ID: 1088247969

View in Genome Browser
Species Human (GRCh38)
Location 11:107837901-107837923
Sequence GTGTATAAGGTGGGGGTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 889
Summary {0: 1, 1: 0, 2: 8, 3: 80, 4: 800}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088247969_1088247977 10 Left 1088247969 11:107837901-107837923 CCACCCACCCCCACCTTATACAC 0: 1
1: 0
2: 8
3: 80
4: 800
Right 1088247977 11:107837934-107837956 ACAATATCTAGTAATAGTAATGG 0: 1
1: 0
2: 0
3: 26
4: 249

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088247969 Original CRISPR GTGTATAAGGTGGGGGTGGG TGG (reversed) Intronic
900164878 1:1240633-1240655 GTGAATGAGGTGGGGGATGGGGG - Intergenic
900650077 1:3726246-3726268 ATGGATGAGGTGGGTGTGGGGGG + Intronic
900857454 1:5197404-5197426 GTGTATTTGGTGGGGGAGGGGGG + Intergenic
900996488 1:6126017-6126039 GTGTATAACGTGGTGGTGTTGGG - Intronic
901492210 1:9602385-9602407 GGCTGTAGGGTGGGGGTGGGAGG - Intronic
901633609 1:10659584-10659606 GTGTATAAGGTGTGAGCGGCAGG + Intronic
902535121 1:17115287-17115309 GTCTGTGAGGTGGAGGTGGGAGG - Intronic
902742319 1:18447328-18447350 GTGTGTATGGTGGGGGTTGGGGG + Intergenic
902781685 1:18709059-18709081 GTGTGCCAGGTGGGGCTGGGAGG + Intronic
902838069 1:19059356-19059378 GGGTTCAAGGGGGGGGTGGGAGG + Intergenic
902960779 1:19961705-19961727 GGGTGTGGGGTGGGGGTGGGTGG - Intergenic
903034344 1:20484914-20484936 GCGCAAAAGGCGGGGGTGGGGGG + Intronic
903407654 1:23111762-23111784 GTGTGTAAGGTGGGTGGGGAGGG - Intronic
903547688 1:24136954-24136976 CTGTAATTGGTGGGGGTGGGGGG + Intronic
903671375 1:25037794-25037816 GGGCATAAGGTGGGGTGGGGTGG - Intergenic
903748161 1:25602499-25602521 GTGTCTGGGGTGGGGGAGGGTGG - Intergenic
903953035 1:27007101-27007123 TTTTATTGGGTGGGGGTGGGGGG + Intronic
905468197 1:38171812-38171834 CTGTATGGAGTGGGGGTGGGAGG - Intergenic
905706187 1:40060668-40060690 GAGTGTGGGGTGGGGGTGGGGGG - Intronic
906488896 1:46252325-46252347 GTGTTTTAAGTGGGGGTAGGAGG + Intronic
906634946 1:47403167-47403189 GTGTATAGGGAGGGACTGGGAGG - Intergenic
906680739 1:47724023-47724045 GTGTAACATGTGGGGGTAGGAGG + Intergenic
907334485 1:53691349-53691371 GTGTCTCATGTGGTGGTGGGAGG - Intronic
907919722 1:58901254-58901276 CTGGAGAAGGTGGGGGTTGGGGG + Intergenic
908323124 1:62997439-62997461 GTCTCTCAGGTGGGTGTGGGAGG - Intergenic
908696315 1:66845848-66845870 GTGTGTGTGGTGGGGGTTGGGGG + Intronic
909115021 1:71522714-71522736 GTGTGTAAGGGGGGGGTAGAGGG - Intronic
909877671 1:80829480-80829502 GTGTTGAAGGTGGGGCTTGGGGG + Intergenic
909883509 1:80910901-80910923 GTGTGTGTGTTGGGGGTGGGGGG - Intergenic
910526983 1:88190712-88190734 GTGTATCATCTGGGTGTGGGGGG - Intergenic
911209974 1:95128757-95128779 GTGTGTGTGGTGGGGGTGGCAGG + Intronic
911344917 1:96684747-96684769 GAGTCTAATCTGGGGGTGGGAGG + Intergenic
911367142 1:96952221-96952243 GTGTGTGTGTTGGGGGTGGGTGG + Intergenic
912041650 1:105398129-105398151 GTGCATAACGTGGGGGTTTGGGG + Intergenic
912380011 1:109242319-109242341 ATGTGTATGCTGGGGGTGGGTGG - Intergenic
912699330 1:111864849-111864871 GTGTATACGTTAGGGTTGGGGGG + Intronic
912933503 1:113983726-113983748 GTGTGTGTGTTGGGGGTGGGAGG + Intergenic
913106155 1:115615912-115615934 CTGTGTATGGTGGGGGTGGATGG + Intergenic
913119245 1:115724581-115724603 GTACATAAGGTGTGGGTTGGGGG + Intronic
913142647 1:115956549-115956571 TTGTACAAGGTGGGTGGGGGTGG + Intergenic
913568358 1:120096183-120096205 GTAGAAAAGGTGGGGGGGGGAGG - Intergenic
914846019 1:151283754-151283776 TTGAATAGGGTGGGGGTGAGGGG + Intronic
915413908 1:155725325-155725347 GTGTGGAAGGAGTGGGTGGGGGG - Intronic
915525942 1:156476301-156476323 GTGAATGGGGTGGGGGTGAGAGG - Intronic
916315367 1:163442779-163442801 GAGAATAGGGTGGGGGTGGGGGG - Intergenic
916323704 1:163533847-163533869 GTTAAGAAGGTGGGGCTGGGTGG - Intergenic
916383588 1:164241663-164241685 ATTTTTAAAGTGGGGGTGGGAGG + Intergenic
916436600 1:164783366-164783388 GTCAGTAAGGTGGGGGTGGGGGG + Intronic
916483084 1:165233044-165233066 GTGTTTATGGTGGGGGTTGTAGG - Intronic
916720453 1:167481522-167481544 GTCTATAATGTGGGTGGGGGCGG + Intronic
916826139 1:168443729-168443751 ATTAAGAAGGTGGGGGTGGGTGG + Intergenic
917002602 1:170375944-170375966 GTGTGTGTGGGGGGGGTGGGGGG + Intergenic
917380090 1:174396893-174396915 GTTTGGAAGGTGGAGGTGGGAGG + Intronic
918118357 1:181516233-181516255 GTGGATGGGGTGGGGGTTGGAGG + Intronic
918387388 1:184023633-184023655 GTGCGTGAGGTGGGGGGGGGGGG + Intronic
918433222 1:184483905-184483927 GTGTGTGGGGCGGGGGTGGGGGG + Intronic
918538368 1:185600882-185600904 GTGTATGGGGTGGGTGGGGGAGG + Intergenic
919777163 1:201201824-201201846 CTGTATAAGGTGAGGCTGGAGGG + Exonic
920265261 1:204716748-204716770 GTGAATCAGGTTAGGGTGGGAGG + Intergenic
920336086 1:205246292-205246314 GGGTGTGAGGTGGGGGCGGGGGG + Intronic
920679048 1:208059005-208059027 GGGTATGGGGTGAGGGTGGGAGG - Intronic
920816784 1:209342144-209342166 GGGTGAAAGGTGGTGGTGGGGGG - Intergenic
921127027 1:212187174-212187196 TTGTTTAGGGTGGGGGTGGTGGG + Intergenic
921129214 1:212205324-212205346 GGGAAAAAGTTGGGGGTGGGGGG - Intergenic
921589869 1:216990940-216990962 GTATATGGGGTGGGGTTGGGGGG - Intronic
922247551 1:223815452-223815474 GTGTATTTTGTAGGGGTGGGTGG - Intronic
922531451 1:226348409-226348431 GTCTAAAAGGTGGGAGTGGGCGG - Intergenic
922587831 1:226749023-226749045 GAGTATATGGTGGTGGTGAGTGG + Intergenic
922914162 1:229241788-229241810 GAGCAGGAGGTGGGGGTGGGAGG - Intergenic
923079748 1:230642231-230642253 GTAGAAACGGTGGGGGTGGGAGG + Intergenic
923169909 1:231405978-231406000 GGGAATTGGGTGGGGGTGGGGGG - Intronic
923290290 1:232538685-232538707 GTGTGTATAGTGGGGGAGGGGGG - Intronic
924374587 1:243391823-243391845 GTGCAGGAGGTGGGGGTGGTAGG + Intronic
924584814 1:245352849-245352871 GTGTGTGTGGTGGGCGTGGGTGG + Intronic
1062789988 10:297223-297245 GTGTATGTGGTGGGGTGGGGGGG - Intronic
1062831465 10:608486-608508 GTGTGTGTGGGGGGGGTGGGGGG - Intronic
1062864959 10:844351-844373 GTGTATGAGGTGGAGGTGTGAGG - Intronic
1063024624 10:2165746-2165768 GTGTGTGTGTTGGGGGTGGGGGG - Intergenic
1063378017 10:5565776-5565798 GTGTGGATGGTGGGGGTGGGAGG - Intergenic
1064011387 10:11739309-11739331 GTGTAGAAGATAGGGGTGAGTGG + Intergenic
1064604412 10:17023973-17023995 GGGGGTAGGGTGGGGGTGGGGGG - Intronic
1065021669 10:21507100-21507122 GTGTGTATGTGGGGGGTGGGAGG - Intergenic
1066293265 10:34033105-34033127 GTATGTATGGTGGGGGTGGGGGG + Intergenic
1066520216 10:36209387-36209409 GTGTATTGGGTGGGGGGGTGGGG + Intergenic
1067295979 10:44975418-44975440 GGGTGGAAGGTGGGGATGGGAGG - Intronic
1067522266 10:47016838-47016860 GAGTATAAGTTGGGGGTGCAGGG + Intergenic
1068633678 10:59324752-59324774 GTGTATGAGGGGGTGGTGGCAGG - Intronic
1069489646 10:68850402-68850424 GTGTTTAAGGTGGGAGGGAGGGG - Intronic
1069870461 10:71529805-71529827 GTGGGTAAGGAGGAGGTGGGAGG - Intronic
1070208851 10:74293927-74293949 GGGAAGAAGGTGGGGGTGAGGGG - Intronic
1070220479 10:74438104-74438126 TTATATAAGGTGGGGGTTGGGGG - Intronic
1070772966 10:79093123-79093145 GTGTGTGTGTTGGGGGTGGGGGG - Intronic
1070925818 10:80220856-80220878 GTGTCTATGGTGGGGGAGGAAGG - Intergenic
1071052352 10:81466525-81466547 GTATATTAGTTGGGGGAGGGTGG - Intergenic
1071397961 10:85241718-85241740 GGGTAGAGGGTTGGGGTGGGAGG - Intergenic
1071411879 10:85405317-85405339 GTGTGTGTGGTCGGGGTGGGGGG + Intergenic
1071676815 10:87662552-87662574 GTATAGGGGGTGGGGGTGGGAGG - Intronic
1072092205 10:92139532-92139554 GGAAAGAAGGTGGGGGTGGGTGG + Intronic
1072250550 10:93578992-93579014 GAGAAAAAGATGGGGGTGGGTGG - Intronic
1072726934 10:97820051-97820073 GTGTGGGAGCTGGGGGTGGGAGG + Intergenic
1073125053 10:101144020-101144042 GTGTAGAAGGTGAGGGAAGGAGG - Intergenic
1073286906 10:102395091-102395113 TTGTATTAGGTGGGGGGGGGGGG + Intronic
1073699512 10:105910035-105910057 GAGTATATGAAGGGGGTGGGAGG + Intergenic
1074005399 10:109417830-109417852 GTGCATTGGGTGGGTGTGGGTGG - Intergenic
