGG - Intronic
931617854 2:64179367-64179389 AAATAGTCATATATGGCTAGTGG + Intergenic
932179866 2:69637015-69637037 AAATAGCCATATGTGGCTAGTGG + Intronic
932256790 2:70294549-70294571 AAATATACATATATAGAGAGAGG - Intergenic
932530466 2:72524817-72524839 AAAAAACTGTATATGGAGAAAGG + Intronic
932967828 2:76498670-76498692 AAAAAGCTTGATATGGAGAAAGG - Intergenic
933343112 2:81048078-81048100 AAATAGACATGGCTGGAGAATGG + Intergenic
935554720 2:104496762-104496784 AAATAGACACAGATAGAGAAGGG - Intergenic
936951448 2:117981808-117981830 CAATAGCCACATATGGATAGTGG + Intronic
937724943 2:125152146-125152168 AAATAGCAAAATATGGATACAGG - Intergenic
938584908 2:132680679-132680701 ACATCCCCATATATGGAAAACGG + Intronic
939518066 2:143193753-143193775 AAATAGTGATATATGAAGAAAGG + Intronic
940406638 2:153311346-153311368 AAATATCCAAATATGAAGAAAGG + Intergenic
940811302 2:158245702-158245724 AAAGAGCCACATCTAGAGAAAGG + Intronic
940858006 2:158744857-158744879 AAATAGCCACATATGGCCAGTGG + Intergenic
941398994 2:165007607-165007629 CACCAGTCATATATGGAGAATGG + Intergenic
941664837 2:168234385-168234407 AAATAGCCACATATGGTTAGTGG + Intronic
942059233 2:172212636-172212658 AAATAGCAAGGTATGGGGAAAGG + Intergenic
942090086 2:172481320-172481342 AAATAGCCACATAAGGACTAGGG + Intronic
942575254 2:177356377-177356399 AAATAGCTATATGTGGATAATGG - Intronic
943120649 2:183730785-183730807 AAATAGTCATCAATGGAAAATGG + Intergenic
943601632 2:189927789-189927811 AAATAGCCACATATGGCTAGTGG - Intronic
944054101 2:195504918-195504940 AAATAGCCATGTATGGCTAGTGG + Intergenic
944161567 2:196666412-196666434 GAATAGCCATATGTGGCTAATGG - Intronic
944457757 2:199912429-199912451 AGATAGCCATATATGGCTAATGG - Intronic
944655630 2:201874137-201874159 AAATAGCCACATGTGGCTAATGG - Intronic
945606424 2:211938460-211938482 AAACAGCCATATTTGGCTAATGG - Intronic
946614612 2:221496290-221496312 CAATAGCCATATATGGCTAGTGG - Intronic
947409142 2:229816487-229816509 AAATAGCCATTTTTGGTGAAAGG - Intronic
947898209 2:233694992-233695014 AAATAGCTAGAAATGAAGAATGG - Intronic
948617694 2:239211967-239211989 AAATAGTCAGCTAAGGAGAATGG - Intronic
1169930781 20:10830636-10830658 AAATATCCATACATGGATGAAGG + Intergenic
1171339142 20:24413361-24413383 AAATAGGCATTTATGGAGCAGGG - Intergenic
1171723492 20:28592011-28592033 ACAAAGTGATATATGGAGAACGG + Intergenic
1171754564 20:29091056-29091078 ACAAAGTGATATATGGAGAACGG - Intergenic
1171855850 20:30342385-30342407 ATATATACATATATGGAAAAGGG - Intergenic
1171859850 20:30387917-30387939 ACAAAGTGATATATGGAGAACGG - Intronic
1172641852 20:36445176-36445198 AAATAGCCATACATGGCTCATGG + Intronic
1173392368 20:42646527-42646549 AAATATCCACATATGGCCAATGG - Intronic
1173691509 20:44964795-44964817 CAATAGCCATATGTGGCTAATGG + Intergenic
1174126997 20:48313972-48313994 AAAAAGCCAGATGTGGAGAATGG - Intergenic
1174561045 20:51431079-51431101 AAATAAGCACATATAGAGAATGG - Intronic
1174620538 20:51871152-51871174 AAATAGCCACATATGGCTAGTGG - Intergenic
