ID: 1088250674

View in Genome Browser
Species Human (GRCh38)
Location 11:107858705-107858727
Sequence GGCCGCCGCTCCCTCCGCGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 398
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 381}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088250667_1088250674 25 Left 1088250667 11:107858657-107858679 CCAGGTGAAGAGTTTGCCTTTTA 0: 1
1: 1
2: 4
3: 25
4: 215
Right 1088250674 11:107858705-107858727 GGCCGCCGCTCCCTCCGCGAGGG 0: 1
1: 0
2: 2
3: 14
4: 381
1088250669_1088250674 9 Left 1088250669 11:107858673-107858695 CCTTTTATCCTGCGCAGCAGGCT 0: 1
1: 2
2: 1
3: 11
4: 86
Right 1088250674 11:107858705-107858727 GGCCGCCGCTCCCTCCGCGAGGG 0: 1
1: 0
2: 2
3: 14
4: 381
1088250671_1088250674 1 Left 1088250671 11:107858681-107858703 CCTGCGCAGCAGGCTGGAGAACT 0: 1
1: 0
2: 2
3: 23
4: 124
Right 1088250674 11:107858705-107858727 GGCCGCCGCTCCCTCCGCGAGGG 0: 1
1: 0
2: 2
3: 14
4: 381

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088250674 Original CRISPR GGCCGCCGCTCCCTCCGCGA GGG Exonic
900203197 1:1420384-1420406 GGCGGCGGCTCGCTCCGGGACGG - Exonic
901030636 1:6305215-6305237 GCCCGCCGCCCCGTCCGGGAAGG - Intronic
901100472 1:6715379-6715401 GCCAGCCGCTCCGTCCGGGAGGG - Intergenic
901238580 1:7680308-7680330 GGCCGATTCTCCCTCCGCGCTGG + Intronic
901540108 1:9910136-9910158 GGCCGCCGCGCGCTGCGCGCCGG - Exonic
903115698 1:21176770-21176792 GGGCGCCGCTTCCTCCGGGGAGG - Exonic
903485890 1:23689070-23689092 GGCAGCCGCCCCGTCCGGGAGGG + Intergenic
903531202 1:24032071-24032093 GGCAGCCGCCCCGTCCGGGAGGG - Intergenic
903749085 1:25608603-25608625 GGCAGCTGCACCCTCCGCCAGGG - Intergenic
903894774 1:26596319-26596341 GGCAGCCGCCCCGTCCGGGAGGG + Intergenic
903921406 1:26803579-26803601 GCCAGCCGCTCCGTCCGGGAGGG - Intergenic
904039596 1:27576114-27576136 GCCCGGCGCTCCCTCCGCAGCGG + Intronic
905427452 1:37896571-37896593 GCCAGCCGCTCCGTCCGGGAAGG + Intronic
905699359 1:39999925-39999947 GGCAGCCGCCCCATCCGGGAGGG + Intergenic
907053509 1:51345080-51345102 GGCCGCCGCCGCCGCCGCGAGGG - Exonic
910669995 1:89763089-89763111 GGCCGCCGCTCACTCCAGGGAGG - Intronic
912371463 1:109177250-109177272 GGCAGCCGCCCCGTCCGGGAGGG - Intronic
912993454 1:114510980-114511002 GGCCGCCGGGCCCGCCGCGCAGG - Exonic
913305794 1:117429449-117429471 GCCAGCCGCCCCCTCCGGGAGGG - Intronic
913305973 1:117429823-117429845 GCCAGCCGCCCCCTCCGGGAGGG - Intronic
915272071 1:154760598-154760620 GGCCGAGGCTCGCTCCGCCAGGG - Intronic
915411028 1:155701025-155701047 GCCAGCCGCCCCCTCCGGGAGGG + Intronic
917126645 1:171693919-171693941 GGCAGCCGCCCCGTCCGGGAGGG - Intergenic
917304629 1:173613433-173613455 GGCAGCCGCCCCCTCTGGGAGGG + Intronic
919080241 1:192857734-192857756 GCCAGCCGCTCCGTCCGGGAGGG + Intergenic
920143884 1:203841793-203841815 GGCAGCCGCCCCGTCCGGGAGGG - Intronic
921109127 1:212015106-212015128 GGCAGCCGCCCCGTCCGGGAGGG + Intronic
921192798 1:212725028-212725050 GGCAGCCGCCCCGTCCGGGAGGG + Intergenic
922102491 1:222487881-222487903 GGCAGCCGCCCCGTCCGGGAGGG + Intergenic
922693062 1:227710774-227710796 GCCAGCCGCCCCCTCCGGGAGGG - Intergenic
923468240 1:234267649-234267671 GGCAGCCGCCCCGTCCGGGAGGG - Intronic
923684192 1:236142590-236142612 GGCCGCCGCCGCCCCCGCGGGGG - Exonic
923711063 1:236387346-236387368 GCCAGCCGCCCCCTCCGGGAGGG + Intronic
924470287 1:244337304-244337326 GGCAGCCGCTCCCTCTGGCAGGG + Intergenic
924925613 1:248676910-248676932 GGCAGCCGCCCCGTCCGGGAGGG + Intergenic
1065840520 10:29697115-29697137 GCCAGCCGCTCCGTCCGGGAGGG + Intronic
1066094071 10:32056197-32056219 CGCCGCCGCTGCCGCCGCCATGG - Exonic