1074085567 10:110207175-110207197 GTGTTTGTGTTGGGGGTGGGGGG + Intergenic
1074211521 10:111339755-111339777 GTAAAGAAGGTGGGGGTGGGGGG + Intergenic
1075021623 10:118956516-118956538 GGGCATGTGGTGGGGGTGGGGGG + Intergenic
1075539793 10:123302511-123302533 GTGTGCATGGTGGGGGTAGGGGG + Intergenic
1075787375 10:125059130-125059152 GTGTGGGCGGTGGGGGTGGGAGG + Intronic
1076120516 10:127933244-127933266 GTGTGTATGGAGGGGGTGGTAGG - Intronic
1076292535 10:129358152-129358174 GTGTGTGTGGGGGGGGTGGGGGG + Intergenic
1077024286 11:432406-432428 GGGTATAAGGAGGGTGTGTGCGG - Intronic
1078040363 11:7856085-7856107 GGGAAGAAGGTGGGGGGGGGGGG - Intergenic
1078504146 11:11917635-11917657 GTAAACAGGGTGGGGGTGGGTGG + Intronic
1078591184 11:12641513-12641535 ATGAATAGGGTTGGGGTGGGTGG - Intergenic
1078655470 11:13234884-13234906 GTGTATTAGGTGGGGGCAGGAGG - Intergenic
1078889034 11:15537290-15537312 GTATATAAGGTTAGGGTGTGGGG - Intergenic
1079320768 11:19449610-19449632 GTGTGTGTTGTGGGGGTGGGGGG + Intronic
1079359672 11:19759891-19759913 GTGGAAATGCTGGGGGTGGGGGG + Intronic
1080567103 11:33520672-33520694 GTGTGTGTGTTGGGGGTGGGGGG - Intergenic
1080632665 11:34093371-34093393 GCCTATAAGGTAGAGGTGGGAGG - Intronic
1080764271 11:35281104-35281126 GAGTATGGGGTGGGGGTTGGGGG - Intronic
1081069590 11:38595000-38595022 CTTTATCAGGTGGGGGTTGGGGG - Intergenic
1082775661 11:57242583-57242605 GTGCCTAGGGTGGGGGTTGGGGG - Intergenic
1082783534 11:57304118-57304140 GTGTGTGGGGTGGGGGTGTGGGG - Intronic
1083050237 11:59770327-59770349 GTATATGGGGTGTGGGTGGGCGG + Intronic
1083080531 11:60087704-60087726 GTTTTTTTGGTGGGGGTGGGGGG - Intergenic
1083325678 11:61871879-61871901 GTGGATCCGGTGGGGCTGGGTGG + Intergenic
1083763865 11:64832980-64833002 GTGGATGAGGTGAGGCTGGGAGG + Intronic
1083891196 11:65596545-65596567 AAGGATCAGGTGGGGGTGGGAGG + Intronic
1084024057 11:66436960-66436982 GAGGATGGGGTGGGGGTGGGAGG - Intronic
1084352265 11:68610838-68610860 GAGGATGGGGTGGGGGTGGGGGG - Intronic
1085304854 11:75479669-75479691 GTGCATGAGAAGGGGGTGGGGGG - Intronic
1085440252 11:76555358-76555380 GTGTATGTGGTGGGGGAGGTAGG - Intergenic
1085683138 11:78596795-78596817 GTGTGTGTGTTGGGGGTGGGGGG - Intergenic
1087642579 11:100771365-100771387 CTTTAAAAGGTGGGGGTGGAGGG - Intronic
1088223625 11:107594118-107594140 GTGTTTATGGTGGTGGTGGAGGG + Intronic
1088247969 11:107837901-107837923 GTGTATAAGGTGGGGGTGGGTGG - Intronic
1088833140 11:113555080-113555102 GTGTGTGTGTTGGGGGTGGGGGG - Intergenic
1089056956 11:115593441-115593463 GTCTACAATGTGGGGCTGGGGGG - Intergenic
1089067661 11:115674224-115674246 GTGTACGAGGTGGGGGGTGGGGG + Intergenic
1089270816 11:117300252-117300274 GTGTGTAAGGTGGAGAGGGGAGG - Intronic
1089335998 11:117724402-117724424 CTGTGGAAGGTGAGGGTGGGAGG + Intronic
1089639651 11:119839322-119839344 GGGAGTGAGGTGGGGGTGGGAGG - Intergenic
1089911083 11:122101410-122101432 GTCTTGAAGGTGGGGGTGGGGGG - Intergenic
1089991950 11:122869826-122869848 GTGTGAAAACTGGGGGTGGGAGG + Intronic
1090068726 11:123525751-123525773 TGGTATGAGGTGAGGGTGGGGGG + Exonic
1090257996 11:125299266-125299288 GTGTCGGAGGTGGGGCTGGGCGG - Intronic
1091227650 11:133967318-133967340 GTGGAGAAGGTGGGTATGGGGGG - Intergenic
1091443277 12:527933-527955 GTGTGTGAAGTGTGGGTGGGTGG + Intronic
1091763221 12:3101514-3101536 GTGTGTAGGCTGGGGATGGGAGG - Intronic
1091838485 12:3602610-3602632 GAGTAGAAGGATGGGGTGGGAGG - Intergenic
1092253963 12:6916269-6916291 GTGTGTGGGGTGGGGGTGGGGGG + Intronic
1092427665 12:8387405-8387427 GTGTTTATGGTGGGGATGTGGGG - Intergenic
1093787288 12:23207352-23207374 GTGTGTGTGTTGGGGGTGGGTGG - Intergenic
1094213146 12:27913496-27913518 GTTTGTGTGGTGGGGGTGGGGGG + Intergenic
1094375698 12:29784817-29784839 GGGAAGAAGGTGGGGATGGGGGG + Intergenic
1094579862 12:31724684-31724706 GAGAAAAAGGTGGCGGTGGGGGG - Intronic
1095500289 12:42830166-42830188 GTGTGTCAGGGGTGGGTGGGTGG + Intergenic
1095724965 12:45441591-45441613 GAGAATGAGGTTGGGGTGGGAGG + Intergenic
1096255186 12:50058164-50058186 GTGTGTATGTTGGGAGTGGGGGG - Intronic
1096379765 12:51146368-51146390 GGGTATGGGGTGGGGGAGGGAGG - Intronic
1096731150 12:53613762-53613784 GGGGTTGAGGTGGGGGTGGGGGG - Intronic
1096789514 12:54036111-54036133 GGGTTAAAAGTGGGGGTGGGAGG + Intronic
1096914305 12:55015025-55015047 GTGTATAAGGGGAGAGTTGGTGG + Intergenic
1097140221 12:56896464-56896486 GTGTATGTGGTGCGTGTGGGGGG - Intergenic
1097970212 12:65625339-65625361 GTGTGTTACGTGGGAGTGGGAGG + Intergenic
1098138995 12:67432422-67432444 TTTTATTTGGTGGGGGTGGGGGG + Intergenic
1099198222 12:79645023-79645045 GTGTGTGTGGTGGGGGTGGAGGG - Intronic
1099965097 12:89437598-89437620 AACTATATGGTGGGGGTGGGGGG - Intronic
1100029281 12:90166195-90166217 GGGTAGGAGGTGGGGGTAGGAGG - Intergenic
1100332563 12:93598325-93598347 GGGTAGAAGGTGAAGGTGGGAGG + Intergenic
1100579139 12:95922098-95922120 GTGTAGAAAGTGGGAGTGGCTGG + Intronic
1100620609 12:96268930-96268952 GCCTATGGGGTGGGGGTGGGGGG - Exonic
1100627741 12:96353592-96353614 GTTTAAAAGGTGGCGGGGGGGGG + Intronic
1100825422 12:98470387-98470409 TTCTAGAGGGTGGGGGTGGGAGG + Intergenic
1101236195 12:102792695-102792717 GTATATGAGGTGGGGGTACGTGG - Intergenic
1101820855 12:108183385-108183407 GTGTATGTGCTGGGGGTGAGGGG + Intronic
1101846040 12:108363909-108363931 GTGTGTGATGTGGGGGTGTGTGG + Intergenic
1102009195 12:109607601-109607623 GTGTGTGTGGCGGGGGTGGGGGG - Intergenic
1102037930 12:109782839-109782861 GTGGGGAAGGTGGGGGTGGAGGG - Intergenic
1102315619 12:111884876-111884898 GATTAGAAGGTGGGGGTTGGGGG + Intronic
1102538231 12:113598353-113598375 GGGTATAAGGTGGAGATGAGAGG + Intergenic
1103698395 12:122835177-122835199 GTGAGTGAGGTGGGGGTTGGAGG + Intronic
1103999140 12:124849313-124849335 GGGGATGAGGTAGGGGTGGGAGG - Intronic
1104460566 12:128952418-128952440 GGGTGTAGGGTGGGGGTGGGGGG + Intronic
1104710010 12:130979055-130979077 GTTCATGAGGTGGGTGTGGGTGG + Intronic
1105205324 13:18218436-18218458 GTTTGGAAGGTGGAGGTGGGCGG - Intergenic
1105258813 13:18763613-18763635 GGGTGAAAAGTGGGGGTGGGGGG - Intergenic
1105261004 13:18779490-18779512 GGGTGAAACGTGGGGGTGGGTGG - Intergenic
1106563775 13:30868561-30868583 GTGTATTTGGTGGGGGTGGGGGG + Intergenic
1106868491 13:33993616-33993638 GTCTATATGGTGATGGTGGGAGG + Intergenic
1106896631 13:34309868-34309890 GTGTGTTTGGTGGGGGTGGGGGG + Intergenic
1107071931 13:36279203-36279225 GTGGTTGGGGTGGGGGTGGGAGG + Intronic
1107159485 13:37209457-37209479 CTAAATAAGGTGGGGGTGGTGGG - Intergenic
1107437075 13:40389627-40389649 GTGTTAAAGTTGGGGGTGGCAGG - Intergenic
1107772338 13:43801923-43801945 GTGTATGTGGTGGTAGTGGGGGG + Intergenic
1107927895 13:45281177-45281199 CTGTATAAGGTGTGGGAGGTAGG + Intronic
1107985009 13:45767975-45767997 GTGTGTGTGGTGGGGGCGGGGGG + Intergenic
1108240508 13:48458293-48458315 GTATATATGGTGGGGTGGGGAGG + Intronic
1108355188 13:49623769-49623791 ATGTACAAGATGGGGCTGGGTGG - Intergenic
1108587143 13:51880061-51880083 GTGGAATAGTTGGGGGTGGGAGG + Intergenic
1108872244 13:55001841-55001863 GTGTATATTGTTGGAGTGGGGGG + Intergenic
1109081548 13:57908365-57908387 GAATATAAGGTGGGAGTGGCAGG + Intergenic
1109499955 13:63221474-63221496 GTTTATAGGCTGGGGGTAGGGGG + Intergenic
1110125048 13:71932267-71932289 GAGTAGATGTTGGGGGTGGGGGG + Intergenic
1110525649 13:76533571-76533593 GTGTATATGGTGGATGTGGGAGG - Intergenic
1111882288 13:93972499-93972521 GTCTACATGGTGGGAGTGGGGGG - Intronic
1114512697 14:23275838-23275860 GTATATCCGGTGGGGGTGGAGGG + Exonic
1115362114 14:32515291-32515313 GTGTCAAAGGTGGGGCCGGGTGG - Intronic
1115671540 14:35617627-35617649 GTGTGTGGGGTGGGGGGGGGGGG + Intronic
1117193066 14:53312741-53312763 TTTTATAAGGCGGGGGGGGGTGG - Intergenic
1117548489 14:56811708-56811730 GTGAATAAGCTGGGTGGGGGTGG + Intergenic
1117913555 14:60655798-60655820 GTGAATGAGATGGGGGCGGGGGG - Intronic
1118011168 14:61612036-61612058 GTGTGTGTGGAGGGGGTGGGAGG - Intronic