1174765749 20:53252513-53252535 AAATATCCATCAATGGAGATGGG - Intronic
1174884565 20:54318341-54318363 AAATAGCCATAGATGAAAAATGG - Intergenic
1177614881 21:23503884-23503906 AAATAGACCTATATGGGAAAGGG + Intergenic
1177646532 21:23905834-23905856 AAATGGTAATTTATGGAGAAAGG - Intergenic
1178219706 21:30642474-30642496 AAATATGCATATAAGAAGAAGGG + Intergenic
1178575401 21:33784072-33784094 AAATAAGCATATTTGGAAAAAGG - Intronic
1179812026 21:43877910-43877932 AAGGAGCCATAGATGGGGAAGGG - Intronic
1180297054 22:10950693-10950715 ACAAAGTGATATATGGAGAACGG + Intergenic
1180590343 22:16931950-16931972 AATTAGCCTTATATGGCAAAAGG - Intergenic
1180651079 22:17377693-17377715 AAATATGCAAATATGGAGGAAGG - Intronic
951274212 3:20665411-20665433 AAATAGTGAGAGATGGAGAAAGG - Intergenic
951467315 3:23015558-23015580 AAGTAACTATATATGGACAATGG + Intergenic
951645915 3:24891206-24891228 AAATAGGAATATATGTAGAAAGG - Intergenic
951959743 3:28304095-28304117 AAATAGCCATGTATGTCTAATGG - Intronic
952513151 3:34077092-34077114 AATTAACCATCTATGGACAATGG + Intergenic
952723323 3:36556071-36556093 AAAAAGCCAGCTAAGGAGAATGG + Intergenic
953250479 3:41242151-41242173 AAATATCCACAGATGGAGCAAGG + Intronic
954822628 3:53344093-53344115 AAATTGGCATCAATGGAGAAAGG + Intronic
955293955 3:57718431-57718453 AAATAGCCAAATGTGGCTAATGG - Intergenic
955427277 3:58805231-58805253 AAATGGCCATATGTGGACTATGG + Intronic
955883918 3:63577404-63577426 CAATAGCTATATATGAAGAAAGG + Intronic
956058436 3:65325317-65325339 AAATAGCCATATGTGGCTAGTGG - Intergenic
956109472 3:65856159-65856181 AAATAGTCACATATGGCTAATGG + Intronic
956608100 3:71093382-71093404 AAATAGCCATATGTGGCCAGTGG - Intronic
956904348 3:73750261-73750283 ACAAAGCCATATTTGTAGAATGG + Intergenic
957369037 3:79267063-79267085 AAATATCCACATATGGATAGTGG - Intronic
957755423 3:84478665-84478687 AATTTTCCAAATATGGAGAAAGG + Intergenic
958640829 3:96801870-96801892 TAAAAACCATATATGCAGAAAGG - Intergenic
959174407 3:102887872-102887894 AAATAGCTAAATATTGGGAATGG - Intergenic
961161779 3:124732622-124732644 AAATAGTCATATATGGCCAGTGG + Intronic
961501961 3:127342641-127342663 AAAGACCCATATTGGGAGAAAGG + Intergenic
961843718 3:129741337-129741359 AAACAGCCATACAGGTAGAAGGG - Intronic
961919284 3:130409009-130409031 TAATAGCCACATATGGCTAATGG + Intronic
962144970 3:132831099-132831121 AAATAGTCATATGTGGCCAATGG - Intergenic
963027218 3:140931827-140931849 AAAGAGCCATCAATTGAGAATGG + Intergenic
963645296 3:147906056-147906078 AAATATCCATATATAAAGAAAGG + Intergenic
963707798 3:148709960-148709982 AAATAGCCACATATAGTAAATGG - Intronic
965849245 3:173002757-173002779 ACATATTCATATATGGAAAATGG + Intronic
966030085 3:175335178-175335200 AAATAGCCATATATGGCTAGTGG - Intronic
966337037 3:178879992-178880014 AAATAGCCATATTTGGTTAATGG + Intergenic
969076281 4:4580745-4580767 AAATAGCCAGATCTGGAGTCAGG - Intergenic
970349827 4:15191331-15191353 AGATAGTCCTATATGGGGAATGG - Intergenic