1067030971 10:42878701-42878723 GGCCTCCCCTCTCTCCGGGACGG - Intergenic
1067034174 10:42900579-42900601 GGCAGCCGCCCCGTCCGGGAGGG + Intergenic
1067052006 10:43026948-43026970 GGCCCCTGCTTCCTCCCCGAGGG + Intergenic
1069424837 10:68279652-68279674 GGCAGCCGCCCCGTCCGGGAGGG + Intergenic
1071311434 10:84347565-84347587 GCCAGCCGCCCCGTCCGCGAGGG - Intronic
1072013333 10:91323182-91323204 GCCAGCCGCCCCCTCCGGGAGGG - Intergenic
1072180341 10:92975448-92975470 GGCAGCCGCCCCGTCCGGGAGGG + Intronic
1072980463 10:100093667-100093689 GCCAGCCGCCCCGTCCGCGAGGG + Intergenic
1072999822 10:100277577-100277599 GCCAGCCGCTCCGTCCGGGAGGG + Intronic
1073000040 10:100278080-100278102 GCCAGCCGCTCCGTCCGGGAGGG + Intronic
1073139691 10:101238953-101238975 GGCCGCCGCGCTCCCCGCGCGGG + Intergenic
1073325607 10:102642750-102642772 GCCCGGCTCTCCCCCCGCGAAGG - Intergenic
1075013815 10:118895733-118895755 GGCAGCCGCCCCGTCCGGGAGGG + Intergenic
1075050929 10:119182227-119182249 GCCAGCCGCTCCGTCCGGGAGGG - Intergenic
1075401392 10:122163768-122163790 TGCCGCCGCTCCCGCCGCCACGG + Intronic
1078474960 11:11622128-11622150 GCCCCCCGCTCCCTCCCCGTTGG - Intergenic
1080801977 11:35618253-35618275 GGCCGCCTCTCCCTCTCGGAAGG + Intergenic
1081699963 11:45146763-45146785 CGCGGCCGCTCCCTCCGCGGGGG + Intronic
1082678845 11:56143908-56143930 GGCAGCCGCCCCGTCCGGGAGGG + Intergenic
1083091128 11:60201130-60201152 GCCAGCCGCTCCGTCCGGGAGGG - Intergenic
1083118943 11:60491803-60491825 GCCAGCCGCCCCCTCCGGGAGGG + Intergenic
1083617969 11:64035784-64035806 GGCCGCCTCTCCCCTCGCGGCGG - Intronic
1083917983 11:65762833-65762855 GGCAGCCGCCCCGTCCGGGAGGG - Intergenic
1084219098 11:67666763-67666785 GGCCTCAGCTCCCTGTGCGATGG + Intronic
1084588858 11:70078815-70078837 GGGGGCCGCACCCTCCGCGCAGG + Intronic
1084624333 11:70295574-70295596 GCCAGCCGCTCCATCCGGGAGGG - Intronic
1085116472 11:73936280-73936302 GCCAGCCGCTCCGTCCGGGAGGG - Intergenic
1085359951 11:75877624-75877646 GCCAGCCGCTCCGTCCGGGAGGG - Intronic
1085359999 11:75877751-75877773 GCCAGCCGCTCCGTCCGGGAGGG - Intronic
1086366103 11:86110821-86110843 GGCAGCCGCCCCGTCCGGGAGGG + Intergenic
1086881497 11:92157691-92157713 GGCAGCCGCCCCGTCCGGGAGGG + Intergenic
1088250674 11:107858705-107858727 GGCCGCCGCTCCCTCCGCGAGGG + Exonic
1089148555 11:116347404-116347426 GGCAGCCGCCCCATCCGGGAGGG + Intergenic
1090230813 11:125102242-125102264 GGCCGCCGCTGCCTCCCCGCGGG - Exonic
1092331461 12:7590298-7590320 GGCAGCCGCCCCGTCCGGGAGGG - Intergenic
1092453578 12:8625238-8625260 GGCAGCCGCCCCGTCCGGGAGGG + Intergenic
1095571101 12:43685252-43685274 GGCAGCCGCCCCGTCCGGGAGGG + Intergenic
1095571285 12:43685679-43685701 GCCAGCCGCTCCGTCCGGGAGGG + Intergenic
1095672403 12:44876351-44876373 GCCCGCCCCTCCCTCCCCGGAGG - Intronic
1095810642 12:46371346-46371368 GGCCGCTGCACCCACCGCCAAGG - Exonic
1096167300 12:49436414-49436436 GCCAGCCGCCCCCTCCGGGAGGG - Intronic
1096225005 12:49861111-49861133 GGCAGCCGCCCCGTCCGGGAGGG + Intergenic
1096475653 12:51907375-51907397 GGCCGCCGCTCGCCCCTCGCTGG - Intronic
1097126998 12:56783606-56783628 GCCAGCCGCTCCGTCCGGGAGGG - Intronic
1097127095 12:56783830-56783852 GGCAGCCACCCCCTCCGGGAGGG - Intronic
1098370918 12:69759713-69759735 GGCAGCCGCCCCGTCCGGGAGGG - Intronic
1098370961 12:69759806-69759828 GGCAGCCGCCCCGTCCGGGAGGG - Intronic
1099255432 12:80307935-80307957 GCCAGCCGCTCCGTCCGGGAGGG - Intronic
1099971379 12:89503961-89503983 GGCAGCCGCCCCGTCCGGGAGGG + Intronic
1101371925 12:104138247-104138269 GGCCTCCCCTCCCTCCGCCGCGG + Exonic
1102089279 12:110172916-110172938 GGCAGCCGCCCCGTCCGGGAGGG + Intronic