1118474045 14:66100848-66100870 CTGCCTAAGGTGGGAGTGGGGGG - Intergenic
1118715502 14:68556863-68556885 GTGGAGAAGGTGGGGTGGGGTGG - Intronic
1118791452 14:69096985-69097007 GTGCAGAAGGAGGGGGTGGGAGG + Intronic
1119274141 14:73338111-73338133 CTGTAGAGGTTGGGGGTGGGGGG - Intronic
1119333000 14:73809479-73809501 GTGTCTTGGGTGGTGGTGGGAGG - Intergenic
1119384177 14:74246820-74246842 GTAGATTAGGTGGGGGAGGGTGG + Intronic
1119426127 14:74535674-74535696 GTGTTCCAGGTGGGTGTGGGTGG + Intronic
1119825592 14:77654838-77654860 GTGTAACAGGTGGTGGAGGGAGG + Intergenic
1120121321 14:80682980-80683002 GTGTGTTTGGTGGGGGTGGTGGG - Intronic
1120410273 14:84145279-84145301 GTGTATAGGTTGGTGGTGGGAGG + Intergenic
1120666075 14:87308246-87308268 ATTTCTATGGTGGGGGTGGGGGG + Intergenic
1121290057 14:92766903-92766925 GTAAACAAGCTGGGGGTGGGGGG - Intergenic
1121544213 14:94751628-94751650 GTGTGCAAGGTGGGGGTGTCGGG - Intergenic
1121647218 14:95526658-95526680 GTGTGCGTGGTGGGGGTGGGGGG + Intergenic
1121666004 14:95672891-95672913 GTGTGTATGTTGGGGGTTGGGGG + Intergenic
1121812204 14:96901075-96901097 CTGTTTAAAGTGAGGGTGGGTGG + Intronic
1121902327 14:97705078-97705100 ATGAAAAAAGTGGGGGTGGGAGG - Intergenic
1122251541 14:100443438-100443460 AGATATAGGGTGGGGGTGGGGGG + Intronic
1122584610 14:102796520-102796542 GTGTCTGAAGTGGGGATGGGGGG + Intronic
1122979907 14:105186737-105186759 GTGTATAGGGGGTGTGTGGGAGG + Intergenic
1122979973 14:105186996-105187018 GTGTATAGGGGGTGTGTGGGAGG + Intergenic
1123055761 14:105568896-105568918 GTGTGTGAGGTGTGGGTGTGGGG - Intergenic
1123080118 14:105688415-105688437 GTGTGTGAGGTGTGGGTGTGGGG - Intergenic
1123080166 14:105688669-105688691 GTGTGTGAGGTGTGGGTGTGGGG - Intergenic
1123093299 14:105751643-105751665 GTGTGGCTGGTGGGGGTGGGAGG + Intergenic
1202834613 14_GL000009v2_random:68522-68544 GGGTGAAAAGTGGGGGTGGGGGG + Intergenic
1123697696 15:22890994-22891016 AGGTTAAAGGTGGGGGTGGGAGG - Intronic
1123809840 15:23912645-23912667 TTTTTTTAGGTGGGGGTGGGTGG + Intergenic
1123937922 15:25202963-25202985 GGGAAGAGGGTGGGGGTGGGGGG - Intergenic
1124098986 15:26675683-26675705 GTGTTTATGTTGGAGGTGGGGGG + Intronic
1124196585 15:27636592-27636614 GTGTTATAGGTGGGGTTGGGGGG - Intergenic
1124384873 15:29198526-29198548 GTATCTAATTTGGGGGTGGGTGG + Intronic
1124639868 15:31391089-31391111 GTGGATAATGTGGGGGAGTGTGG + Intronic
1124641834 15:31400696-31400718 GTGTGGAAGGTGGAGGAGGGTGG + Intronic
1124875108 15:33584772-33584794 GTGGGTGAGGTGGGGGTGGGGGG - Intronic
1125186225 15:36933594-36933616 GTGTGTGTGGTGGGGGTGGGCGG + Intronic
1126468146 15:48979461-48979483 TTATATACAGTGGGGGTGGGTGG - Intergenic
1126532672 15:49728127-49728149 GGGAATGAGTTGGGGGTGGGAGG + Intergenic
1127151988 15:56085290-56085312 GTGTATGTGGTGGGGGTAGAAGG + Intergenic
1127346634 15:58107524-58107546 GTTTATATTTTGGGGGTGGGGGG + Intronic
1127618803 15:60713316-60713338 GTGGGTAAAGTGGGGGTAGGAGG - Intronic
1127902197 15:63349139-63349161 GTGCAAATGGTGGGGGTGGTGGG + Intronic
1127974625 15:63987978-63988000 GAGCATGAGGTGTGGGTGGGTGG + Intronic
1128604716 15:69028116-69028138 GTGTCTGGGGTGGTGGTGGGGGG - Intronic
1129055227 15:72814589-72814611 GGGTATAGGGTGGTGGTGGTAGG + Intergenic
1129115882 15:73365137-73365159 GTGGGTTAGGTGGGGTTGGGTGG + Intronic
1129828985 15:78654948-78654970 GTCCATAAAGTTGGGGTGGGGGG - Intronic
1130555164 15:84917575-84917597 GGGTTTAAGAAGGGGGTGGGGGG - Intronic
1130600996 15:85273097-85273119 TTGGAGAAGGCGGGGGTGGGGGG + Intergenic
1130622738 15:85480605-85480627 ATGTAGGTGGTGGGGGTGGGGGG + Intronic
1130786466 15:87102129-87102151 GAGTGTATGTTGGGGGTGGGGGG + Intergenic
1131510024 15:93044683-93044705 GTGTCTCTGGTGGGGGTGGGGGG + Intronic
1132045178 15:98557625-98557647 GTGTGTAATGGCGGGGTGGGGGG + Intergenic
1132530505 16:445952-445974 CTGTGTGAGGTGGGGGTAGGTGG + Intronic
1132583199 16:694575-694597 GTGGACTAAGTGGGGGTGGGTGG + Intronic
1134354073 16:13464824-13464846 CTGTAAAAGGTGGGGGGTGGGGG - Intergenic
1134355397 16:13477498-13477520 GTGAAAAAGGTGGTGGGGGGAGG + Intergenic
1135003135 16:18793968-18793990 GTGTGTATGGCGGTGGTGGGTGG + Intronic
1135477979 16:22794469-22794491 GTCTATAAGGTGGGCAGGGGGGG + Intergenic
1135625044 16:23987385-23987407 GGGTATTTGGTTGGGGTGGGGGG + Intronic
1135739566 16:24962130-24962152 GTGTGTATGGTGGGGTTGAGGGG - Intronic
1135922445 16:26663374-26663396 ATGTATTGGGTGGGGGTTGGAGG + Intergenic
1136067350 16:27768076-27768098 TGGGATGAGGTGGGGGTGGGGGG + Intronic
1137789746 16:51165132-51165154 CTGTAAAAGTTGGGGGTGGGGGG - Intergenic
1138245187 16:55462230-55462252 GTGTCTAAGCTGTGGCTGGGAGG + Intronic
1138304314 16:55960302-55960324 ATGGATTTGGTGGGGGTGGGGGG + Intergenic
1138588502 16:57986444-57986466 GTGTACAAAGTGGGGCCGGGAGG - Intronic
1138595702 16:58027857-58027879 GTGAATGGGGTGGGGGAGGGTGG - Intronic
1138627569 16:58264715-58264737 GTGTATTTGGTAGGGGTGGGAGG + Intronic
1139136087 16:64206233-64206255 GTGGAGGGGGTGGGGGTGGGGGG + Intergenic
1139432479 16:66918564-66918586 GTCTAGAAGGTGGCAGTGGGAGG - Intronic
1139754332 16:69131482-69131504 GTGGAGAAGATGGGGGTGGGTGG - Intronic
1141141422 16:81499217-81499239 GTGTATACGGTGAGGGGGTGTGG - Intronic
1141682807 16:85554150-85554172 GCGTTTAAGGAGAGGGTGGGGGG + Intergenic
1142064763 16:88055274-88055296 GTGTGTGCGGAGGGGGTGGGTGG - Intronic
1142086513 16:88186161-88186183 GTCCACAAGGTGGGTGTGGGTGG + Intergenic
1142107806 16:88315671-88315693 GTGCAGAAGGTGGGGGAGGGAGG + Intergenic
1142248278 16:88979626-88979648 GTGTGTGTGTTGGGGGTGGGGGG - Intergenic
1142357323 16:89607918-89607940 GAGTATAAAGTGGGGATCGGGGG - Intergenic
1142589135 17:993706-993728 GTGGATTATGTGAGGGTGGGTGG - Intergenic
1142589196 17:994046-994068 GTGGATTATGTGAGGGTGGGTGG - Intergenic
1142629310 17:1214223-1214245 AGGTTTAAGGTGGTGGTGGGGGG - Intronic
1142713775 17:1737208-1737230 GTGAATATGGTGTGTGTGGGAGG + Intronic
1143001332 17:3796993-3797015 GTGTAGAAGATCGAGGTGGGGGG - Intronic
1143326705 17:6103736-6103758 GTGAATGCTGTGGGGGTGGGAGG + Intronic
1143483012 17:7238185-7238207 GTGTCTGGGGTGGGGGTGAGGGG - Intronic
1143485244 17:7250750-7250772 GTGTCAAGGGTGGAGGTGGGTGG - Intronic
1143558507 17:7677311-7677333 GTGTATCAGGTGGGGAAGGGTGG - Intronic
1143583160 17:7838190-7838212 GTGTAAAAGGTTGGGGTGGGTGG + Intergenic
1143635523 17:8162235-8162257 GTGGATGAGGTGAGTGTGGGGGG - Exonic
1144139631 17:12336278-12336300 GTGGAGGTGGTGGGGGTGGGGGG + Intergenic
1144144695 17:12386115-12386137 GTGTGTATTGTGGGGGCGGGCGG + Intergenic
1144752129 17:17656197-17656219 GTATATGAGGTGGGGGCTGGTGG - Intergenic
1146302535 17:31700854-31700876 TTGTATGGGGTGGGGGTAGGAGG + Intergenic
1147658870 17:42106424-42106446 GTGCAGAAGGTGGGGGGTGGGGG + Intronic
1147660059 17:42112558-42112580 GGCCAAAAGGTGGGGGTGGGGGG + Intronic
1147671695 17:42180369-42180391 GTGTCTAAGGTGGGTGAGGCAGG - Intronic
1147703701 17:42411850-42411872 ATGTATACAGTGGGGATGGGAGG - Intronic
1148498547 17:48070992-48071014 GTGTATTATTTGGGGGAGGGAGG - Exonic
1148758121 17:49985272-49985294 AGGCATGAGGTGGGGGTGGGGGG + Intergenic
1148804412 17:50257133-50257155 GGGTTGCAGGTGGGGGTGGGGGG + Intergenic
1148837637 17:50474268-50474290 GTGTGTAAGGTGGAGGAGGCTGG + Intronic
1148848991 17:50545421-50545443 GGGCATGGGGTGGGGGTGGGGGG - Intronic
1148852875 17:50563175-50563197 GTGTAGAGGATGGGGGTGGGGGG - Intronic
1149458692 17:56810150-56810172 GTGTGTGAGGTGGGGGTGTGAGG - Intronic
1149506535 17:57198539-57198561 TTATATCAGGTGGTGGTGGGAGG + Intergenic
1150137147 17:62702253-62702275 GTGGAGTTGGTGGGGGTGGGTGG + Intronic
1150411957 17:64952616-64952638 GTGAATTTGGTGGGGGTGGGTGG - Intergenic
1151323583 17:73365777-73365799 GTGGAGAAGGTGGGGGTGTCTGG + Intronic
1151347047 17:73508511-73508533 GTGGATAGGGTGGGGCCGGGCGG + Intronic
1151934492 17:77253740-77253762 CTGTATTGGGTGGGGGTGAGGGG + Intergenic