971108242 4:23551288-23551310 AAATAGACATTTTTGGACAAAGG + Intergenic
971745932 4:30580966-30580988 AAATAGCCAAAAAAGGAGATTGG - Intergenic
971875839 4:32307492-32307514 TAAAATACATATATGGAGAAGGG + Intergenic
973007144 4:45025326-45025348 ATATATCTATATATAGAGAAAGG - Intergenic
973199131 4:47479793-47479815 AATTAGCCATATATGGTGGTGGG - Intergenic
973203067 4:47527186-47527208 AAAGACACATAGATGGAGAAAGG + Intronic
973205957 4:47560383-47560405 AAATAACCATCAAAGGAGAATGG + Intronic
973325215 4:48853634-48853656 AAATAGCCACATATGGCTAGCGG - Intronic
973594723 4:52475712-52475734 AAATAGACATATATGGCCAATGG + Intergenic
975032009 4:69632737-69632759 AATTAGCCAGACATGGTGAAGGG + Intronic
976132781 4:81902716-81902738 ACATACCCTTACATGGAGAAAGG - Intronic
976164842 4:82243545-82243567 AAATGTCCATATATGGGGACTGG + Intergenic
976493657 4:85700529-85700551 AAATTGCCATCAATGGAGATAGG + Intronic
978136299 4:105265304-105265326 AAACAGCCACATGTGGATAATGG + Intronic
978461024 4:108952113-108952135 AGATTGCCATATATTGAGACAGG - Intronic
979207312 4:118054451-118054473 AGATTTCCATATATGGAAAAAGG - Exonic
979289276 4:118961885-118961907 AAAGAGCCATATACTGAAAATGG - Intronic
979317402 4:119280501-119280523 AAATAGGCATAAAAAGAGAATGG + Intronic
979866991 4:125768541-125768563 AAATAGCCAGATATGGTGGCAGG + Intergenic
980040648 4:127935831-127935853 AAATAGCCACATGTGGCTAATGG + Intronic
980520741 4:133930342-133930364 AAATAGCCACATATGGCTAGTGG - Intergenic
980944676 4:139307650-139307672 AAATAGTCACATGTGGTGAATGG + Intronic
982152967 4:152483371-152483393 AAAGAGCCATATATCTAAAAAGG - Intronic
982270666 4:153583227-153583249 AAACAGCCTTATATGGATACAGG + Exonic
983282988 4:165704839-165704861 CAATAGCCATATATGGCCAATGG - Intergenic
983288170 4:165765819-165765841 AAATAGGGATAGATGGAGAGAGG + Intergenic
983307387 4:166008756-166008778 AAATGGGCATAAATGGAAAAAGG - Intronic
984521317 4:180804930-180804952 AAATAGACATTAATGGAGACAGG + Intergenic
985944416 5:3166215-3166237 AAATAGAAAAATATGGAAAAGGG - Intergenic
986410134 5:7470408-7470430 AAAAAGCCATCTATGAAAAAAGG - Intronic
987022503 5:13889416-13889438 AACCTGCCATATATGCAGAAAGG + Intronic
987160288 5:15134498-15134520 AAATAGCCATATGTAGTGAGTGG + Intergenic
987859895 5:23471160-23471182 ACATAGCAAGAGATGGAGAAAGG + Intergenic
989564420 5:42887593-42887615 AAATAGCCACATATGGCTAGGGG - Intergenic
990270212 5:54129129-54129151 AAACAGTCATATATGTTGAAAGG - Intronic
990294698 5:54389146-54389168 AAATAGCCAGATGTGGCTAATGG + Intergenic
990550773 5:56876098-56876120 AAAGAGACATATACGCAGAATGG - Intronic
990686864 5:58313770-58313792 CAATAGCCACATGTGGATAATGG - Intergenic
991349022 5:65701600-65701622 AAATAGCCACATATGGCTTATGG - Intronic
991618390 5:68519695-68519717 AAATAGCCATCTATGGCTAGTGG - Intergenic
992079443 5:73220344-73220366 CAATGGCCATGTATGGTGAAAGG + Intergenic
992407464 5:76473301-76473323 ATATAGCCATATATAGCCAATGG - Intronic
993147282 5:84111510-84111532 AAAGTGCCAAATATGTAGAAGGG - Intronic