1102174680 12:110867141-110867163 GCCAGCCGCCCCCTCCGGGAGGG - Intronic
1102278201 12:111598824-111598846 GGCCACGGCTCCCTCCTCGGTGG - Exonic
1103038328 12:117674286-117674308 GGCTGCCGCTGCCTCCTCGCTGG + Intronic
1103563597 12:121804674-121804696 GGCCGCCGCCGCCGCCGCGGCGG + Intronic
1105327303 13:19382316-19382338 GGCCGCCTCTCCTTCCGCAGGGG + Intergenic
1105976801 13:25480309-25480331 GGCAGCCGCCCCGTCCGGGAGGG - Intronic
1106104784 13:26723989-26724011 GGCAGCCGCCCCGTCCGGGAGGG + Intergenic
1106104834 13:26724116-26724138 GCCAGCCGCTCCGTCCGGGAGGG + Intergenic
1107165932 13:37280639-37280661 GCCAGCCGCTCCGTCCGGGAGGG + Intergenic
1107562713 13:41572149-41572171 GGCAGCCGCCCCGTCCGGGAGGG + Intronic
1110782382 13:79481298-79481320 GGCCGCCGAGACCTCCGCGTTGG - Exonic
1111672681 13:91348746-91348768 GGACGCCGCTCCCGCCGAGCCGG - Intergenic
1113478988 13:110606479-110606501 GGCAGCCGCCCCGTCCGGGAGGG - Intergenic
1114174795 14:20310145-20310167 GGCAGCCGCCCCGTCCGGGAGGG + Intergenic
1114578719 14:23736898-23736920 GGCAGCCGCCCCGTCCGGGAGGG + Intergenic
1115259327 14:31437053-31437075 GGCAGCCGCCCCGTCCGGGAGGG - Intronic
1115493933 14:33984477-33984499 GGCAGCCGCCCCGTCCGGGAGGG - Intronic
1117297426 14:54393017-54393039 GGGCGCCGCTCCCTGCTCCAGGG - Intergenic
1118209277 14:63751154-63751176 GCCAGCCGCTCCGTCCGGGAGGG - Intergenic
1118238962 14:64037955-64037977 GGCAGCCGCCCCGTCCGGGAGGG - Intronic
1119254516 14:73184660-73184682 GCCAGCCGCTCCGTCCGGGAGGG - Intronic
1122497940 14:102172724-102172746 GGCAGCCGCCCCGTCCGGGAGGG - Intronic
1122957747 14:105079244-105079266 GGCAGCCGCCCCGTCCGGGAGGG - Intergenic
1124629238 15:31327535-31327557 GGCCGCCGCGCCTTCGGCGCCGG - Exonic
1126295384 15:47132592-47132614 GGCAGCCGCCCCGTCCGGGAGGG + Intergenic
1126392889 15:48178240-48178262 CGCCGCCGCTGCCTCCGCCTCGG + Exonic
1126691896 15:51294555-51294577 GGCAGCCGCCCCGTCCGGGAGGG + Intronic
1126799432 15:52286195-52286217 GGCAGCCGCCCCGTCCGGGAGGG + Intronic
1127644674 15:60946990-60947012 GGCAGCCGCCCCTTCCGGGAGGG + Intronic
1128071327 15:64799158-64799180 GGCAGCCGCCCCGTCCGGGAGGG - Intergenic
1128455034 15:67827375-67827397 CGCCGCCGCTGCCGCCGCCACGG - Intronic
1128587176 15:68860327-68860349 GGCAGCCGCCCCGTCCGGGAGGG - Intronic
1129431250 15:75503518-75503540 GGCAGCCGCCCCGTCCGGGAGGG + Intronic
1129431274 15:75503567-75503589 GCCAGCCGCTCCGTCCGGGAGGG + Intronic
1129780099 15:78264453-78264475 GGCCGCCGGAACCTCCGCGAAGG + Intronic
1131001413 15:88941902-88941924 GGCAGCCGCCCCATCCGGGAGGG - Intergenic
1132934580 16:2474214-2474236 GGCCGCCGCCCCGTCCCCGCCGG + Intergenic
1135694297 16:24574126-24574148 GGCAGCCGCCCCATCCGGGAGGG - Intergenic
1137303926 16:47181325-47181347 GGCAGCCGCCCCGTCCGGGAGGG + Intronic
1142705249 17:1689849-1689871 GGCAGCCGCCCCATCCGGGAGGG - Intergenic
1142740762 17:1930670-1930692 AGCCGCTGCTCCCTGCACGAGGG + Intergenic
1142949303 17:3464991-3465013 GCCAGCCGCTCCGTCCGGGAGGG + Intronic
1143008847 17:3854452-3854474 GGCAGCCGCCCCGTCCGGGAGGG + Intergenic
1143200763 17:5111725-5111747 AGCCGCCGCTGCCTGCGGGACGG + Intronic
1144559757 17:16312100-16312122 GCCAGCCGCCCCCTCCGGGAGGG - Intronic
1144598194 17:16589197-16589219 TTCCGCCGCTCCCTGCGAGAGGG + Intergenic
1144934827 17:18888768-18888790 GCCAGCCGCCCCGTCCGCGAGGG - Intronic
1145087069 17:19951111-19951133 GGCAGCCGCCCCGTCCGGGAGGG + Intronic
1145684249 17:26638343-26638365 GGCAGCCGCCCCGTCCGGGAGGG + Intergenic
1145684510 17:26639021-26639043 GCCAGCCGCCCCCTCCGGGAGGG + Intergenic
1146954290 17:36928149-36928171 CCCCGCTGCTCCTTCCGCGATGG - Intergenic