1152025591 17:77807065-77807087 TTGAATAATGTGGGGGTGAGGGG - Intergenic
1152050917 17:77976297-77976319 TTTTATAAGGTGGGTGAGGGAGG + Intergenic
1152107548 17:78339924-78339946 GTAGAGACGGTGGGGGTGGGGGG - Intergenic
1152786234 17:82249433-82249455 GTGTGTGAGGTAGGGGTGAGGGG + Exonic
1152903689 17:82959028-82959050 GTGTATACTGTGGGGGTGTATGG + Intronic
1152991261 18:365925-365947 GTGTATAAACTTGGGGTGGGGGG - Intronic
1153527944 18:6015353-6015375 TTGCAGAAGGTGGGGGTGGATGG + Intronic
1154037726 18:10821672-10821694 ATGAAAAAGGTGGTGGTGGGTGG - Intronic
1154382689 18:13866975-13866997 GTGGGTTATGTGGGGGTGGGGGG - Intergenic
1154427227 18:14281241-14281263 GGGTGAAAAGTGGGGGTGGGGGG + Intergenic
1155046890 18:22110530-22110552 GTGGCTCACGTGGGGGTGGGGGG + Intergenic
1155318078 18:24592044-24592066 ATATATAAAGTGGGGGGGGGGGG - Intergenic
1155680239 18:28478420-28478442 GAGTATAAGCTGGGGCTAGGAGG - Intergenic
1156385387 18:36599955-36599977 GTGTTTGGGGTGGGGGTGGGGGG + Intronic
1156450189 18:37262389-37262411 GTGTGTGGGGTGGGGGAGGGGGG + Intronic
1156513341 18:37659983-37660005 GAAGAGAAGGTGGGGGTGGGGGG + Intergenic
1157260106 18:46170008-46170030 CTGGCTATGGTGGGGGTGGGTGG + Intergenic
1157480358 18:48050013-48050035 GTGGCTGAGGTGGGGGTGGGAGG + Intronic
1157675083 18:49562642-49562664 GGGAAGGAGGTGGGGGTGGGAGG - Intronic
1157980436 18:52373569-52373591 CTGTACATTGTGGGGGTGGGTGG + Intronic
1158547950 18:58411692-58411714 AAATGTAAGGTGGGGGTGGGGGG + Intergenic
1158911947 18:62073199-62073221 GTGTGTAAGGGGGGGATGGAGGG + Intronic
1160048142 18:75406770-75406792 GTGTGTCAGGTGGGGGCGTGGGG + Intergenic
1160141638 18:76328653-76328675 GACTCTAGGGTGGGGGTGGGGGG - Intergenic
1160977774 19:1802250-1802272 GTGGATGAGTGGGGGGTGGGTGG - Intronic
1161927609 19:7312907-7312929 GTGTCTCAGGCAGGGGTGGGAGG - Intergenic
1162025088 19:7889114-7889136 GGGTCTAGGGTGGGGGAGGGTGG - Intronic
1162067626 19:8135942-8135964 GTGGGTGAGTTGGGGGTGGGCGG - Exonic
1162070450 19:8149375-8149397 GTGGAGAAGGCGGGGGCGGGGGG - Intronic
1162966040 19:14156559-14156581 GTGTGTGTGGGGGGGGTGGGGGG + Intronic
1163322636 19:16583497-16583519 GGGTGTTGGGTGGGGGTGGGGGG + Intronic
1163520029 19:17786643-17786665 GTGTATGAGGGCTGGGTGGGAGG + Intronic
1163651451 19:18520714-18520736 CTGTTGATGGTGGGGGTGGGGGG - Intronic
1163756970 19:19111929-19111951 GAGTATAGCTTGGGGGTGGGAGG + Exonic
1163853955 19:19684708-19684730 GTCCATATTGTGGGGGTGGGGGG + Intergenic
1164323278 19:24169694-24169716 GTGATTGAGGTGGGGGTCGGGGG - Intergenic
1164530710 19:29046260-29046282 GGGAAAATGGTGGGGGTGGGGGG - Intergenic
1164733139 19:30520771-30520793 TTGTAGATGGTGGGGTTGGGAGG + Intronic
1164790572 19:30974242-30974264 GTGTGTAAGATGGAGGTGGAGGG - Intergenic
1165026777 19:32968212-32968234 GTGTAGCAGGTGGTGGAGGGGGG - Intronic
1165557002 19:36642750-36642772 GTGTTTTTGGTGGGGGGGGGTGG + Intronic
1165780988 19:38434229-38434251 AGGGCTAAGGTGGGGGTGGGGGG - Intronic
1166226160 19:41396838-41396860 GTGTGGGGGGTGGGGGTGGGAGG + Intronic
1166838685 19:45683017-45683039 GTTTAAAAGGTGGAGGTGAGAGG + Exonic
1167033478 19:46978853-46978875 GTGTGTATGGTGGGGTTTGGTGG + Intronic
1167087641 19:47321052-47321074 GTGTGTGTGGGGGGGGTGGGGGG - Exonic
1167372255 19:49090184-49090206 TTGTAGGGGGTGGGGGTGGGAGG + Intronic
1167636694 19:50659769-50659791 GTGTAGGGGGTGGGGGGGGGAGG - Intronic
1167749108 19:51369085-51369107 GTGTATGCGATGGTGGTGGGGGG - Intergenic
1168251697 19:55145809-55145831 GTGCAGACAGTGGGGGTGGGGGG - Intronic
1168328080 19:55548398-55548420 GTGTATGGGGGGGTGGTGGGTGG + Intergenic
1202637199 1_KI270706v1_random:52803-52825 GAGTGAAAGGTGAGGGTGGGGGG - Intergenic
925628285 2:5863584-5863606 GGGTGGAAGGTGGGGGGGGGTGG + Intergenic
925728504 2:6898295-6898317 GTGCATTAGGTGGTGGTGGTGGG - Intergenic
925995040 2:9285347-9285369 GTGTTTGAAGTGGGGATGGGGGG - Intronic
926075829 2:9942068-9942090 CTGCATATTGTGGGGGTGGGGGG - Intergenic
926119379 2:10233882-10233904 GTGTATGTGGTGGGTGTGAGTGG + Intergenic
926372691 2:12196444-12196466 GTGTGTGTGGTGGGGGTAGGAGG - Intergenic
926589993 2:14730275-14730297 GTGTGTGTGTTGGGGGTGGGGGG + Intergenic
926837982 2:17045364-17045386 GTGTTGAAGGTGGGGCTTGGTGG - Intergenic
927145873 2:20166188-20166210 GTGTATATGGTGTGGGTATGTGG - Intergenic
927633805 2:24796843-24796865 GTGTGTGTGTTGGGGGTGGGGGG + Intronic
927799923 2:26088956-26088978 GTATATAGGGTGGGGGAGGGTGG + Intronic
927888106 2:26730745-26730767 GTGTTTATGTTGGGGGTGGGGGG + Exonic
928182161 2:29076044-29076066 GAGCACAGGGTGGGGGTGGGGGG - Intergenic
928313940 2:30231920-30231942 GTTGCAAAGGTGGGGGTGGGGGG + Intronic
929041626 2:37750178-37750200 GTGTATATGTGTGGGGTGGGTGG - Intergenic
929126109 2:38524002-38524024 GTGTGTTTGGTGGGGTTGGGGGG - Intergenic
929454181 2:42054671-42054693 GGGGATAATGTGGGGCTGGGAGG + Intronic
929546568 2:42858638-42858660 GTGTGTGTGTTGGGGGTGGGGGG + Intergenic
929925199 2:46201816-46201838 CTGAAGAAGGTGGGGGTGGAGGG + Intergenic
929932450 2:46269462-46269484 GTGTGTGAGGTGGGGGTGGGTGG - Intergenic
930058460 2:47269903-47269925 GTGTGTGTGGTGGGGGTGGTGGG - Intergenic
930298204 2:49581506-49581528 GTGTGTGTGTTGGGGGTGGGGGG - Intergenic
930491848 2:52083688-52083710 CTGAAGAAGGTGGGGGTGGGAGG - Intergenic
930626861 2:53708101-53708123 GTGTTGAAGGTGGGGCTTGGTGG + Intronic
931771220 2:65499842-65499864 GTGTATGTGGTGGTGGGGGGCGG - Intergenic
931847043 2:66214721-66214743 GTGGATTTGGTGGGGGTTGGGGG - Intergenic
932087773 2:68776849-68776871 GTGTAGATATTGGGGGTGGGTGG + Intronic
932187576 2:69712180-69712202 GTGTATGTGGTGGTGGTGGTGGG - Intronic
932696950 2:73964872-73964894 GTGTAAAAGCTTGGGGTGGTGGG - Intergenic
933082366 2:78006769-78006791 GTGTCTAAGGTTGGGTTTGGAGG + Intergenic
933153680 2:78946870-78946892 GTGGACACTGTGGGGGTGGGGGG + Intergenic
933445049 2:82369141-82369163 TTGTGTGTGGTGGGGGTGGGGGG - Intergenic
933690145 2:85173315-85173337 GTGGGTACGGAGGGGGTGGGGGG + Intronic
933698472 2:85237700-85237722 GTGTAAACAGTGGGGTTGGGGGG + Intronic
934609916 2:95727482-95727504 ATGTGTGAGGTGGGGGTAGGAGG + Intergenic
934676606 2:96253813-96253835 GTGTGTAAGCAGGGGGTGGCTGG + Exonic
934685206 2:96316214-96316236 GTGGATGAGGAGGGGGTGGAGGG - Intergenic
934756833 2:96830236-96830258 GTGGGGCAGGTGGGGGTGGGAGG - Intronic
934859477 2:97751930-97751952 GTGTGGAAGGTGGGGCTTGGTGG - Intergenic
935135342 2:100295625-100295647 GTGAACAAGGAGGTGGTGGGTGG + Intronic
935553592 2:104483380-104483402 GTGGGGAAGGTGGGGCTGGGTGG + Intergenic
935789106 2:106574929-106574951 GTTTATCAACTGGGGGTGGGGGG + Intergenic
936543243 2:113369059-113369081 ATGTGTGAGGTGGGGGTAGGAGG + Intergenic
936619676 2:114082421-114082443 GAGGCTGAGGTGGGGGTGGGGGG + Intergenic
936711705 2:115139414-115139436 GTGTGTGTGGTAGGGGTGGGAGG - Intronic
937066780 2:119023630-119023652 GTGTAAAATGTAGTGGTGGGTGG + Intergenic
937117646 2:119420105-119420127 GTGTTGAAGGTGGGGCTGGTGGG - Intergenic
937239270 2:120449903-120449925 GTGTATACTCTGGGGGTGGGTGG + Intergenic
937520058 2:122702616-122702638 GTGTACAAGGTGGGGAATGGTGG - Intergenic
937752087 2:125488357-125488379 GTGTATGTGGCGGGGGCGGGTGG - Intergenic
937990745 2:127660912-127660934 GTGGCATAGGTGGGGGTGGGGGG + Intronic
938194034 2:129310123-129310145 GTGTGTGTGGTGGGGGTGAGTGG + Intergenic
938279976 2:130056941-130056963 GTTTGGAAGGTGGGGGTGGTTGG - Intergenic
938330934 2:130447656-130447678 GTTTGGAAGGTGGGGGTGGTTGG - Intergenic
938359015 2:130673847-130673869 GTTTGGAAGGTGGGGGTGGTTGG + Intergenic
938435408 2:131280496-131280518 GTTTGGAAGGTGGGGGTGGTTGG + Intronic
938761518 2:134430662-134430684 GCCTATATGGTGGGGGTGGGGGG - Intronic
938821575 2:134965871-134965893 GTGTATGTGGTGGGGCAGGGAGG - Intronic
940108490 2:150125032-150125054 TTGTAGAAGGTGGGAGTTGGAGG + Intergenic
940659076 2:156524140-156524162 CTCCAAAAGGTGGGGGTGGGTGG - Intronic
941567633 2:167128651-167128673 GTGAATTAAGTGGGGGTGGCGGG - Intronic
