ID: 1088254059

View in Genome Browser
Species Human (GRCh38)
Location 11:107886529-107886551
Sequence CTATGAGAATGTAATCAAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 620
Summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 583}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088254052_1088254059 22 Left 1088254052 11:107886484-107886506 CCTAATCCAGGTACCTGTGAATG 0: 1
1: 0
2: 11
3: 55
4: 362
Right 1088254059 11:107886529-107886551 CTATGAGAATGTAATCAAGTAGG 0: 1
1: 0
2: 2
3: 34
4: 583
1088254053_1088254059 16 Left 1088254053 11:107886490-107886512 CCAGGTACCTGTGAATGTGACCT 0: 31
1: 176
2: 504
3: 1224
4: 2089
Right 1088254059 11:107886529-107886551 CTATGAGAATGTAATCAAGTAGG 0: 1
1: 0
2: 2
3: 34
4: 583
1088254058_1088254059 -4 Left 1088254058 11:107886510-107886532 CCTTATTTGGAAATAGGGTCTAT 0: 1
1: 288
2: 980
3: 1683
4: 2159
Right 1088254059 11:107886529-107886551 CTATGAGAATGTAATCAAGTAGG 0: 1
1: 0
2: 2
3: 34
4: 583
1088254054_1088254059 9 Left 1088254054 11:107886497-107886519 CCTGTGAATGTGACCTTATTTGG 0: 173
1: 545
2: 1279
3: 2072
4: 2817
Right 1088254059 11:107886529-107886551 CTATGAGAATGTAATCAAGTAGG 0: 1
1: 0
2: 2
3: 34
4: 583

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088254059 Original CRISPR CTATGAGAATGTAATCAAGT AGG Intronic
905697143 1:39983070-39983092 TTATGCCACTGTAATCAAGTAGG - Intergenic
907780880 1:57564817-57564839 CAAGGAGAATGGAACCAAGTTGG + Intronic
908584033 1:65549407-65549429 CTTGGAGAATGGAACCAAGTTGG - Intronic
909307289 1:74097448-74097470 CAAGGAGAATGGAACCAAGTTGG + Intronic
909487093 1:76186432-76186454 CTATGAGAATGGAATGAAGGAGG - Intronic
909689988 1:78396837-78396859 TGATGAGAATGGAACCAAGTTGG - Intronic
910266297 1:85341441-85341463 CTAAGAAAATGGAATGAAGTTGG + Intronic
910619203 1:89234834-89234856 CGAGGAGAATGGAACCAAGTTGG - Intergenic
910642159 1:89474781-89474803 CAGTGAGAATGGAACCAAGTTGG + Intergenic
912061485 1:105676978-105677000 TTATGAGAATTAAATAAAGTTGG + Intergenic
912171512 1:107106175-107106197 CTAAGAGAATGAAGTCAAGTTGG - Intergenic
913078127 1:115358867-115358889 CTGGGAGAATGGAACCAAGTTGG + Intergenic
914369285 1:147008062-147008084 CAGAGAGAATGGAATCAAGTTGG + Intergenic
915046301 1:153019859-153019881 CTGGGAGAATGGAACCAAGTTGG + Intergenic
915869209 1:159539740-159539762 CGGGGAGAATGGAATCAAGTTGG + Intergenic
916612652 1:166408524-166408546 CAGTGAGAATGGAAACAAGTTGG - Intergenic
917009624 1:170456639-170456661 CTGAGAGAATGGAACCAAGTTGG - Intergenic
917044627 1:170845473-170845495 ATATGAGAATGTATTAAAGATGG - Intergenic
917267167 1:173233372-173233394 CTGGGAGAATGGAACCAAGTTGG + Intergenic
917391673 1:174544193-174544215 CAAGGAGAATGGAACCAAGTTGG - Intronic
917573536 1:176295672-176295694 CTGGGAGAATGGAACCAAGTTGG - Intergenic
918353607 1:183683763-183683785 CAGGGAGAATGGAATCAAGTTGG - Intronic
920993522 1:210963835-210963857 CTGGGAGAATGAAACCAAGTTGG + Intronic
921331780 1:214046121-214046143 CTTTTAGAATGTAAACAAATAGG - Intergenic
921484701 1:215702417-215702439 CAAGGAGAATGGAACCAAGTTGG - Intronic
921842275 1:219840866-219840888 CGGGGAGAATGGAATCAAGTTGG + Intronic