1148016367 17:44524920-44524942 GCCAGCCGCTCCGTCCGGGAGGG + Intergenic
1148079452 17:44959807-44959829 GCCCTCCGCTCCCTCCGGGGTGG - Exonic
1148404359 17:47398036-47398058 GCCAGCCGCTCCGTCCGGGAGGG + Intronic
1148432022 17:47650226-47650248 CGCCGCCGCCACCTCCGCCATGG + Exonic
1148502382 17:48101466-48101488 GCCCGCCGCTCGCACCGCGCAGG + Intronic
1148558513 17:48592716-48592738 GGCGGCCGCTCGCCCCGGGAGGG + Intronic
1148847474 17:50537885-50537907 AGCCGCCCCTCCATCCGGGATGG + Intronic
1150477244 17:65484585-65484607 GGCAGCCGCCCCGTCCGGGAGGG + Intergenic
1152020114 17:77776466-77776488 GGCAGCCGCCCCGTCCGGGAGGG + Intergenic
1152392403 17:80010544-80010566 GGCCGCAGCTCCGTCGGGGAGGG + Exonic
1152487324 17:80602437-80602459 GCCAGCCGCCCCGTCCGCGAGGG - Intronic
1152777591 17:82212590-82212612 CCCCGCCGCAGCCTCCGCGAGGG + Intronic
1152867956 17:82735522-82735544 GGCCGCCCCTCCCGCCGCCCGGG + Intergenic
1152875769 17:82785516-82785538 GGACGCCCCTCCCGCTGCGATGG - Intronic
1153634135 18:7098817-7098839 GGCCACCGCCCCGTCCGGGAGGG + Intronic
1153911251 18:9708249-9708271 GGCCGCCGGCCCCGCCGCGGTGG - Exonic
1154278198 18:12979889-12979911 GCCAGCCGCCCCGTCCGCGAAGG - Intronic
1156489151 18:37486039-37486061 GGGCGCTGCTCCCTCAGGGATGG + Intronic
1157629462 18:49080655-49080677 GGCAGCCGCCCCGTCCGGGAGGG - Intronic
1158148832 18:54343921-54343943 GCCAGCCGCCCCGTCCGCGAGGG + Intronic
1160453326 18:78979717-78979739 CGCGGCCGCTCGCTCCGGGAGGG + Intergenic
1160773875 19:846019-846041 GGATGCCGCTCCCTCCGCCTGGG - Intronic
1160994143 19:1874004-1874026 GGCCGCCCCTCCCTCCCTGCGGG - Intergenic
1161153668 19:2721613-2721635 GGCCCCAGCTCCCACCCCGAGGG - Intronic
1161309373 19:3585593-3585615 GGCCGCTGCTCCCTCCATGGCGG - Exonic
1161667513 19:5586154-5586176 GGCTGCCCCTCCCGCCGAGAGGG + Intergenic
1161685814 19:5702176-5702198 GCCAGCCGCCCCCTCCGGGAGGG + Intronic
1161790330 19:6355820-6355842 GCCAGCCGCTCCATCCGGGAGGG + Intergenic
1162163876 19:8739540-8739562 GGCAGCCGCCCCGTCCGGGAGGG + Intergenic
1163012250 19:14433474-14433496 GGCCGCCCCTCCCTCCGCGCGGG + Intronic
1163143113 19:15363327-15363349 GCCAGCCGCTCCGTCCGGGAGGG + Intronic
1163542346 19:17918665-17918687 GCCAGCCGCTCCGTCCGGGAGGG + Intergenic
1163986105 19:20952696-20952718 GGCAGCCGCCCCGTCCGGGAGGG - Intergenic
1164081532 19:21865393-21865415 GCCAGCCGCCCCCTCCGGGAGGG - Intergenic
1164105274 19:22105209-22105231 GGCAGCCGCCCCATCCGGGAGGG + Intergenic
1164256624 19:23533527-23533549 GGCAGCCGCCCCGTCCGGGAGGG - Intronic
1165481843 19:36069089-36069111 GCCAGCCGCTCCGTCCGGGAGGG - Intronic
1166030118 19:40118790-40118812 GCCAGCCGCCCCCTCCGGGAGGG + Intergenic
1167897458 19:52593424-52593446 GCCAGCCGCTCCCTCCGGGAGGG - Intergenic
1167924525 19:52811734-52811756 GGCAGCCGCCCCGTCCGGGAGGG + Intronic
1168572621 19:57483341-57483363 GGCAGCCGCCCCGTCCGGGAGGG + Intergenic
1168696138 19:58405283-58405305 GCCAGCCGCTCCGTCCGGGAGGG - Intronic
925609632 2:5692503-5692525 GACCGCAGCTCCCACCGCGCCGG + Intergenic
926801807 2:16665840-16665862 GGCCGCCGCAGCCTGCGAGACGG + Intronic
927755646 2:25705847-25705869 GGCAGCCGCCCCGTCCGGGAGGG + Intergenic
927897726 2:26795344-26795366 GCCAGCCGCCCCCTCCGGGAGGG - Intronic
928597175 2:32869249-32869271 GCCAGCCGCCCCGTCCGCGAGGG + Intergenic
928597356 2:32869656-32869678 GCCAGCCGCCCCGTCCGCGAGGG + Intergenic
929238304 2:39628344-39628366 GGCAGCCGCCCCGTCCGGGAGGG - Intergenic
929539715 2:42810342-42810364 GGCGGCCCCTCCATCCCCGAGGG + Intergenic
929577762 2:43063208-43063230 GGCAGCCGCCCCGTCCGGGAGGG - Intergenic
929983223 2:46699578-46699600 GGCCGGCGCTGCCTCCGCCGCGG - Intronic