941810288 2:169748772-169748794 ATGTATATGGGGGGGGGGGGGGG - Intronic
942060749 2:172226598-172226620 GTGGAGAAGGCGGGGGCGGGGGG + Intergenic
943287124 2:186016267-186016289 GTGTGTATGGTGGCGGTGGGGGG - Intergenic
943585110 2:189729708-189729730 GTGTGTGTGGTGCGGGTGGGGGG + Intronic
944141657 2:196463380-196463402 GGGTAGAGGGTGGTGGTGGGTGG - Intronic
944517678 2:200528527-200528549 GTGGAGTAGGTTGGGGTGGGGGG + Intronic
944605542 2:201348625-201348647 GTGTGTAAGGGGGTGGTGGGGGG - Intronic
944718725 2:202402130-202402152 GGGAATGAGGTGGAGGTGGGAGG + Intronic
944910343 2:204304839-204304861 ATACATATGGTGGGGGTGGGGGG - Intergenic
945194713 2:207227373-207227395 GGGTATGAGGTGGGGGGAGGGGG + Intergenic
945381915 2:209150342-209150364 GTGTGTGTGTTGGGGGTGGGGGG + Intergenic
945563306 2:211365135-211365157 CTGGACAAGGTGGGGGAGGGAGG - Intergenic
946066944 2:216996070-216996092 GTTTTTAAAGTGGTGGTGGGGGG + Intergenic
947044876 2:225970460-225970482 GTGTGTGCGGCGGGGGTGGGGGG + Intergenic
947839139 2:233196540-233196562 GTGGATAGGGTGGGGTTTGGTGG - Intronic
948285564 2:236782056-236782078 GTGGAAAAGGTAGGGGTGGGAGG - Intergenic
948865853 2:240774397-240774419 GTTCATGGGGTGGGGGTGGGGGG - Intronic
1168868491 20:1109063-1109085 GTGTGTGTGGTGGGGGTCGGGGG - Intergenic
1168887330 20:1268610-1268632 GAATTTAGGGTGGGGGTGGGGGG - Intronic
1168901583 20:1369490-1369512 GGGTTTAAGGGGAGGGTGGGTGG + Exonic
1168967600 20:1908349-1908371 GTGTAGAGGGTGTGTGTGGGGGG - Intronic
1169109514 20:3022836-3022858 GTGGGTCAGGTGAGGGTGGGGGG + Intronic
1169765292 20:9141967-9141989 GTATACAGGGTAGGGGTGGGAGG + Intronic
1170292353 20:14784658-14784680 GTGTTTTAAGTGGGGGGGGGGGG + Intronic
1172014314 20:31863869-31863891 GGGGATAAGGTGGGGGAGGAAGG - Intronic
1172031495 20:31985177-31985199 GTGAACAGGGTGGGGCTGGGAGG - Intronic
1172392721 20:34576849-34576871 GTGGAAGAGGTGGAGGTGGGGGG - Intronic
1172649526 20:36493033-36493055 GTGGGTAGGGTGGGGATGGGGGG - Intronic
1172916041 20:38444571-38444593 GTGTATGTGGTAGGGGTTGGAGG - Intergenic
1173049233 20:39543062-39543084 GGGTATAATGTGGTGCTGGGAGG - Intergenic
1173057969 20:39634828-39634850 GTGTGTGTGGTGGGGGTGGCAGG + Intergenic
1173352310 20:42256588-42256610 GTGGTAAGGGTGGGGGTGGGGGG - Intronic
1173675931 20:44835775-44835797 GTGTGTATGTGGGGGGTGGGGGG - Intergenic
1173856402 20:46253059-46253081 GTGTAGTGGGTTGGGGTGGGAGG + Intronic
1173912212 20:46678801-46678823 GTGTAGGAGGTGGGGCTGGTGGG + Intronic
1174339624 20:49887720-49887742 GTGTCTAGGGAGGAGGTGGGAGG - Intronic
1174426519 20:50435491-50435513 GTGCATGAGATGAGGGTGGGGGG + Intergenic
1174444115 20:50579033-50579055 GTGTTGGAGGTGGGGCTGGGTGG - Intronic
1174524724 20:51161773-51161795 GTGTACATGGAGGGGGTGAGGGG - Intergenic
1174820588 20:53723488-53723510 GAGTAAGTGGTGGGGGTGGGGGG - Intergenic
1175375290 20:58519827-58519849 GTGTGTATGGTGGGGGCTGGGGG + Intergenic
1175873512 20:62219289-62219311 GTGGGGAAGGTGGGGGTTGGGGG - Intronic
1175901142 20:62360352-62360374 GTGGATACGTTGGGGGTGGGTGG + Intronic
1175944480 20:62552321-62552343 GAGTTTCACGTGGGGGTGGGTGG - Intronic
1176372424 21:6070306-6070328 GTGTGTATGGTGTGTGTGGGAGG + Intergenic
1176372868 21:6073139-6073161 GTGTGTTGGGGGGGGGTGGGGGG - Intergenic
1177408599 21:20701612-20701634 GTGTGTTCGGGGGGGGTGGGGGG - Intergenic
1177621354 21:23598929-23598951 GTGTATGAGGTGGGGGACAGGGG + Intergenic
1178189002 21:30258549-30258571 GTGTCCTAGGTGGGGTTGGGAGG - Intergenic
1179750609 21:43465104-43465126 GTGTGTTGGGGGGGGGTGGGGGG + Intergenic
1179751094 21:43468233-43468255 GTGTGTATGGTGTGTGTGGGAGG - Intergenic
1180008569 21:45034770-45034792 GTGCAGAAGGTGGAGGTGGGAGG + Intergenic
1180028746 21:45186100-45186122 GTGTGTGATGTGGGGGAGGGGGG + Intronic
1180084145 21:45500174-45500196 GTGTATAGTGTGGGTGTGTGTGG + Intronic
1180084153 21:45500217-45500239 GTGTATAGTGTGGAGGTGTGAGG + Intronic
1180172883 21:46069568-46069590 GTGTGCATTGTGGGGGTGGGGGG + Intergenic
1180363882 22:11922708-11922730 GAGTGAAAAGTGGGGGTGGGGGG + Intergenic
1180682936 22:17641347-17641369 ATATACAAAGTGGGGGTGGGTGG + Intronic
1180692637 22:17730016-17730038 GGGTATAAGTTGGAGGTGGAAGG - Intronic
1180760651 22:18200285-18200307 GTTTGGAAGGTGGAGGTGGGTGG + Intergenic
1180770965 22:18384582-18384604 GTTTGGAAGGTGGAGGTGGGTGG + Intergenic
1180775017 22:18424411-18424433 GTTTGGAAGGTGGAGGTGGGTGG - Intergenic
1180808092 22:18735466-18735488 GTTTGGAAGGTGGAGGTGGGTGG - Intergenic
1181071016 22:20340431-20340453 GTTTGGAAGGTGGAGGTGGGTGG - Intergenic
1181194088 22:21169380-21169402 GTTTGGAAGGTGGAGGTGGGTGG - Intergenic
1181215354 22:21323398-21323420 GTTTGGAAGGTGGAGGTGGGTGG + Intergenic
1181296796 22:21846959-21846981 GTGTGTTTGGCGGGGGTGGGGGG - Intronic
1181750149 22:24983597-24983619 GTGTGTATGGTGGGGGGGCGGGG + Intronic
1182053244 22:27329254-27329276 GTGTATGTGGTGGGGGCGGTGGG - Intergenic
1182346732 22:29671656-29671678 GTTTAGAAGGACGGGGTGGGGGG + Intronic
1182465306 22:30512210-30512232 GTGGATAGGGTGGGAGGGGGTGG - Intergenic
1182554766 22:31123167-31123189 GTGTATGTGGGGGGGGTGTGTGG - Intronic
1182637724 22:31741989-31742011 ATGTGTAAGGTGGGGGATGGGGG + Intronic
1182790951 22:32952277-32952299 GTGAATAATGTGTGTGTGGGGGG + Intronic
1182866694 22:33610626-33610648 CTTTATAGGGTGGTGGTGGGTGG + Intronic
1183095966 22:35552534-35552556 GTGTGTGTGCTGGGGGTGGGAGG - Exonic
1183257628 22:36772852-36772874 ATGTGTGTGGTGGGGGTGGGTGG + Intronic
1183774863 22:39957418-39957440 GTGGATGCGGTGGGGGAGGGGGG - Intronic
1183819536 22:40334198-40334220 GTGCAAAGGGTGGTGGTGGGGGG - Exonic
1184425170 22:44404957-44404979 CAGTATAGGATGGGGGTGGGCGG + Intergenic
1184482590 22:44756577-44756599 GTGTATGGGGTGGGGGGGCGGGG - Intronic
1184627863 22:45751951-45751973 TTTTAAAACGTGGGGGTGGGGGG - Intronic
1185100321 22:48836834-48836856 GTGCAGAGTGTGGGGGTGGGAGG + Intronic
1203232799 22_KI270731v1_random:125754-125776 GTTTGGAAGGTGGAGGTGGGTGG + Intergenic
949706211 3:6820263-6820285 GTGTATGTGGTGGGGCTGGGGGG + Intronic
951363513 3:21752012-21752034 GTGTGTGTGGTGGGGGGGGGAGG - Intronic
951490109 3:23260785-23260807 CTGTCTCAGGTGGGGGTTGGAGG + Intronic
951840011 3:27024186-27024208 GTATATAGGGTGGGGGTCGGAGG - Intergenic
952315803 3:32231270-32231292 GAGGATGGGGTGGGGGTGGGTGG - Intergenic
952561325 3:34596856-34596878 GTGTATGAGGAGGGTATGGGGGG + Intergenic
952567423 3:34675722-34675744 GTTTATGTGCTGGGGGTGGGAGG - Intergenic
952643348 3:35625198-35625220 GTGTGTGTGGTGGGGGGGGGGGG - Intergenic
953095498 3:39770544-39770566 ATGTAAAAGGTGTGTGTGGGGGG - Intergenic
953241753 3:41155758-41155780 GTGTGTAGGGTCGGGGTGGGGGG + Intergenic
953378277 3:42447076-42447098 GAGTGTGAGGTGGGGCTGGGAGG - Intergenic
954430941 3:50470579-50470601 GTGTATATGGGGGGAGGGGGCGG + Intronic
955225787 3:57059496-57059518 GTGTATGAGTTGGGGGTGGGGGG + Intronic
955560881 3:60189224-60189246 ATTTAGAAGCTGGGGGTGGGGGG + Intronic
956290737 3:67656884-67656906 GTGCTTAATTTGGGGGTGGGTGG - Intergenic
956467656 3:69535513-69535535 GTGTGTGTGGTGGGGGTGGCGGG + Intronic
957556750 3:81771897-81771919 GTGTGTTGGGTGGGGGGGGGGGG + Intergenic
957577623 3:82029852-82029874 CTGTATGAGGTGGGGAGGGGTGG + Intergenic
957676105 3:83367030-83367052 GTTGATAAGGTGTGGGGGGGAGG - Intergenic
957957380 3:87205504-87205526 GTGAATGAGGTGGGTGTGGGGGG + Intergenic
958963490 3:100533626-100533648 GTGTGAAGGGTGGGGCTGGGAGG - Intronic
959563422 3:107809201-107809223 GTTTATAAGGTGGGGAGGGGAGG + Intronic
959849616 3:111071593-111071615 GTGTAGGAGGGCGGGGTGGGAGG + Intronic
960517975 3:118623357-118623379 GTGTATATGTTGAGGGTGGCAGG + Intergenic
960630623 3:119726817-119726839 GTGTCTTGGGTCGGGGTGGGGGG - Intronic
960940450 3:122929705-122929727 GTGCAGACAGTGGGGGTGGGAGG - Intronic
961474378 3:127137565-127137587 GTGTGGACAGTGGGGGTGGGGGG - Intergenic
961575871 3:127835771-127835793 GTGTGTTGGGCGGGGGTGGGTGG + Intergenic