993492728 5:88571432-88571454 AAATATCCATAGGTGGAGAAGGG + Intergenic
993941246 5:94061802-94061824 AAATAGACATATCAGGTGAATGG + Intronic
994384563 5:99114662-99114684 AAATAGCCACATGTGGCTAATGG + Intergenic
995115257 5:108471728-108471750 AAAGAGACAGATCTGGAGAAGGG - Intergenic
996939182 5:128983439-128983461 AAATAGCCAGGTATGGTGATGGG - Intronic
997216098 5:132112114-132112136 AAATAGCCATATATGGCTAATGG + Intergenic
997254076 5:132413785-132413807 AAATGCCCATAAATGGAAAATGG - Intronic
998027676 5:138833340-138833362 CAATAGCCACATATGGTGAGTGG - Intronic
998487267 5:142513625-142513647 AAACAGCTATAGATAGAGAATGG - Intergenic
998818897 5:146040805-146040827 AAATAGGCGTAGATAGAGAAGGG + Intronic
998830763 5:146155916-146155938 AAATATCCATTAATAGAGAATGG + Intronic
999220905 5:149976646-149976668 AAATAGCCAGAAAAAGAGAAAGG - Intronic
999985614 5:157002257-157002279 AAATAGCCATATATGGCTACTGG + Intergenic
1000141982 5:158414198-158414220 AAATAGCCACATATGGCTAGGGG - Intergenic
1001534028 5:172486058-172486080 AAAGAGCCATTTATGGAGACTGG - Intergenic
1002670587 5:180863025-180863047 AAATAGCCACATGTGGCTAATGG + Intergenic
1003484839 6:6566717-6566739 TAATAGCCATATATGGTGACTGG + Intergenic
1004665717 6:17746807-17746829 TAGTAGACATATATGCAGAATGG + Intergenic
1005594976 6:27370314-27370336 AAATAGCTACATGTGGGGAATGG - Intergenic
1005655689 6:27934543-27934565 ATATGACCATATAAGGAGAAAGG + Intergenic
1007058088 6:38908499-38908521 AAGTAGCCATATATGCCTAATGG - Intronic
1007336822 6:41160410-41160432 AAAGAGCCATACTGGGAGAAGGG + Intronic
1007540314 6:42636608-42636630 AAATTGCTCTGTATGGAGAATGG + Intronic
1007927033 6:45658107-45658129 AGAAGGCCATTTATGGAGAAGGG + Intronic
1008223967 6:48888883-48888905 AAATAGCCATATGTGACTAAGGG - Intergenic
1008701150 6:54101906-54101928 ATACAGCCATATTTTGAGAATGG + Intronic
1009324670 6:62336344-62336366 AAATAGACAGACATGGAGGATGG + Intergenic
1009434103 6:63598660-63598682 AAATTGCCATCTCTGGGGAAAGG + Intergenic
1009611272 6:65944522-65944544 AAATAGCCATATATGGCTAGTGG - Intergenic
1009680582 6:66886994-66887016 AAATAGCCAGACATGGTGATGGG - Intergenic
1009742889 6:67770387-67770409 AAATAGCCATATGTGGTGGTGGG - Intergenic
1010004884 6:70985049-70985071 AATTAGGCATTTAAGGAGAATGG - Intergenic
1010055975 6:71564029-71564051 AAATAGCCATAGACTGAGCACGG + Intergenic
1010673711 6:78717283-78717305 AAATGGTCATAAATGGACAAAGG - Intergenic
1011257793 6:85441762-85441784 AAACAGCCAAATAAGGAGACAGG + Intergenic
1011772561 6:90691192-90691214 AAATAGCCACATGTGGTTAATGG - Intergenic
1012067623 6:94568690-94568712 TAGGAGCCATATGTGGAGAACGG + Intergenic
1012154992 6:95808163-95808185 AAAGAGCAATAAATAGAGAAAGG - Intergenic
1012345634 6:98182000-98182022 ATATTGCCATATATGTATAATGG - Intergenic
1012611236 6:101223404-101223426 AATTAGCCAGGTATGGTGAAGGG - Intergenic
1013448684 6:110257453-110257475 CAATAGCCATATATGGCTAGTGG + Intronic