930727900 2:54699169-54699191 GCCGGCCGCTCCGTCCGGGAGGG + Intergenic
931752102 2:65339070-65339092 GCCAGCCGCTCCGTCCGGGAGGG + Intronic
934753016 2:96806095-96806117 GCCAGCCGCCCCCTCCGGGAGGG - Intronic
934998539 2:98988960-98988982 GGCAGCCGCCCCGTCCGGGAGGG - Intergenic
935590946 2:104845021-104845043 AGCCGCGGCCCCCTCCCCGAAGG + Intergenic
937437626 2:121892947-121892969 GGCAGCCGCCCCGTCCGGGAGGG + Intergenic
938533800 2:132221164-132221186 GGCAGCCACCCCATCCGCGAGGG + Intronic
938583929 2:132670746-132670768 TGCCCCCTCTTCCTCCGCGAAGG + Intronic
941603065 2:167563795-167563817 GCCAGCCGCTCCCTCCGGGGGGG - Intergenic
941814452 2:169785724-169785746 GCCAGCCGCCCCATCCGCGAGGG - Intergenic
941814530 2:169785903-169785925 GCCAGCCGCCCCGTCCGCGAGGG - Intergenic
941847812 2:170150000-170150022 GGCAGCCGCCCCGTCCGGGAGGG + Intergenic
942024719 2:171900081-171900103 GGCCGCCACCCCGTCCGGGAGGG + Intronic
942170236 2:173282731-173282753 GGCCTCAGCTGCCTCCGCGCGGG - Intergenic
943648300 2:190430858-190430880 GGCAGCCGCCCCGTCCGGGAGGG - Intronic
943773417 2:191742067-191742089 GCCAGCCGCTCCGTCCGGGAGGG + Intergenic
943773485 2:191742210-191742232 GCCAGCCGCTCCGTCCGGGAGGG + Intergenic
943773657 2:191742611-191742633 GCCAGCCGCTCCGTCCGGGAGGG + Intergenic
944263116 2:197696524-197696546 GGCAGCCACCCCCTCCGGGAGGG - Intronic
944533051 2:200683948-200683970 GGCAGCCGCCCCGTCCGGGAGGG - Intergenic
944585126 2:201166274-201166296 GGCAGCCGCCCCGTCCGGGAGGG - Exonic
945864792 2:215163373-215163395 GGCAGCCGCCCCGTCCGGGAGGG - Intergenic
946054044 2:216885546-216885568 GGCCGCTGCTCCCTGCTCCAGGG + Intergenic
947797807 2:232905867-232905889 GGCAGCCGCCCCGTCCGGGAGGG + Intronic
1169370975 20:5028001-5028023 GCCAGCCGCCCCCTCCGGGAGGG + Intergenic
1169449880 20:5702074-5702096 GGCAGCCGCCCCGTCCGGGAGGG + Intergenic
1169718312 20:8644677-8644699 GGCAGCCGCCCCGTCCGGGAGGG + Intronic
1170622933 20:18010234-18010256 GCCAGCCGCTCCGTCCGGGAGGG - Intronic
1171951650 20:31427142-31427164 GGCAGCCGCCCCGTCCGGGAGGG + Intergenic
1171956838 20:31470093-31470115 GCCAGCCGCTCCGTCCGGGAGGG - Intronic
1171957478 20:31471556-31471578 GGCAGCCGCCCCGTCCGGGAGGG - Intronic
1172059077 20:32176214-32176236 GGCAGCCGCCCCATCCGGGAGGG + Intergenic
1174020546 20:47525728-47525750 GCCAGCCGCCCCCTCCGGGATGG - Intronic
1174743333 20:53038047-53038069 GGCTGTCGTTCCCTCCCCGAAGG - Intronic
1175361401 20:58414338-58414360 GGCGGCCGCCCCGTCCGGGAGGG - Intronic
1175823380 20:61923842-61923864 GGCTGCGGCTCCCTCCTGGAAGG - Intronic
1176656697 21:9593798-9593820 GGCAGCCGCCCCGTCCGGGAGGG - Intergenic
1177178505 21:17720603-17720625 GGCAGCCGCCCCATCCGGGAGGG - Intergenic
1177788283 21:25695616-25695638 TGCCGCCGCCCCATCCGGGAGGG - Intronic
1179195304 21:39157625-39157647 GCCAGCCGCTCCGTCCGGGAGGG + Intergenic
1179969238 21:44825048-44825070 GCCAGCCGCTCCGTCCGGGAGGG + Intergenic
1180005421 21:45018560-45018582 GGCCGCCGAGCCCGCTGCGAGGG + Intergenic
1181017652 22:20080424-20080446 GGGCGCCGCGGCCTGCGCGAGGG + Intronic
1181273966 22:21677043-21677065 GGCAGCCGCCCCGTCCGGGAGGG - Intronic
1181598904 22:23937243-23937265 GGCAGCCGCCCCGTCCGGGAGGG + Intergenic
1181813672 22:25421016-25421038 GCCCACCGCTCCTTCAGCGAGGG - Intergenic
1182346764 22:29671817-29671839 CGCTGCCGCTCCATCTGCGAGGG - Exonic
1182399833 22:30066861-30066883 GGCAGCCGCCCCGTCCGGGAGGG + Intergenic
1183434744 22:37786949-37786971 GGCAGCCGCCCCGTCCGGGAGGG + Intergenic
1183537222 22:38410084-38410106 GGCAGCCGCCCCGTCCGGGAGGG - Intergenic
1184037842 22:41926829-41926851 GCCCCCCGCTTCCTCCCCGAGGG - Intergenic
1184086865 22:42270563-42270585 GGCGGCCGCGGCCTCCGCCAGGG - Intronic