962104693 3:132378709-132378731 GGGTAAAGGGTGGGGGTGGATGG - Intergenic
962170242 3:133094227-133094249 GTGTGTGTGGGGGGGGTGGGGGG - Intronic
962250309 3:133832194-133832216 GGGTAGAAAGTGGGGGTTGGGGG + Intronic
962558615 3:136582204-136582226 GTTGAAGAGGTGGGGGTGGGGGG + Intronic
962894731 3:139704151-139704173 GTGGGTAAGGTGGGGGAGGAGGG + Intergenic
963214543 3:142729930-142729952 ATGTATAAAGTGGGGGTGACTGG + Intronic
963320745 3:143806721-143806743 GGGTATTATGTGGTGGTGGGGGG + Intronic
963981246 3:151539651-151539673 GTGTTGGAGGTGGGGGTGGTCGG - Intergenic
964205331 3:154168331-154168353 CTTTGGAAGGTGGGGGTGGGTGG + Intronic
964315199 3:155436228-155436250 ATGTGTAAGGTGGGGGTAGGAGG - Intronic
964420374 3:156496076-156496098 GTGTAAGAGGTGGGTTTGGGAGG + Intronic
964488131 3:157206792-157206814 GTGTGTGTGGTGTGGGTGGGTGG + Intergenic
965285336 3:166812004-166812026 GTGTATTATTTGGGGGTGGGAGG + Intergenic
965294230 3:166923452-166923474 GTGTTAAAGGTGGGGTTGGGTGG - Intergenic
965597245 3:170421136-170421158 GTGCATACTCTGGGGGTGGGGGG + Intronic
966526799 3:180928434-180928456 GTGTATGTGTTTGGGGTGGGGGG - Intronic
966712547 3:182984597-182984619 GTGTATGTGTTGGGGGTGGTGGG - Intronic
967540802 3:190665499-190665521 GTGTATATGGTGAGGGGAGGAGG - Intergenic
967843051 3:194022255-194022277 GTGTGTAGGATGTGGGTGGGGGG - Intergenic
968211645 3:196854014-196854036 CTTTGGAAGGTGGGGGTGGGCGG - Intergenic
969061150 4:4436403-4436425 GCTCATAAGGTGGGGGTGGGGGG - Intronic
969202323 4:5616018-5616040 GGGTATAGGCTGGGGCTGGGAGG + Intronic
969797188 4:9535485-9535507 GTGTTTATGGTGGGGATGTGGGG + Intergenic
969831304 4:9799695-9799717 GTGTAGAAGTTGGGTGGGGGGGG - Intronic
970043447 4:11822728-11822750 GTGTGCAAGGTGGAGGTGGTTGG + Intergenic
970078760 4:12255353-12255375 GAATATATGTTGGGGGTGGGAGG - Intergenic
970714306 4:18904147-18904169 GTGTGTTAGGTGGGGGGTGGGGG - Intergenic
971350570 4:25852296-25852318 GTGGGGAAGGTGGGAGTGGGTGG - Intronic
972091757 4:35295199-35295221 GTGTGTCTGCTGGGGGTGGGTGG + Intergenic
972571339 4:40312914-40312936 GTAGATAAGGAGGAGGTGGGGGG + Intergenic
973262489 4:48178880-48178902 GTGGTTAAGGAGGGAGTGGGTGG - Intronic
973368301 4:49225519-49225541 GGGTGAAAAGTGGGGGTGGGGGG - Intergenic
973392743 4:49569906-49569928 GGGTGAAAAGTGGGGGTGGGGGG + Intergenic
973393605 4:49576262-49576284 GAGTGAAAGGTGAGGGTGGGGGG + Intergenic
973537092 4:51894375-51894397 GGTTGGAAGGTGGGGGTGGGAGG - Intronic
973613502 4:52658758-52658780 GGGGATAAGCTGGAGGTGGGGGG - Intronic
973785856 4:54332220-54332242 GAGGCTAGGGTGGGGGTGGGGGG - Intergenic
973857227 4:55024895-55024917 TTTTTTGAGGTGGGGGTGGGGGG + Intergenic
974072056 4:57132786-57132808 GGGGAAAAGGTGGAGGTGGGTGG + Intergenic
974339560 4:60598044-60598066 GTGTAGGGTGTGGGGGTGGGCGG - Intergenic
975029521 4:69598005-69598027 GTGTAAAAAGTGGGTTTGGGAGG + Intronic
975337457 4:73195872-73195894 GTGTATATGGGTGGGATGGGAGG + Intronic
975706837 4:77120271-77120293 TTGTAAAAAGTGGGGGGGGGGGG - Intergenic
975752681 4:77539848-77539870 GTGTGTGTGGTGGGGGTAGGGGG + Intronic
975962981 4:79935297-79935319 ATGGAGAGGGTGGGGGTGGGGGG - Intronic
976737827 4:88328605-88328627 GTGTATGGGCTGGGGGGGGGGGG - Intergenic
977151203 4:93514406-93514428 GTGTGTACTGTGGAGGTGGGGGG - Intronic
977561647 4:98539021-98539043 CTGTAACAGTTGGGGGTGGGAGG + Intronic
977804925 4:101286017-101286039 ATGTACAAGGCGGGGGTGGATGG + Intronic
977822519 4:101490820-101490842 GTGTGTGTGGTGGGGGTTGGGGG + Intronic
979273054 4:118784742-118784764 GTGTATTTGGTGGCGGGGGGGGG - Intronic
980166950 4:129240761-129240783 ATGTATGAGGCGGGGGTGGGAGG - Intergenic
981052476 4:140323110-140323132 GTGTTGAAGGTGGGGCTTGGTGG + Intronic
981546484 4:145899293-145899315 GTGTGGAAGGTGGGGGAGGGAGG + Intronic
981683838 4:147430834-147430856 GTTTAAAAGGTGGGGTTTGGGGG + Intergenic
981875773 4:149543571-149543593 GTGTATATGTGTGGGGTGGGGGG + Intergenic
981922110 4:150096898-150096920 GTGAATGGGGTGGGGCTGGGCGG + Intronic
981997319 4:150988930-150988952 GTTTATAAATTGGGGGTGGGGGG + Intronic
982037559 4:151361422-151361444 GTGTGTGTGTTGGGGGTGGGGGG + Intergenic
982276312 4:153640022-153640044 GTGTCTAAAGCGAGGGTGGGAGG + Intergenic
982380432 4:154743127-154743149 GTGTGTAGGGCGGGGGGGGGGGG - Intronic
982488161 4:155994128-155994150 GTGTCTCAGGTGTGGGTGGGGGG + Intergenic
983839059 4:172433364-172433386 GTGTATGAGGTGGGAGCAGGCGG - Intronic
984699648 4:182810518-182810540 GTGTATGTGGTGAGGGTGTGTGG - Intergenic
985263301 4:188135312-188135334 GAGGAGGAGGTGGGGGTGGGAGG - Intergenic
1202765410 4_GL000008v2_random:145029-145051 GGGTGAAAAGTGGGGGTGGGGGG - Intergenic
985544738 5:503969-503991 GTGAGGAAGGTGGGGGTGGGTGG - Intronic
985606510 5:861051-861073 GTGTATGGGGTGCGGGTGTGGGG - Intronic
985616886 5:928029-928051 GTGTTGGAGGTGGGGGTCGGTGG + Intergenic
986026729 5:3858202-3858224 GTGAATAAGGAGGGGGTGAAAGG + Intergenic
986309129 5:6538667-6538689 GTGTACAATGTGGGGGTTAGGGG - Intergenic
986732454 5:10645299-10645321 GTGGATAACATGGGGGTGGGTGG + Intronic
986835834 5:11636028-11636050 GTGTGTGTGGCGGGGGTGGGGGG - Intronic
986866904 5:11999953-11999975 GTGTGTGTGGTGGGGGTGGGGGG - Intergenic
988528035 5:32003423-32003445 GTGTGTAGGGTGTGTGTGGGGGG - Intronic
988879643 5:35487157-35487179 GTGTTTAGGGTGGAGGTAGGGGG - Intergenic
989052722 5:37337098-37337120 GTGTATAAGGAGGTGAGGGGAGG - Intronic
989701006 5:44264929-44264951 GTGTGTGTGTTGGGGGTGGGGGG - Intergenic
990760059 5:59118952-59118974 TTGTATAAAGTGGGGTGGGGAGG + Intronic
990784259 5:59401531-59401553 GTGAATAAGATGGGGGAGGGTGG + Intronic
990863603 5:60355550-60355572 TTGAACAAGGTGGGGGTTGGGGG + Intronic
991279049 5:64889850-64889872 GTGCATAAGGTTGTTGTGGGGGG + Intronic
991677054 5:69098137-69098159 GTTTATAAATTGGGGGTGTGGGG - Intronic
992378610 5:76215302-76215324 ATGTATTGGGTGGGAGTGGGGGG + Intronic
992849941 5:80797044-80797066 GTGTGTGAGGCGGGAGTGGGTGG - Intronic
993807746 5:92433489-92433511 GTGTGTGTGGTGGTGGTGGGTGG - Intergenic
995036695 5:107542547-107542569 TGGTATAAGGGGGGGGTGCGGGG + Intronic
995097548 5:108256646-108256668 GTGTATATGTTGGGTCTGGGTGG - Intronic
995847781 5:116512689-116512711 GTGTTTGGGGTGGGGGTGGTGGG - Intronic
997335532 5:133106531-133106553 GTGTGTGGGGTGGGGGCGGGGGG + Intergenic
997694757 5:135852184-135852206 GTATATGAGGTGGGGGCGTGTGG + Intronic
998374809 5:141683155-141683177 GTGTATGTGTTGGGGGTGGCGGG + Intergenic
999279455 5:150355476-150355498 GTGTATGTGGGGGGGGGGGGCGG - Intergenic
999319682 5:150605731-150605753 GTGTGTGTGGTGGGGGTGGTTGG - Intronic
999622888 5:153490441-153490463 GAGGATAAGGTGAGGATGGGAGG + Intronic
999970026 5:156850248-156850270 GTGGGTGTGGTGGGGGTGGGGGG - Intergenic
999990770 5:157047854-157047876 GTGTGTGTGGTGGGGTTGGGAGG + Intronic
1000129629 5:158283686-158283708 GTGTATGTGGTGGGGGAAGGGGG + Intergenic
1001118312 5:168957763-168957785 GTGTATGTGTTGGGGGCGGGAGG + Intronic
1001757964 5:174185501-174185523 GTGTATGTGGGGGTGGTGGGTGG + Intronic
1002210468 5:177595883-177595905 GTGTGTGAGTTGAGGGTGGGTGG + Exonic
1002671635 5:180872381-180872403 GTGTGTGTGGTGGGAGTGGGAGG + Intergenic
1003426115 6:5999404-5999426 CTGTCTAAAGCGGGGGTGGGGGG + Intronic
1004201059 6:13548524-13548546 TTGATTAATGTGGGGGTGGGGGG - Intergenic
1004244216 6:13956909-13956931 GTGTGTATGGTGGGGGGCGGGGG - Intronic
1004872450 6:19920669-19920691 AGGAATGAGGTGGGGGTGGGGGG - Intergenic
1005194251 6:23264664-23264686 GTGTGTGTGGTGGGGGTGGGTGG + Intergenic
1005281836 6:24282757-24282779 CATTATAAGCTGGGGGTGGGGGG + Intronic
1005639075 6:27777348-27777370 GGGGATAAGGTGGGGCTGCGTGG + Intergenic
1006079833 6:31558743-31558765 TTGTAACAAGTGGGGGTGGGGGG + Exonic
1006181459 6:32155610-32155632 GTGTGTGTGGTGGGGGTGGGGGG + Intronic
1006650305 6:35545544-35545566 GGGGTGAAGGTGGGGGTGGGAGG + Intergenic
1006766266 6:36509603-36509625 GGAGATGAGGTGGGGGTGGGGGG + Intronic
1006770965 6:36552419-36552441 GTGAATCTGGTGGGAGTGGGTGG - Intergenic