922627492 1:227064208-227064230 AAATGAGAATGTACTCAACTTGG - Intronic
922693723 1:227714948-227714970 CAAGGATAATGGAATCAAGTTGG + Intergenic
924828864 1:247571797-247571819 CGGGGAGAATGGAATCAAGTTGG - Intronic
1063528621 10:6808742-6808764 CTGGGAGAATGGAACCAAGTTGG - Intergenic
1064761820 10:18628797-18628819 CGGGGAGAATGGAATCAAGTTGG + Intronic
1065907807 10:30273654-30273676 CAAGGAGAATGGAACCAAGTAGG + Intergenic
1067127482 10:43532055-43532077 CAAGGAGAATGGAACCAAGTTGG - Intergenic
1067162034 10:43835172-43835194 CAGGGAGAATGGAATCAAGTTGG - Intergenic
1068214805 10:53969401-53969423 CAGTGAGAATGGAACCAAGTTGG + Intronic
1068567769 10:58594269-58594291 CGAGGAGAATGGAACCAAGTTGG + Intronic
1069120667 10:64566056-64566078 CAGAGAGAATGGAATCAAGTTGG - Intergenic
1070516078 10:77208204-77208226 CTAAGAGAAGGGAATCAAGCTGG - Intronic
1070980328 10:80640386-80640408 CGAGGAGAATGGAACCAAGTTGG - Intronic
1071373104 10:84973486-84973508 CAAGGAGAATGGAACCAAGTTGG + Intergenic
1071763261 10:88633202-88633224 CGGGGAGAATGTAACCAAGTTGG - Intergenic
1071900653 10:90117664-90117686 CTGGGAGAATGGAACCAAGTTGG - Intergenic
1071975703 10:90953894-90953916 CGAGGAGAATGGAACCAAGTGGG - Intergenic
1072045044 10:91645704-91645726 CAAGGAGAATGGAACCAAGTTGG + Intergenic
1072388648 10:94959230-94959252 CGAGGAGAATGGAACCAAGTTGG - Intronic
1073117503 10:101099855-101099877 GTATGAGAGTGTAAACATGTGGG + Intronic
1073716766 10:106116141-106116163 CAGGGAGAATGGAATCAAGTTGG + Intergenic
1077591720 11:3497548-3497570 CAGTGAGAATGGAACCAAGTTGG - Intergenic
1078499475 11:11855989-11856011 CTGTGAGAATGTAATCACAAAGG + Intronic
1079026600 11:16953225-16953247 CTCTGAGATTGTAATCCAATAGG - Intronic
1079165347 11:18035833-18035855 CTATCAGACTGTAAGCAATTTGG + Intronic
1079629021 11:22651517-22651539 CGAGGAGAATGGAACCAAGTTGG - Intronic
1079653046 11:22954594-22954616 CTATGAAAATCTGATTAAGTAGG + Intergenic
1080118097 11:28642800-28642822 CGAGGAGAATGGAACCAAGTTGG + Intergenic
1080378501 11:31742289-31742311 CGGTGAGAATGGAACCAAGTTGG + Intronic
1081180996 11:39985582-39985604 CGAGGAGAATGAAAGCAAGTTGG + Intergenic
1081252188 11:40849734-40849756 CAGGGAGAATGGAATCAAGTTGG - Intronic
1081442853 11:43099604-43099626 CGGTGAGAATGGAACCAAGTTGG - Intergenic
1082137488 11:48566177-48566199 CAGGGAGAATGGAATCAAGTTGG - Intergenic
1082279619 11:50257756-50257778 CTGGGAGAATGGAACCAAGTTGG - Intergenic
1082578608 11:54839392-54839414 CGGGGAGAATGGAATCAAGTTGG + Intergenic
1083532014 11:63431831-63431853 CAAGGAGAATGGAACCAAGTTGG + Intergenic
1084825267 11:71725228-71725250 CAGTGAGAATGGAACCAAGTTGG + Intergenic
1085434031 11:76482795-76482817 CAGGGAGAATGGAATCAAGTTGG + Intronic
1085691590 11:78668703-78668725 CTATGAAAATGTAATAATGGTGG + Intronic
1085850236 11:80110887-80110909 CAGAGAGAATGGAATCAAGTTGG + Intergenic
1086175425 11:83885491-83885513 CGAGGAGAATGGAATCAAGCTGG + Intronic
1086312131 11:85547582-85547604 CAAGGAGAATGGAACCAAGTTGG - Intronic
1086320372 11:85640661-85640683 GTTTGCAAATGTAATCAAGTTGG + Intergenic
1086410877 11:86542697-86542719 CGAGGAGAATGGAACCAAGTTGG + Intronic