1184147971 22:42622597-42622619 GGCGGCTGCTCCCTCAGGGATGG + Intronic
1184169476 22:42750596-42750618 GGCAGCCGCCCCGTCCGGGAGGG - Intergenic
950742416 3:15062018-15062040 GGCAGCCGCCCCGTCCGGGAGGG + Intronic
950754879 3:15163254-15163276 GGCAGCCGCCCCGTCCGGGAGGG - Intergenic
951558710 3:23945552-23945574 GGCCCCGGCCGCCTCCGCGAGGG + Exonic
953257609 3:41306102-41306124 GGCCGCCACCCCGTCCGGGAGGG + Intronic
953426285 3:42798410-42798432 GCCAGCCGCCCCGTCCGCGAGGG + Intronic
954048387 3:47952232-47952254 GGCAGCCGCCCCGTCCGGGAGGG + Intronic
954356178 3:50084826-50084848 GCCAGCCGCTCCCTCCGGGAGGG - Intronic
954437441 3:50503532-50503554 CGCCGCCGCCTTCTCCGCGAGGG + Intronic
956675041 3:71725331-71725353 GGCCGCCGCGCCCCCCGCCGGGG - Exonic
958808322 3:98836887-98836909 GCCAGCCGCCCCCTCCGGGAGGG - Intronic
959201677 3:103255014-103255036 GGCAGCCGCCCCGTCCGGGAGGG - Intergenic
960817563 3:121688988-121689010 GGCAGCCACCCCCTCCGGGAGGG + Intronic
961120757 3:124368255-124368277 GGCAGCCGCCCCGTCCGGGAGGG - Intronic
961163652 3:124750025-124750047 GACCCCCCCTCCCTCCGGGACGG + Intergenic
961729486 3:128955066-128955088 GCCAGCCGCCCCGTCCGCGAGGG + Intronic
962770780 3:138608705-138608727 GGCCACCCCTCCCGCCGCCACGG - Exonic
964765963 3:160178835-160178857 GGCAGCCGCCCCGTCCGGGAAGG + Intergenic
966362931 3:179148914-179148936 GGCCGCCGCCCCGGCCGCGGTGG + Intronic
966375373 3:179290941-179290963 GGCAGCCGCCCCGTCCGGGAGGG - Intergenic
966378800 3:179323239-179323261 GGCCGCCGCCGCCTCTGCGTGGG + Intronic
967178705 3:186884943-186884965 GGCAGCCGCCCCGTCCGGGAGGG - Intergenic
968042421 3:195599738-195599760 GGCAGCCGCCCCGTCCGGGAGGG - Intergenic
968411739 4:395972-395994 GCCAGCCGCTCCGTCCGGGAGGG + Intergenic
970472723 4:16393494-16393516 GGCAGCCGCCCCATCCGGGAGGG - Intergenic
972288428 4:37669333-37669355 GCCAGCCGCTCCCTCCGGGAGGG + Intronic
972586208 4:40438830-40438852 GGCCGCCGGGTCCTCCGCCAAGG - Exonic
973650455 4:52992790-52992812 GGCAGCCGCCCCGTCCGGGAGGG + Intronic
976149460 4:82077962-82077984 GCCAGCCGCCCCCTCCGGGAGGG + Intergenic
976236249 4:82900541-82900563 GACCGCTCCTCCCTCCGCGTTGG - Intronic
976265106 4:83182359-83182381 GGCAGCCGCCCCGTCCGGGAGGG + Intergenic
980056513 4:128083815-128083837 GGCAGCCGCCCCGTCCGGGAGGG - Intronic
980883689 4:138739485-138739507 GGCAGCCGCCCCGTCCGGGAGGG + Intergenic
980895305 4:138854615-138854637 GCCAGCCGCCCCCTCCGGGAGGG + Intergenic
981494418 4:145375541-145375563 GGCCGCCGATGGCTCCGCCATGG - Intergenic
981523984 4:145693679-145693701 GCCAGCCGCCCCCTCCGGGAGGG - Intronic
984037912 4:174692240-174692262 GCCAGCCGCCCCATCCGCGAGGG + Intronic
984728103 4:183040763-183040785 GGCAGCCGCCCCGTCCGGGAGGG - Intergenic
988760242 5:34305885-34305907 GCCAGCCGCCCCGTCCGCGAGGG - Intergenic
988760419 5:34306292-34306314 GCCAGCCGCCCCGTCCGCGAGGG - Intergenic
989633522 5:43511339-43511361 GGCAGCCGCCCCGTCCGGGAGGG + Intronic
989633543 5:43511385-43511407 GCCAGCCGCTCCGTCCGGGAGGG + Intronic
989812671 5:45696209-45696231 CGCCGCCGCCGCCGCCGCGACGG - Intergenic
990459079 5:56015126-56015148 GGCAGCCGCCCCGTCCGGGAGGG - Intergenic
991073665 5:62513429-62513451 GCCAGCCGCTCCGTCCGGGAGGG - Intronic
992443092 5:76812671-76812693 GCCAGCCGCTCCGTCCGGGAGGG + Intergenic
992528100 5:77630656-77630678 CGCCGCCGCTGCCGCCGCCATGG - Exonic
992574473 5:78096813-78096835 GGCAGCCGCCCCGTCCGGGAGGG + Intronic
995724500 5:115169571-115169593 GACCGCCGCCCCCACCTCGAGGG - Intronic
996069996 5:119122328-119122350 GCCAGCCGCCCCCTCCGGGAGGG - Intronic
997874917 5:137538171-137538193 GCCAGCCGCTCCGTCCGGGAGGG - Intronic