1013818686 6:114130123-114130145 AAATAGCCAAATATGGCTAGTGG - Intronic
1015231161 6:130916516-130916538 AAATGTCCATATTTGGGGAACGG + Intronic
1016693777 6:146968814-146968836 AAATAGCCACAGTTTGAGAATGG + Intergenic
1016798900 6:148148156-148148178 ATAGAGCCATTTATGGAGATTGG + Intergenic
1017033409 6:150244693-150244715 AAATAGCCACATATGGTTAGTGG + Intronic
1017436711 6:154422300-154422322 AAATAGTCATATATGGTTACTGG + Intronic
1017549109 6:155485612-155485634 CAGTAGCCATTTATGGAAAATGG + Intergenic
1018217297 6:161541273-161541295 AAATAGCCATATGTGGCTAAAGG + Intronic
1019955516 7:4411245-4411267 AAATAGCCATACATGGCCAATGG + Intergenic
1020505292 7:8979297-8979319 AGATAGACAAAGATGGAGAATGG + Intergenic
1020515841 7:9117954-9117976 AAATAGGCATATAATGAAAATGG - Intergenic
1020666504 7:11050524-11050546 AAATAGCCATATGTGGCTAGTGG - Intronic
1020857517 7:13448627-13448649 GGATAGCCATTTATGGAAAATGG + Intergenic
1021105457 7:16634137-16634159 AAATAGCCATATGTGGCTAGTGG - Intronic
1022000345 7:26220045-26220067 AAATTGACATATAAGGAAAAAGG - Intergenic
1022172931 7:27846888-27846910 AAATAGCAATCTATGGATTAGGG - Intronic
1022180189 7:27911579-27911601 AAGTAGCCACATATGGCTAAGGG + Intronic
1022536082 7:31099445-31099467 AAATAGCCACATATGGGTAGTGG + Intronic
1022543522 7:31162339-31162361 AAACATCCATTTATGTAGAATGG - Intergenic
1022579461 7:31535134-31535156 AAATAGCCATATATGGGTAGTGG + Intronic
1022838798 7:34142930-34142952 CAGTAGCCAAATATGGAGAGTGG + Intronic
1022897925 7:34771519-34771541 GAATAGCCCTATAAGTAGAAGGG + Intronic
1024168573 7:46759979-46760001 AAATACCCATTTATGGAGAATGG - Intergenic
1024535219 7:50424988-50425010 AAATAGCCATACGTGGATAGCGG + Intergenic
1024748865 7:52439642-52439664 AAATAGCAAAATAGGGAAAAAGG - Intergenic
1027943050 7:84709145-84709167 AAATAGCCATATATGAATAGTGG - Intergenic
1028726891 7:94097945-94097967 AAAAAGGCATATATGTAGAAAGG + Intergenic
1028795809 7:94902072-94902094 AAACATCCATATTTAGAGAAAGG - Intergenic
1029310780 7:99661852-99661874 AAATAGCCACATGTGGATAGTGG - Intronic
1029743415 7:102503748-102503770 AAAGACCCATCTATGGAGAAAGG - Intronic
1029761404 7:102602909-102602931 AAAGACCCATCTATGGAGAAAGG - Intronic
1029778276 7:102702465-102702487 AAATACCCATATATGAGGAGAGG - Intergenic
1029928930 7:104350146-104350168 AAATAGCCACATGTGGTGACAGG - Intronic
1029937385 7:104441468-104441490 AAATATCCATTAATGGATAATGG - Intronic
1030172290 7:106615610-106615632 AAATGGCCAGATCTGGGGAAAGG + Intergenic
1030733898 7:113021267-113021289 AAATAAGCACATATGGAGAATGG + Intergenic
1030750926 7:113231892-113231914 CAATATCCATATTTAGAGAAGGG + Intergenic
1031267816 7:119604121-119604143 TAATTTCCATATATGGTGAAAGG - Intergenic
1031268129 7:119608269-119608291 AAATAGCCATATATAGCTAATGG + Intergenic
1031823122 7:126529310-126529332 GAATAGGCATTTATTGAGAATGG + Intronic
1032261856 7:130344619-130344641 AAATAGCCACATGTGGCTAATGG - Intergenic
1034000815 7:147410643-147410665 AAATAGCCACATATGGCTAGTGG - Intronic