1086422068 11:86646595-86646617 CGAGGAGAATGGAACCAAGTTGG + Intronic
1086662210 11:89432857-89432879 CTATAAAAATGTATACAAGTAGG + Intronic
1087072792 11:94098611-94098633 CGAGGAGAATGGAATCAAGTTGG - Intronic
1087354149 11:97073251-97073273 ATAGGAGAATGGAACCAAGTTGG - Intergenic
1087782431 11:102315512-102315534 CAATGATAATGTAATCAAAGAGG + Intergenic
1088096326 11:106105114-106105136 CTATCACAATGTAGTCAAGAGGG + Intergenic
1088254059 11:107886529-107886551 CTATGAGAATGTAATCAAGTAGG + Intronic
1088490915 11:110387362-110387384 CGGGGAGAATGGAATCAAGTTGG - Intergenic
1089765870 11:120765054-120765076 CGGGGAGAATGGAATCAAGTTGG - Intronic
1090106285 11:123856180-123856202 CAAGGAGAATGAAATCAAATTGG + Intergenic
1090318558 11:125819483-125819505 CAGGGAGAATGGAATCAAGTTGG + Intergenic
1091493482 12:952526-952548 CTTTGTAGATGTAATCAAGTAGG + Intronic
1092010215 12:5103837-5103859 CTCTGAGAAGGAAATCAAATTGG + Intergenic
1092562536 12:9631863-9631885 CGAGGAGAATGGAACCAAGTTGG - Intergenic
1093764083 12:22942653-22942675 CTCTGAGATTGTGATCAAGCAGG + Intergenic
1095065180 12:37763236-37763258 CGGGGAGAATGGAATCAAGTTGG + Intergenic
1095217602 12:39568224-39568246 CGGGGAGAATGGAATCAAGTTGG - Intronic
1095330556 12:40956698-40956720 CCTAGAGAATGGAATCAAGTTGG + Intronic
1095424921 12:42064513-42064535 CAGGGAGAATGGAATCAAGTTGG + Intergenic
1095490056 12:42724413-42724435 CAGTGAGAATGGAACCAAGTTGG - Intergenic
1095832201 12:46600180-46600202 CGAGGAGAATGGAACCAAGTTGG - Intergenic
1095854961 12:46850090-46850112 CGAGGAGAATGGAACCAAGTTGG + Intergenic
1096891761 12:54778276-54778298 CAGGGAGAATGAAATCAAGTTGG + Intergenic
1097340084 12:58427409-58427431 CAAGGAGAATGGAACCAAGTTGG + Intergenic
1097569786 12:61318250-61318272 CGAGGAGAATGGAACCAAGTTGG + Intergenic
1097763202 12:63492726-63492748 CGAGGAGAATGGAACCAAGTTGG - Intergenic
1098317899 12:69211388-69211410 CTAAGAAAATATATTCAAGTGGG + Intergenic
1098749228 12:74274178-74274200 ATATGAAAACCTAATCAAGTAGG - Intergenic
1099030993 12:77525307-77525329 CAAGGAGAATGGAACCAAGTTGG + Intergenic
1099293092 12:80796500-80796522 CTATGGGAATATATTAAAGTTGG + Exonic
1099502528 12:83431595-83431617 TGGTGAGAATGGAATCAAGTTGG - Intergenic
1099744820 12:86688943-86688965 CAAGGAGAATGGAACCAAGTTGG - Intronic
1100720585 12:97354007-97354029 CGGGGAGAATGGAATCAAGTTGG - Intergenic
1102096924 12:110248259-110248281 CTGTGAGAATTCAAACAAGTTGG + Intergenic
1105224670 13:18419822-18419844 CTCTAAGAATGTAATAAATTTGG + Intronic
1106094899 13:26635085-26635107 CAGGGAGAATGGAATCAAGTTGG - Intronic
1106472795 13:30072581-30072603 CTATAAGAAGGGAATCCAGTTGG + Intergenic
1108153936 13:47565446-47565468 CGAGGAGAATGGAACCAAGTTGG + Intergenic
1108173815 13:47772089-47772111 CTGGGAGAATGGAACCAAGTTGG - Intergenic
1108316917 13:49245791-49245813 CTATGAGAATGGTATCTAGATGG + Intergenic
1108755575 13:53498032-53498054 CTATGAGAATGTATATAAGCGGG + Intergenic
1108957832 13:56183067-56183089 CCAGGAGAATGGAACCAAGTTGG + Intergenic
1109528149 13:63603692-63603714 CTAATCGACTGTAATCAAGTAGG + Intergenic
1110631107 13:77709304-77709326 CTGGGAGAATGGAACCAAGTTGG + Intronic