1000630204 5:163583699-163583721 GGCAGCCGCCCCATCCGGGAGGG - Intergenic
1002116116 5:176962270-176962292 GCCAGCCGCCCCGTCCGCGAGGG + Intronic
1003407431 6:5835884-5835906 GGCAGCCGCCCCGTCCGGGAGGG - Intergenic
1005063493 6:21797310-21797332 GCCAGCCGCTCCCTCCGGGCGGG - Intergenic
1005606661 6:27484748-27484770 GCCAGCCGCCCCCTCCGGGAGGG - Intergenic
1005865469 6:29933090-29933112 GCCAGCCGCTCCATCCGGGAGGG + Intergenic
1005929876 6:30475380-30475402 GCCAGCCGCCCCCTCCGGGAGGG + Intergenic
1006064595 6:31454522-31454544 GCCAGCCGCCCCCTCCGGGAGGG - Intergenic
1006064776 6:31454953-31454975 GGCAGCCGCCCCATCCGGGAGGG - Intergenic
1006065075 6:31455656-31455678 GGCAGCCGCCCCGTCCGGGAGGG - Intergenic
1006149038 6:31976277-31976299 GGCAGCCGCCCCCTCCAGGAGGG - Intronic
1006337434 6:33427990-33428012 CGCCGCCGCCCCCACCGCGCCGG + Intronic
1007902039 6:45422010-45422032 GGCCGCCGCTCCCCCCGCGCGGG - Intronic
1010030452 6:71266532-71266554 GCCAGCCGCTCCATCCGGGAGGG - Intergenic
1010239277 6:73601385-73601407 GGCAGCCGCCCCGTCCGGGAGGG + Intronic
1010239446 6:73601788-73601810 GCCAGCCGCTCCGTCCGGGAGGG + Intronic
1010245953 6:73660811-73660833 GGCAGCCACCCCCTCCGGGAGGG - Intergenic
1010513286 6:76744798-76744820 GCCAGCCGCCCCCTCCGGGAGGG + Intergenic
1012479372 6:99650264-99650286 GGCAGCCGCCCCGTCCGGGAGGG - Intergenic
1013575799 6:111482947-111482969 GGCGGCGGCTCCCTCCGCAGCGG + Exonic
1013679581 6:112508982-112509004 TGCCGCCGCCCCGTCCGGGAGGG - Intergenic
1014800363 6:125771000-125771022 GGCAGCCGCCCCCTCCGGGAGGG + Intergenic
1017493777 6:154966340-154966362 GGCAGCCGCCCCGTCCGGGAGGG - Intronic
1017660711 6:156670465-156670487 GGCCACCGCCCCGTCCGGGAGGG + Intergenic
1017672072 6:156778048-156778070 TGCCGCCGCTGCCGCCGCGGAGG - Exonic
1019314982 7:380145-380167 GGTCGCCCCTCCCTCCTCAAGGG + Intergenic
1019714992 7:2534439-2534461 GGCAGCCGCCCCGTCCGGGAGGG - Intergenic
1020204669 7:6105247-6105269 GGCCGCCGCCCCCTCCCCAGCGG - Intronic
1021120393 7:16790194-16790216 GGCAGCCGCCCCGTCCGGGAGGG - Intergenic
1021672380 7:23046345-23046367 GCCAGCCGCTCCGTCCGGGAGGG - Intergenic
1021991875 7:26148221-26148243 GGCAGCCGCCCCGTCCGGGAGGG + Intergenic
1021991898 7:26148269-26148291 GCCAGCCGCCCCCTCCGGGAGGG + Intergenic
1021991921 7:26148316-26148338 GCCAGCCGCCCCCTCCGGGAGGG + Intergenic
1021991944 7:26148363-26148385 GCCAGCCGCCCCCTCCGGGAGGG + Intergenic
1022083495 7:27045370-27045392 GCCAGCCGCTCCGTCCGGGAGGG + Intergenic
1022393282 7:29961792-29961814 GCCAGCCGCTCCGTCCGGGAGGG - Intronic
1023044231 7:36197263-36197285 GGCAGCCGCCCCGTCCGGGAGGG + Intronic
1023160577 7:37292710-37292732 GGCAGCCGCCCCGTCCGGGAGGG + Intronic
1024988948 7:55219772-55219794 GCCAGCCGCCCCGTCCGCGAGGG - Intronic
1025793713 7:64718178-64718200 GGCAGCCGCTCCATCCGGGAGGG + Intergenic
1026148959 7:67771946-67771968 GGCTGCCCCTCCCTCCACGCAGG - Intergenic
1026783274 7:73284112-73284134 GGCAGCCGCCCCGTCCGGGAGGG - Intergenic
1027087513 7:75275077-75275099 GCCAGCCGCCCCCTCCGGGAGGG + Intergenic
1027182911 7:75952429-75952451 GCCAGCCGCTCCGTCCGGGAGGG - Intronic
1029468687 7:100741400-100741422 GCCAGCCGCCCCGTCCGCGAGGG - Intronic
1029525719 7:101092550-101092572 GGCAGCCGCCCCGTCCGGGAGGG + Intergenic
1029569286 7:101359409-101359431 GGCAGCCGCCCCGTCCGGGAGGG - Intergenic
1030288331 7:107848355-107848377 GGCAGCCGCCCCGTCCGGGAGGG + Intergenic
1032291183 7:130591241-130591263 GCCAGCCGCTCCGTCCGGGAGGG + Intronic
1033323780 7:140362392-140362414 GGCAGCCGCCCCGTCCGGGAGGG + Intronic
1034361846 7:150506354-150506376 GCCCGCCGCCCCGTCCGGGAGGG - Intergenic