1007208445 6:40171784-40171806 AGGTATAGGGTGGGGGTGAGGGG + Intergenic
1007229201 6:40336708-40336730 GTGTCTAGGGTGGGGGTGTAAGG - Intergenic
1007394539 6:41570063-41570085 GTGTGTCAGGGGGTGGTGGGGGG - Intronic
1007654987 6:43446460-43446482 GTGGATGAGGTAGGGGTGAGGGG - Intronic
1008320349 6:50104422-50104444 GTGGGCAGGGTGGGGGTGGGAGG + Intergenic
1008370312 6:50723824-50723846 GTGTGTATGGCGGGGGTTGGGGG - Intronic
1008449662 6:51635848-51635870 GTGGTGAAGGTGGGGGGGGGCGG + Intronic
1008883878 6:56410929-56410951 GTGTGTGGGGTGGGGGGGGGGGG - Intergenic
1009680254 6:66882321-66882343 GTGTTGGAGGTGGGGCTGGGTGG - Intergenic
1009960088 6:70509188-70509210 CTGTGGAAGGTGGAGGTGGGAGG + Intronic
1010615245 6:78005224-78005246 GTGTATAGGGTTGGGGTTGTGGG + Intergenic
1011007031 6:82657019-82657041 GTGGAGAAGGTTGGTGTGGGTGG - Intergenic
1011046721 6:83092557-83092579 GTGAATATGGTGGGGGGGGGGGG - Intronic
1011051406 6:83154729-83154751 GAGTAGAAAGAGGGGGTGGGGGG - Intronic
1011910571 6:92432365-92432387 GAAGACAAGGTGGGGGTGGGTGG + Intergenic
1013330248 6:109094255-109094277 GTGTACAAGGAGAGGGTGAGAGG - Exonic
1013748805 6:113376940-113376962 TGGGATAAGGTAGGGGTGGGTGG + Intergenic
1014312800 6:119826206-119826228 TTGGATGAGGTGGGGGTGGTAGG + Intergenic
1015855400 6:137618782-137618804 GTGTGTGTGTTGGGGGTGGGGGG - Intergenic
1016224856 6:141722795-141722817 GTGTTGAAGGAGGGGGTTGGTGG + Intergenic
1016862947 6:148739729-148739751 GTGTGGGAGGTGGAGGTGGGTGG - Intergenic
1017451143 6:154555485-154555507 GTGGGTGGGGTGGGGGTGGGGGG + Intergenic
1017515550 6:155152805-155152827 GTGTGTGTGGTGGTGGTGGGTGG + Intronic
1017632719 6:156413148-156413170 TTGTCTTTGGTGGGGGTGGGTGG - Intergenic
1017638627 6:156468124-156468146 GTGTATAAGATGGTGGGGTGGGG - Intergenic
1017728063 6:157289692-157289714 GAAATTAAGGTGGGGGTGGGGGG - Exonic
1018006960 6:159631246-159631268 GTGGGTGGGGTGGGGGTGGGAGG + Intergenic
1018620834 6:165728053-165728075 GTGTGTATGTTGGGGGTGGGTGG - Intronic
1018630471 6:165817486-165817508 GAGTACAAGGTTGGGTTGGGTGG + Intronic
1018647130 6:165959290-165959312 CTGGATAGGGTGGGGATGGGAGG + Intronic
1018962259 6:168457347-168457369 GTGTTGAAGGTGGGGTTGGATGG - Intronic
1019348322 7:541352-541374 GTGGGTGGGGTGGGGGTGGGGGG - Intergenic
1019433679 7:1011159-1011181 GGGTGTATGGTGGGTGTGGGTGG - Intronic
1019467313 7:1196617-1196639 GTGATGAAGGGGGGGGTGGGGGG + Intergenic
1019467351 7:1196726-1196748 GTGATGAAGGGGGGGGTGGGGGG + Intergenic
1019740728 7:2671591-2671613 GTGTAGTTGGCGGGGGTGGGGGG + Intergenic
1019821688 7:3248477-3248499 GTGTGTATGGTGGGGGCGAGGGG - Intergenic
1020112554 7:5455737-5455759 GTGTGTGTAGTGGGGGTGGGGGG - Intronic
1020214546 7:6179747-6179769 GTGTGTGTGGTGGGGGTGTGGGG - Intronic
1020815470 7:12900529-12900551 AATTGTAAGGTGGGGGTGGGGGG + Intergenic
1020856694 7:13435960-13435982 GGCTAGAAAGTGGGGGTGGGGGG - Intergenic
1020901492 7:14009105-14009127 GTCTATAAGGTGGGGTGGAGAGG - Intergenic
1021305573 7:19027816-19027838 GTATATAAGGTGGGAGGTGGGGG - Intronic
1021594403 7:22299779-22299801 GTCTTTAAGGTGGGGGAGGGTGG - Intronic
1021929800 7:25568949-25568971 GTATCTGAGGTGGGGGTGGGAGG - Intergenic
1022186189 7:27971757-27971779 ATGTGTATGGTGGGGGTGGAAGG + Intronic
1023038075 7:36150243-36150265 GTGCATGGGGTAGGGGTGGGAGG + Intergenic
1023042072 7:36180849-36180871 GTGCATGATGAGGGGGTGGGGGG - Intronic
1023413147 7:39908090-39908112 GTGTATAGGGTGGGAGGTGGGGG - Intergenic
1023558358 7:41446825-41446847 ATTTTTAAGGTGGGGGTGGGGGG + Intergenic
1023873161 7:44273560-44273582 GTGTATGTGTCGGGGGTGGGGGG - Intronic
1024055399 7:45657214-45657236 GTGTGTCAGGAAGGGGTGGGAGG + Intronic
1024672872 7:51612548-51612570 GGGTCTGAGGTGGGGGTAGGTGG + Intergenic
1024729359 7:52236884-52236906 GTGTTAAAGGTGGGGCTTGGTGG + Intergenic
1025171304 7:56759534-56759556 GAGGACAAGGTGGGGGTTGGCGG - Intergenic
1025700563 7:63815953-63815975 GAGGACAAGGTGGGGGTTGGCGG + Intergenic
1026449623 7:70516281-70516303 GTGGGTAAGGTGCGGGTGTGTGG - Intronic
1026665995 7:72340314-72340336 CTTTGGAAGGTGGGGGTGGGAGG - Intronic
1027665498 7:81039459-81039481 GTGTCAAAGGTGGGGCTAGGTGG - Intergenic
1028761676 7:94504168-94504190 GAATATAAGATGTGGGTGGGGGG + Intergenic
1028790003 7:94843391-94843413 GAGTATAAGGTGAGATTGGGGGG - Intergenic
1029097294 7:98098126-98098148 AAGTATAGTGTGGGGGTGGGGGG - Intergenic
1029225623 7:99026212-99026234 CTGTGGAAGGTGGAGGTGGGTGG + Intergenic
1029274617 7:99396780-99396802 GTGTGTTGGGAGGGGGTGGGGGG - Intronic
1029663816 7:101981193-101981215 GTGTATAGGTTGGGGGAGGAGGG - Intronic
1029813516 7:103072300-103072322 GAGTTTAAGGTGGGTGTGTGGGG + Intronic
1030185630 7:106759027-106759049 CAGAATAAGGTGGTGGTGGGGGG - Intergenic
1031226966 7:119051680-119051702 GTATACATGGTGGGGGTGGTGGG - Intergenic
1031898274 7:127379846-127379868 GTGTGTGTGGGGGGGGTGGGGGG - Intronic
1031968322 7:128044627-128044649 GTGTGTGTGGCGGGGGTGGGGGG - Intronic
1032018383 7:128393620-128393642 GGGTATTGGGTGGGGGTAGGAGG - Intronic
1032331752 7:130987019-130987041 GTGTGTGTGTTGGGGGTGGGAGG + Intergenic
1032395618 7:131587598-131587620 GAGTATATGGTGTGAGTGGGTGG + Intergenic
1032492801 7:132336634-132336656 GTGTATAGAGTGGGGGGTGGTGG - Intronic
1033038969 7:137901184-137901206 GTGTAGCAGGAGTGGGTGGGTGG + Intronic
1033346795 7:140531857-140531879 GTGTGTGTGGTGGGGGCGGGTGG + Intronic
1033569328 7:142612209-142612231 GTGTGTGTGGTGGGGGTCGGGGG + Intergenic
1034030898 7:147762714-147762736 ATGTATAAGTGGGGGGAGGGAGG + Intronic
1034339313 7:150341683-150341705 GTCCAGGAGGTGGGGGTGGGAGG - Intergenic
1034349261 7:150405692-150405714 GTGTGTAAGGTCGGGTGGGGTGG + Intronic
1034915986 7:155039408-155039430 CTGTACAAGGTGTGTGTGGGGGG + Intergenic
1035469455 7:159100354-159100376 GTGGATAAGGTGGTGCTGGCTGG - Intronic
1035469465 7:159100418-159100440 GTGGATAAGGTGGTGCTGGCTGG - Intronic
1035469483 7:159100546-159100568 GTGGATAAGGTGGTGCTGGCTGG - Intronic
1036592830 8:10184322-10184344 GTGTCTAAGGTGGGGCTTAGAGG - Intronic
1036599769 8:10249622-10249644 GTGCAGAAGCTGGTGGTGGGTGG - Intronic
1036899995 8:12663250-12663272 GTGTTTATGGTGGGGATGTGGGG - Intergenic
1036910396 8:12754136-12754158 TTGCATAAGCTGGGGGCGGGGGG - Intronic
1037110545 8:15159746-15159768 GTGTGTGTGGCGGGGGTGGGGGG - Intronic
1037574978 8:20193559-20193581 GAGTATCAGCTGGAGGTGGGGGG - Intergenic
1037804850 8:22053518-22053540 GTGTGTAGGGTGGGGCCGGGGGG + Intronic
1038869875 8:31482152-31482174 GTGTGTATGGGGGGGTTGGGAGG + Intergenic
1039114382 8:34075791-34075813 GTGTATTTTGTGGGGGGGGGGGG + Intergenic
1039593396 8:38769418-38769440 CTGTATGAGGTGGGGGGGTGTGG + Intronic
1040013534 8:42681992-42682014 GTGTTGAAGGTGGGGCTTGGTGG - Intergenic
1041214995 8:55591470-55591492 ATATATAACGTGGGAGTGGGTGG + Intergenic
1041326936 8:56677810-56677832 GTGTGTTGGGTCGGGGTGGGTGG + Intergenic
1041564753 8:59264074-59264096 GTGTTTGTGGTGGGTGTGGGTGG + Intergenic
1041713685 8:60914738-60914760 GGGGCTGAGGTGGGGGTGGGAGG + Intergenic
1042041366 8:64594101-64594123 GTGTGTATGTGGGGGGTGGGTGG + Intronic
1042192266 8:66198916-66198938 ATGTGTGAGGTGGGGGTGGGTGG - Intergenic
1042207625 8:66345061-66345083 GGGTCTGAGGTGAGGGTGGGAGG - Intergenic
1043564741 8:81535351-81535373 GTGAAGAAGGTGGGAGTGTGGGG + Intergenic
1043782300 8:84350967-84350989 TTGGATAAGGAGGGGGTGAGCGG + Intronic
1043874049 8:85464530-85464552 GGGTGGAAGGTGGGGGAGGGGGG - Intronic
1043954231 8:86342702-86342724 GTGGACGGGGTGGGGGTGGGGGG + Intergenic
1044508011 8:93042988-93043010 GTGTTTCAGGTGGGGGATGGTGG + Intergenic
1044711296 8:95060931-95060953 GTGTATATGGTGGGGGAGTGTGG + Intronic
1044715134 8:95093116-95093138 GAGTGTAAGGGGTGGGTGGGAGG + Intronic
1044794876 8:95886625-95886647 GTAAATGAGGTGGGGGTTGGAGG - Intergenic
1045323941 8:101102867-101102889 GAGCATAGGGTTGGGGTGGGAGG - Intergenic
1045354637 8:101374725-101374747 GGGTGGAGGGTGGGGGTGGGGGG + Intergenic