1111360523 13:87168870-87168892 ATATAAGAATGCTATCAAGTTGG + Intergenic
1112860862 13:103828625-103828647 CGAGGAGAATGGAACCAAGTTGG - Intergenic
1113288696 13:108881839-108881861 CGAGGAGAATGGAACCAAGTTGG + Intronic
1113348647 13:109506879-109506901 CGAGGAGAATGGAACCAAGTTGG - Intergenic
1113529357 13:111009699-111009721 TTAAGAAAATGTAATAAAGTTGG + Intergenic
1113580058 13:111422190-111422212 GTATGATAAAGAAATCAAGTTGG - Intergenic
1115162180 14:30409065-30409087 CAGGGAGAATGTAACCAAGTTGG - Intergenic
1115339240 14:32274243-32274265 CGAGGAGAATGGAACCAAGTTGG + Intergenic
1115827617 14:37294847-37294869 CGGGGAGAATGGAATCAAGTTGG + Intronic
1116262327 14:42646466-42646488 CGAGGAGAATGGAACCAAGTTGG + Intergenic
1116588418 14:46739840-46739862 CTATGACAGTGTACTCTAGTAGG - Intergenic
1116634578 14:47378760-47378782 CAAAGAGAATGGAACCAAGTTGG + Intronic
1117019675 14:51556989-51557011 CTATAAGAAAGTAATAAACTGGG + Intronic
1117576581 14:57105084-57105106 CGGGGAGAATGGAATCAAGTTGG - Intergenic
1117635768 14:57741630-57741652 CTGGGAGAATGGAACCAAGTTGG + Intronic
1117787781 14:59305009-59305031 CTTTCAGAATGTCATAAAGTAGG - Intronic
1118067015 14:62203704-62203726 CAGGGAGAATGGAATCAAGTTGG - Intergenic
1118216044 14:63809451-63809473 CTATGATCCTATAATCAAGTGGG + Intergenic
1119154803 14:72399931-72399953 CTGGGAGAATGGAACCAAGTTGG + Intronic
1120069819 14:80090059-80090081 CCAGGAGAATGGAACCAAGTTGG + Intergenic
1120233074 14:81860294-81860316 CCAGGAGAATGGAACCAAGTTGG + Intergenic
1120390355 14:83899377-83899399 CCATGAGAACATAAACAAGTAGG - Intergenic
1120569554 14:86100615-86100637 CGAGGAGAATGGAACCAAGTTGG - Intergenic
1120582169 14:86265915-86265937 TGAGGAGAATGGAATCAAGTTGG - Intergenic
1120584692 14:86297485-86297507 TTCTGGGAATGTAATCCAGTAGG + Intergenic
1120728575 14:87976256-87976278 TTCTGAGAATGTAATCAAATGGG + Intronic
1121043892 14:90774123-90774145 GGATGAGAATGTGATCCAGTTGG + Intronic
1121190388 14:92023316-92023338 TTATGAGAATGTTCTCAAATTGG - Intronic
1124197091 15:27640694-27640716 CAGGGAGAATGGAATCAAGTTGG + Intergenic
1125772773 15:42182339-42182361 AAATGAGAACGTATTCAAGTGGG - Intronic
1126470600 15:49006345-49006367 CGAGGAGAATGGAACCAAGTTGG - Intronic
1126889114 15:53184767-53184789 CGGGGAGAATGGAATCAAGTTGG + Intergenic
1127963105 15:63904809-63904831 ATATCAGGATGAAATCAAGTTGG + Intergenic
1129563374 15:76594370-76594392 CTGGGAGAATGGAACCAAGTTGG + Intronic
1130452754 15:84073614-84073636 CTGGGAGAATGGAACCAAGTTGG + Intergenic
1130728392 15:86465001-86465023 CAAGGAGAATGGAACCAAGTTGG - Intronic
1130779334 15:87018162-87018184 AGATGAGAATGGAACCAAGTTGG + Intronic
1131477900 15:92756152-92756174 CTGGGAGAATGGAACCAAGTTGG + Intronic
1132154129 15:99483725-99483747 GTATAAAAATGTAATCAGGTTGG - Intergenic
1132254818 15:100366674-100366696 CGAGGAGAATGGAACCAAGTTGG + Intergenic
1134793083 16:17008830-17008852 CAGGGAGAATGGAATCAAGTTGG - Intergenic
1135405927 16:22197828-22197850 CAATAAGAAACTAATCAAGTGGG + Intergenic
1136603087 16:31310293-31310315 CGGGGAGAATGGAATCAAGTTGG - Intronic
1136675833 16:31905384-31905406 CGAGGAGAATGGAACCAAGTTGG - Intronic