1034440992 7:151086175-151086197 GGCAGCTGTCCCCTCCGCGAGGG + Intronic
1034491617 7:151396016-151396038 GGCCGCGGCCTCCTCCGCGCAGG + Exonic
1035265588 7:157688965-157688987 GGCCGCAGCACCCTCCGCGCCGG - Intronic
1035869627 8:3123263-3123285 GGCCACCGCTGCCTCTGCCAGGG + Intronic
1036096001 8:5725521-5725543 GGCAGCCGCCCCGTCCGGGAGGG + Intergenic
1036536743 8:9657794-9657816 GGCAGCCGCCCCATCCGGGAGGG - Intronic
1036675267 8:10826680-10826702 GGCGGCCGCTGCCACCGCAATGG + Intronic
1036737209 8:11330078-11330100 GGCAGCCGCCCCATCCGGGAGGG + Intergenic
1038543936 8:28411727-28411749 CGCCGCCGCTCCCTGGCCGATGG - Intronic
1038883617 8:31640112-31640134 GGCCGCCGCCCCCGGCGCCAGGG - Intronic
1039488261 8:37928049-37928071 GCCAGCCGCCCCCTCCGGGAGGG + Intergenic
1040052819 8:43033089-43033111 GGCAGCCGCCCCGTCCGGGAGGG - Intronic
1042196079 8:66232468-66232490 GGCAGCCACTCCGTCCGGGAGGG + Intergenic
1042319696 8:67461706-67461728 GCCAGCCGCTCCATCCGGGAGGG - Intronic
1042336041 8:67630942-67630964 GGCCTCAGCTGCCTCCCCGAGGG + Intronic
1049177321 8:141202192-141202214 GCCAGCCGCCCCGTCCGCGAGGG - Intergenic
1050552133 9:6757960-6757982 CGCCGGCTCTCCCTGCGCGAGGG - Intronic
1052903989 9:33817739-33817761 CGCCGCCGCCGCCGCCGCGATGG + Exonic
1053114593 9:35490053-35490075 GGCGGCCCCTCCCTCCGGGCGGG - Intergenic
1055169828 9:73242621-73242643 GGCTGCCGCTCCCACAGCGAAGG - Intergenic
1056097860 9:83272982-83273004 GGCAGCCGCCCCGTCCGGGAGGG + Intronic
1056152518 9:83804095-83804117 GGCAGCCGCCCCGTCCGGGAGGG + Intronic
1056166852 9:83948401-83948423 GGCAGCCGCCCCGTCCGGGAGGG + Intronic
1056677231 9:88686057-88686079 GGCCGCAGCTGCCTCCCCGCGGG - Intergenic
1057155042 9:92831508-92831530 GCCAGCCGCCCCATCCGCGAGGG - Intergenic
1058722796 9:107776818-107776840 GCCAGCCGCCCCGTCCGCGAGGG + Intergenic
1058722976 9:107777225-107777247 GCCAGCCGCCCCGTCCGCGAGGG + Intergenic
1060350124 9:122852379-122852401 GGCAGCCGCCCCGTCCGGGAGGG + Intronic
1060351867 9:122867381-122867403 GCCAGCCGCTCCGTCCGGGAGGG + Intronic
1060352088 9:122868042-122868064 GCCAGCCGCTCCGTCCGGGAGGG + Intronic
1060703894 9:125780789-125780811 GGCAGCCGCCCCGTCCGGGAGGG - Intronic
1061914865 9:133744813-133744835 GGCAGCCGCCCCTTCCGGGAGGG + Intergenic
1203773676 EBV:61499-61521 CGCCGCCGCCCCCGCCGCGACGG - Intergenic
1203405758 Un_KI270539v1:777-799 GCCAGCCGCCCCCTCCGGGAGGG + Intergenic
1185892792 X:3835584-3835606 GGCCGCCGCATCCGCCGCGGCGG + Intronic
1185897900 X:3874004-3874026 GGCCGCCGCATCCGCCGCGGCGG + Intergenic
1185903019 X:3912435-3912457 GGCCGCCGCATCCGCCGCGGCGG + Intergenic
1186922952 X:14302691-14302713 GGCAGCCGCCCCGTCCGGGAGGG - Intergenic
1190159058 X:48017106-48017128 GGCAGCCGCCCCGTCCGGGAGGG + Intronic
1190174743 X:48139294-48139316 GGCAGCCGCCCCATCCGGGAGGG + Intergenic
1190184544 X:48222554-48222576 GGCAGCCGCCCCGTCCGGGAGGG + Intronic
1190505143 X:51119390-51119412 GCCAGCCGCTCCGTCCGGGAGGG - Intergenic
1192768549 X:74166593-74166615 GGCAGCCGCCCCGTCCGGGAGGG + Intergenic
1192768640 X:74166802-74166824 GCCAGCCGCCCCCTCCGGGAGGG + Intergenic
1192768937 X:74167478-74167500 GCCAGCCGCTCCGTCCGGGAGGG + Intergenic
1192794172 X:74412699-74412721 GGCAGCCGCCCCGTCCGGGAGGG - Intergenic
1193924382 X:87466155-87466177 GGCAGCCGCCCCGTCCGGGAGGG + Intergenic
1196404222 X:115347146-115347168 GCCAGCCGCTCCGTCCGGGAGGG - Intergenic
1197766155 X:130060573-130060595 GGCCGCGGCCGCCTCCGCCAGGG + Intergenic
1199736841 X:150693475-150693497 GGCCGCCGCTCCCGTCCCGACGG + Exonic
1199772571 X:150983977-150983999 GGCCACCGGGCGCTCCGCGACGG - Intronic
1201282248 Y:12352231-12352253 GACAGCCGCTCCATCCGGGAGGG + Intergenic