1045554040 8:103197870-103197892 GTGTTGGAGGTGGGGCTGGGTGG - Intronic
1045683411 8:104686841-104686863 GTGTGTGTCGTGGGGGTGGGGGG + Intronic
1046082241 8:109384609-109384631 GTATAAGTGGTGGGGGTGGGAGG - Intronic
1046199447 8:110903757-110903779 GTGTAGGAGGTGGGGGATGGTGG + Intergenic
1046721762 8:117628110-117628132 ATGTATAAAGTCAGGGTGGGTGG + Intergenic
1047619591 8:126592511-126592533 GTGTGTGGGGTGGGGGTGGTGGG + Intergenic
1047742387 8:127817008-127817030 TTGTATCGGGAGGGGGTGGGGGG - Intergenic
1047958836 8:129996259-129996281 GGGTGTGAGGTGGGGGTTGGGGG - Intronic
1048063370 8:130943472-130943494 GGGAAGAGGGTGGGGGTGGGGGG + Intronic
1048260963 8:132944665-132944687 GTGGAAACAGTGGGGGTGGGAGG - Intronic
1048292989 8:133194539-133194561 GTGTATGTGGTGTGTGTGGGGGG + Intronic
1048389510 8:133948156-133948178 GTGTATGGGGTGGGGGTGGGGGG + Intergenic
1048550166 8:135426742-135426764 GTGTCTCGGGTGGGGGTTGGAGG - Intergenic
1049131920 8:140853116-140853138 GTGTTTAAGGTGTGTGTTGGAGG - Intronic
1049661130 8:143820206-143820228 TTGGATGGGGTGGGGGTGGGGGG - Intronic
1049724595 8:144139802-144139824 GTGCAGAAGGTGGAGGTGGCAGG + Exonic
1049940842 9:544805-544827 GATTATTGGGTGGGGGTGGGAGG + Intronic
1050766271 9:9139101-9139123 ACGGATAAGGTGGGGGCGGGGGG - Intronic
1051193566 9:14538921-14538943 GTGAAAGAGGTGGGGTTGGGAGG - Intergenic
1051363326 9:16301639-16301661 GTGAATAGGCTGGGGGTGGTGGG + Intergenic
1051794689 9:20852463-20852485 ATACATAGGGTGGGGGTGGGAGG + Intronic
1051834982 9:21325567-21325589 TTGTATGTGGTGGGGATGGGAGG - Intergenic
1052014252 9:23446669-23446691 GTGTGCAAGGTGGGGGCGGTGGG + Intergenic
1052280253 9:26724724-26724746 GTAAATGAGATGGGGGTGGGGGG - Intergenic
1053456188 9:38234701-38234723 GTCCATAAGGTGGGGGAGGGTGG + Intergenic
1054922529 9:70556348-70556370 GAGTAAAAGGTGGGGGAGGCTGG - Intronic
1055011119 9:71566601-71566623 GTGTTTAGGGGGGTGGTGGGGGG - Intergenic
1055111708 9:72566456-72566478 GTGTACAGGGTTGGGGTGGGTGG + Intronic
1055503917 9:76929160-76929182 CTCTAGAAGGTGGAGGTGGGAGG + Intergenic
1055910718 9:81347773-81347795 CTGGAAAGGGTGGGGGTGGGTGG - Intergenic
1056005466 9:82265672-82265694 GTGTATATGGTAGTGGTGGTGGG + Intergenic
1056201225 9:84278648-84278670 CTGTACAGGGTGGGGGTGGCTGG + Intronic
1056208022 9:84339086-84339108 GACAATAAAGTGGGGGTGGGAGG - Intronic
1056753967 9:89371094-89371116 GTGTATAAGGTGTGTGTGGGGGG + Intronic
1056753984 9:89371162-89371184 GTGTATAAGGTGTGTGTGGGGGG + Intronic
1056754144 9:89371850-89371872 GTGTCTGAGGTGTGTGTGGGGGG + Intronic
1056754265 9:89372321-89372343 GTGTCTGAGGTGTGTGTGGGGGG + Intronic
1056945613 9:90993380-90993402 ATGGACATGGTGGGGGTGGGGGG - Intergenic
1057211687 9:93204045-93204067 GTGTGTGTGGTGGGGGTGTGGGG + Intronic
1057677553 9:97147604-97147626 ATGTTAAAGGTGGGGGAGGGTGG - Intergenic
1057724465 9:97558386-97558408 CTGGAAAAGTTGGGGGTGGGGGG + Intronic
1057801769 9:98195401-98195423 GTGTGTGTGGTGGGGGTGGGGGG + Intergenic
1058181529 9:101806260-101806282 GAGAGTAACGTGGGGGTGGGGGG + Intergenic
1058706029 9:107638440-107638462 GAGAAAAAGTTGGGGGTGGGGGG - Intergenic
1059333065 9:113548670-113548692 CTGTATGAGGAGGGGGTGTGAGG - Intronic
1059404596 9:114092115-114092137 GTGTATGGGGGTGGGGTGGGGGG - Intronic
1059464597 9:114459913-114459935 GTGTTGGAGGTGGGGCTGGGAGG + Intronic
1059935172 9:119303265-119303287 GTGTGTGTGGTGGGGGTGGGGGG - Intronic
1059967511 9:119629932-119629954 GTGTGTATGGTGGGGGGAGGAGG - Intergenic
1060205435 9:121680163-121680185 GTGTAGGAGGTGAGGCTGGGAGG + Intronic
1060804364 9:126565183-126565205 GTGGAGATGGTGGGGTTGGGGGG - Intergenic
1061024796 9:128041513-128041535 GTGTCTGAAGTGGGGGTGGTGGG + Intergenic
1061342681 9:129995761-129995783 GAGTGCAAGGTGGAGGTGGGTGG + Intronic
1061356291 9:130107728-130107750 TTGTATAAGGAGGAGGTTGGGGG + Intronic
1061372983 9:130208214-130208236 GTGTGTGAGGTGGGGGTGGGGGG + Intronic
1062132006 9:134901350-134901372 GAGGCCAAGGTGGGGGTGGGAGG - Intergenic
1062568094 9:137172092-137172114 GACTGTGAGGTGGGGGTGGGGGG + Exonic
1203546155 Un_KI270743v1:129918-129940 GGGTGAAAAGTGGGGGTGGGGGG - Intergenic
1185481683 X:451079-451101 GTGTAGATGGGGGGGGGGGGTGG + Intergenic
1185969931 X:4651181-4651203 GTGTACAAGGTGGTGGTGTTGGG - Intergenic
1186312552 X:8336333-8336355 GTGTTTAAAGTGGGGGTGGAGGG + Intergenic
1186485195 X:9929268-9929290 CTTTGCAAGGTGGGGGTGGGGGG + Intronic
1187197227 X:17099332-17099354 GTGTATTATGTGGGAGAGGGAGG - Intronic
1187365970 X:18666153-18666175 GTGTGTTGGGTGGGAGTGGGTGG + Intronic
1187434296 X:19253110-19253132 GTAAAGAAGGTGGGAGTGGGGGG - Intergenic
1187482747 X:19672974-19672996 TTGAATCGGGTGGGGGTGGGGGG + Intronic
1187714286 X:22086668-22086690 GTGTATATGTTGGGGTGGGGAGG + Intronic
1187995247 X:24919441-24919463 TTGTAAATGGTGGTGGTGGGGGG - Intronic
1188350323 X:29122454-29122476 GTGGGTGGGGTGGGGGTGGGGGG - Intronic
1188580780 X:31710318-31710340 CTGTATATGGTGGTGGTTGGGGG + Intronic
1189322557 X:40095738-40095760 GTCTGGAGGGTGGGGGTGGGGGG - Intronic
1189646402 X:43137513-43137535 CTGTTGAAGTTGGGGGTGGGGGG - Intergenic
1189999950 X:46676197-46676219 GTGTCTGAGGTGGGGCGGGGGGG + Intronic
1190038671 X:47051124-47051146 GTGTATAGAGTGGGGGATGGAGG + Intronic
1190056706 X:47185419-47185441 CTGTAGAGGGTGAGGGTGGGCGG - Intronic
1190224203 X:48533173-48533195 GTCTATAGGGTGGGTGTTGGGGG - Intergenic
1190291822 X:48998177-48998199 GTGCCTAAAGTGGGGGTGGGTGG + Exonic
1190399392 X:50016734-50016756 GGGTTTAGGGTGGGGGAGGGGGG - Intronic
1190440638 X:50471300-50471322 GTGTGTGTGGTGGGGGGGGGGGG + Intergenic
1190561634 X:51691654-51691676 GTGTGTGTGGTGGGGGTGGGAGG + Intergenic
1190562657 X:51701661-51701683 GTGTGTGTGGTGGGGGTGGGAGG - Intergenic
1190595988 X:52053125-52053147 GTGTATGGGGTGGGGGTGTGTGG - Intronic
1190612836 X:52200948-52200970 GTGTATGGGGTGGGGGTGTGTGG + Intronic
1190666944 X:52704831-52704853 GTGTGTGGGGTGGGGGTAGGGGG + Intronic
1190672474 X:52753577-52753599 GTGTGTGGGGTGGGGGTAGGGGG - Intronic
1190782847 X:53615066-53615088 GCTAATAAGGCGGGGGTGGGGGG + Intronic
1190982842 X:55471977-55471999 GTGTAGAAATTTGGGGTGGGAGG + Intergenic
1190985857 X:55501206-55501228 GTGTAGAAATTTGGGGTGGGAGG - Intergenic
1191121180 X:56907071-56907093 GTGTCTGTTGTGGGGGTGGGAGG - Intergenic
1191628744 X:63298678-63298700 GTGTATTATTTGGGGGAGGGAGG - Intergenic
1192169954 X:68848018-68848040 GTGTGTAAGGTGTGCGTGGTGGG - Intergenic
1192529022 X:71870571-71870593 GTGTGGAAGGTGGAGGCGGGGGG + Intergenic
1192536637 X:71934053-71934075 GTCAATATGGTGGGGGTGGTAGG - Intergenic
1192605776 X:72515582-72515604 GTGTGTGGGGGGGGGGTGGGGGG + Intronic
1193750973 X:85343029-85343051 TTGAAAAAGCTGGGGGTGGGGGG + Intronic
1194340864 X:92703534-92703556 ATCTATAAGGTGGGAGTGGAAGG + Intergenic
1196050651 X:111300018-111300040 GTGTGTGTGGTGGTGGTGGGAGG - Exonic
1196606623 X:117664536-117664558 GGCAATGAGGTGGGGGTGGGAGG - Intergenic
1196871344 X:120116063-120116085 GTGTTGCAGGTGGGAGTGGGGGG + Intergenic
1197595912 X:128464092-128464114 GTGTATTGGGTGAGGGTGAGGGG - Intergenic
1197870261 X:131057726-131057748 GGGTTAAGGGTGGGGGTGGGAGG + Intergenic
1198040622 X:132848021-132848043 GTGCATCAGATGGGGGTGGGTGG + Intronic
1198880285 X:141273626-141273648 GTGTTTGAGGTGGGGCTTGGTGG - Intergenic
1199151003 X:144486464-144486486 GGGAAAAAGGTGGGGGGGGGGGG + Intergenic
1199670513 X:150143971-150143993 TTGTTTACTGTGGGGGTGGGGGG + Intergenic
1199672650 X:150159964-150159986 ATTTATAAAATGGGGGTGGGTGG + Intergenic
1199788529 X:151127978-151128000 GTACATAAGATGGGGGTGGAGGG - Intergenic
1199834251 X:151573049-151573071 GGGTAGAGGTTGGGGGTGGGGGG + Intronic
1200052155 X:153439599-153439621 GTGTATGTGGTGGGGGAGTGGGG + Intergenic
1200101481 X:153690899-153690921 GTGTTGATGGTGGTGGTGGGGGG - Intronic
1200149990 X:153946678-153946700 CTGTGTCATGTGGGGGTGGGGGG - Intergenic
1200649216 Y:5820253-5820275 ATCTATAAGGTGGGAGTGGAAGG + Intergenic