1034234499 7:149556147-149556169 AAATAGCCATGCACTGAGAATGG + Intergenic
1035956916 8:4090829-4090851 AAATAGAAATATTTGGCGAAGGG + Intronic
1035993102 8:4514326-4514348 GTATAGCCGTATATGGAGAGAGG - Intronic
1036032634 8:4991261-4991283 AAATAGGCATTTAAAGAGAAAGG + Intronic
1036944816 8:13085171-13085193 AAATACCCATAAATGGACAAGGG + Exonic
1037289930 8:17339643-17339665 AAATGTTCATAAATGGAGAATGG - Intronic
1038062132 8:23925397-23925419 AAATAGCCAGGCATGGAGACGGG - Intergenic
1038355165 8:26822464-26822486 AAATAGCCATACATGGCTAGTGG + Intronic
1039133704 8:34296741-34296763 AAATAGCCACATGTGGCTAATGG - Intergenic
1039595330 8:38786543-38786565 AAATAAATAAATATGGAGAATGG + Intronic
1039849300 8:41348493-41348515 AAATAGCCTTATATTGATAGAGG - Intergenic
1041366118 8:57107065-57107087 AAATAGTCTTATATAGAAAAAGG - Intergenic
1041501555 8:58544255-58544277 AAATAGCCATGTTGGGAAAAAGG - Intergenic
1041640345 8:60193014-60193036 ATATAGCCATATTTGGAGGATGG - Intronic
1042299158 8:67257606-67257628 AAATACCCAAATATGGTGACTGG + Intronic
1042991670 8:74647139-74647161 ATATATGCATATATGCAGAAAGG - Intronic
1043815504 8:84796013-84796035 AAGTAGCCACAGCTGGAGAAGGG + Intronic
1044229278 8:89756915-89756937 AAATAGTCATCTAAGTAGAAAGG + Intergenic
1044842523 8:96349178-96349200 AAAAACCCATACATGGGGAATGG - Intergenic
1044849652 8:96416176-96416198 AAATATCCATCAATAGAGAAAGG + Intergenic
1044966930 8:97582824-97582846 AAATAGCCACATGTGGTTAATGG - Intergenic
1045666234 8:104488647-104488669 AAATAACCATATATGTACATAGG - Intergenic
1046288040 8:112120877-112120899 AAATATTAATATATGAAGAAGGG - Intergenic
1046541255 8:115586698-115586720 ACAAGGCCATATTTGGAGAAGGG - Intronic
1046578393 8:116060906-116060928 AGTTACCCATTTATGGAGAAGGG - Intergenic
1046758311 8:117994087-117994109 AAATAGCCATATGTGGCTAGTGG - Intronic
1047191975 8:122686611-122686633 AAATAGACAGAAATGGACAAAGG - Intergenic
1047353860 8:124101473-124101495 AAATAGCCATTAATAGGGAATGG + Intronic
1047855209 8:128902107-128902129 AAATAGCCATCAACAGAGAATGG + Intergenic
1050146607 9:2574836-2574858 AAATATCCATTTATGTGGAATGG - Intergenic
1050297326 9:4218728-4218750 AAATAGCCACATGTGGCTAATGG + Intronic
1050815845 9:9810303-9810325 AAATAGCCTTCTATTGAAAAAGG + Intronic
1051004132 9:12321379-12321401 AAATAGCCATATATGGATAATGG - Intergenic
1052119951 9:24702140-24702162 AAATAGGAAGATTTGGAGAATGG + Intergenic
1052476220 9:28963285-28963307 AAGTAGCCATATATAGCTAATGG + Intergenic
1052771337 9:32693738-32693760 AAATAAGCACACATGGAGAATGG - Intergenic
1053047139 9:34929128-34929150 AAATATTCAGATAGGGAGAAGGG - Intergenic
1053602877 9:39628617-39628639 AAAGAGCCATTTGTGCAGAAGGG + Intergenic
1053726607 9:41008341-41008363 ACAAAGTGATATATGGAGAACGG - Intergenic
1053860525 9:42382363-42382385 AAAGAGCCATTTGTGCAGAAGGG + Intergenic
1054250660 9:62713819-62713841 AAAGAGCCATTTGTGCAGAAGGG - Intergenic
1054564768 9:66748331-66748353 AAAGAGCCATTTGTGCAGAAGGG - Intergenic
1054998116 9:71416061-71416083 AAATATTCATTTATTGAGAAGGG - Intronic
1055274798 9:74602707-74602729 AAATAGCCAGATACAGGGAAAGG - Intronic
1055504950 9:76938614-76938636 AATTAGCCAGATATGGTGACGGG + Intergenic
1056279514 9:85027687-85027709 AAATAGCCACATATGGCTAGTGG + Intergenic
1056680878 9:88717043-88717065 AAATAGTCATTTATTGTGAAGGG + Intergenic
1058372750 9:104288717-104288739 TAAAAGCCATATTTGGAGGATGG + Intergenic
1058410869 9:104729947-104729969 AGATAGATATATATGGAGAAAGG - Intergenic
1058805214 9:108583894-108583916 CAATAGCCAGATGTGGTGAATGG - Intergenic
1059245898 9:112849306-112849328 AAATAGCCACATATGGCTAGTGG - Intronic
1059656791 9:116364973-116364995 AAAAAGCCACATAGGGAGACAGG + Intronic
1060432783 9:123564756-123564778 AAATAGCCATATGTGAATAGTGG + Intronic
1203448705 Un_GL000219v1:88938-88960 ACAAAGTGATATATGGAGAACGG + Intergenic
1185956833 X:4500240-4500262 AAATAAACATAAATGTAGAAGGG + Intergenic
1186281381 X:7996768-7996790 AAATATCCATATTTGAATAAAGG - Intergenic
1186628223 X:11318061-11318083 GAATTTCCATTTATGGAGAAGGG - Intronic
1186866184 X:13723156-13723178 AAATAGCCATATGTGGCTAGTGG + Intronic
1186969620 X:14826962-14826984 AAGTAGCCATCTGGGGAGAAAGG - Intergenic
1186996898 X:15133098-15133120 AAATAGTCATATATGGCCAGTGG - Intergenic
1187009038 X:15261271-15261293 AAAGAGCCACAAATTGAGAAAGG + Intronic
1187355158 X:18562368-18562390 AAATAGCCATCCATGAAAAATGG + Intronic
1187607459 X:20901730-20901752 AGATATCCCTATATGAAGAAAGG - Intergenic
1188678123 X:32968324-32968346 AAATAGCTATTTCTGGTGAAAGG + Intronic
1188787335 X:34364196-34364218 AAATAGCTGTGTATAGAGAACGG + Intergenic
1189006660 X:37002223-37002245 AAATATGCATATAAGGAGACAGG + Intergenic
1189463894 X:41263786-41263808 AAATAGCCAGATATGGTGGTAGG - Intergenic
1190181255 X:48194671-48194693 AAATAGCCAAAGCTGGAAAAGGG + Intronic
1190751191 X:53363088-53363110 AAATAACCATGTATGTAGTAGGG - Intergenic
1192188276 X:68972356-68972378 AAAAAGCCATCTATGATGAATGG - Intergenic
1193476022 X:81966922-81966944 AAAATGTCAAATATGGAGAAAGG - Intergenic
1193794602 X:85857971-85857993 AAATAGTCATCTATTGTGAAAGG - Intergenic
1193894237 X:87092147-87092169 ATATAGCGATATATAGTGAAGGG + Intergenic
1194148554 X:90294186-90294208 AATTAGCCATATATGGCAATTGG + Intergenic
1195952413 X:110289204-110289226 AAATTGCCACATGTGGATAATGG - Intronic
1198421716 X:136475079-136475101 AAATAGCAGTAAAGGGAGAAAGG + Intergenic
1198715362 X:139552540-139552562 AAATAGCCATATGTGGCTAGTGG - Intronic
1198776826 X:140188537-140188559 AAATAGCCTTATCTGTAAAATGG - Intergenic
1199715065 X:150502012-150502034 AAATAGCCATCTATGAGAAAGGG - Intronic
1200494929 Y:3870923-3870945 AATTAGCCATATATGGCAATTGG + Intergenic
1200747331 Y:6913908-6913930 AAATAGCCATATGTGGCAACTGG - Intronic
1202241430 Y:22774490-22774512 AACTAGCCATATATAGAAAGCGG - Intergenic
1202394415 Y:24408233-24408255 AACTAGCCATATATAGAAAGCGG - Intergenic
1202476369 Y:25261859-25261881 AACTAGCCATATATAGAAAGCGG + Intergenic