1136992042 16:35158909-35158931 CCAGGAGAATGAAACCAAGTTGG + Intergenic
1137051771 16:35720423-35720445 CAGGGAGAATGGAATCAAGTTGG - Intergenic
1137356290 16:47768454-47768476 CTGGGAGAATGGAACCAAGTTGG + Intergenic
1137525251 16:49229614-49229636 CAAGGAGAATGGAACCAAGTTGG + Intergenic
1138357294 16:56392757-56392779 CGGGGAGAATGGAATCAAGTTGG + Intronic
1140991942 16:80221228-80221250 CGAGGAGAATGGAACCAAGTTGG + Intergenic
1141275485 16:82583961-82583983 CTAAGTGTTTGTAATCAAGTGGG - Intergenic
1142914746 17:3127146-3127168 TGATCAGAATGTAATGAAGTGGG + Exonic
1143973561 17:10813461-10813483 CTATGAGAATGTGATAAAGAGGG + Intergenic
1144616740 17:16782939-16782961 CAAGGAGAATGGAACCAAGTTGG - Intronic
1144895951 17:18532722-18532744 CAAGGAGAATGGAACCAAGTTGG + Intergenic
1145136262 17:20411498-20411520 CAAGGAGAATGGAACCAAGTTGG - Intergenic
1146817250 17:35952694-35952716 CAAGGAGAATGCAACCAAGTTGG - Intergenic
1148470210 17:47888609-47888631 CTCTGAGAATGTGATGGAGTTGG - Intergenic
1149229541 17:54517752-54517774 CTAGGAGAATGTAAACAAGCTGG - Intergenic
1149255556 17:54822199-54822221 CGGGGAGAATGTAACCAAGTTGG + Intergenic
1150088656 17:62299365-62299387 CCTTGAGATTGTGATCAAGTAGG + Intergenic
1150094249 17:62358492-62358514 CGGGGAGAATGCAATCAAGTTGG + Intergenic
1150173754 17:63027910-63027932 CTATGAAAATGGAATGAGGTGGG - Intronic
1150527973 17:65943808-65943830 CAGGGAGAATGGAATCAAGTTGG - Intronic
1153702790 18:7712913-7712935 CAAGGAGAATGGAACCAAGTTGG + Intronic
1153743123 18:8150242-8150264 CGAGGAGAATGGAACCAAGTTGG - Intronic
1153790793 18:8577819-8577841 CGGGGAGAATGGAATCAAGTTGG - Intergenic
1154225007 18:12495388-12495410 ATATGACAATTTAATCAAGGAGG + Intronic
1154528686 18:15319628-15319650 CTCTAAGAATGTAATAAATTTGG - Intergenic
1155350692 18:24902656-24902678 CGAGGAGAATGGAACCAAGTTGG + Intergenic
1157998006 18:52582985-52583007 CTTTGAGAATATAATCAACACGG + Intronic
1158067784 18:53433811-53433833 CTGTGAGTATGTAAGGAAGTAGG - Intronic
1158177014 18:54668777-54668799 CGGGGAGAATGGAATCAAGTTGG - Intergenic
1159109036 18:64035188-64035210 CTAGGAGATTGTAATCAAGTGGG - Intergenic
1159854442 18:73567108-73567130 CTATGAAAATGTAACCATGAAGG + Intergenic
1164067141 19:21725979-21726001 CTGTGCGAATGTAATAAAGTTGG - Exonic
1164341910 19:24410517-24410539 CGGGGAGAATGGAATCAAGTTGG - Intergenic
1164416763 19:28052246-28052268 CGAGGAGAATGGAACCAAGTTGG + Intergenic
1164423122 19:28115062-28115084 ATATGAGAATGTAATACAGAAGG + Intergenic
1164504651 19:28849819-28849841 CTATGAAAATGAAATCAATGGGG + Intergenic
1165038320 19:33050573-33050595 CTATGTAAATGTAATCAGATAGG + Intronic
1166429883 19:42715697-42715719 CGAGGAGAATGGAACCAAGTTGG + Intronic
1168530693 19:57126355-57126377 CGGGGAGAATGGAATCAAGTTGG - Intronic
925172890 2:1761457-1761479 CGAGGAGAATGGAACCAAGTTGG + Intergenic
925200053 2:1959832-1959854 ATATTAGGATGTAATCAAGAGGG + Intronic
926475213 2:13313556-13313578 CAGAGAGAATGGAATCAAGTTGG - Intergenic
926943818 2:18166784-18166806 CAAGGAGAATGGAACCAAGTTGG - Intronic
927422879 2:22951485-22951507 CTGTGAGACTGTACTCAACTTGG - Intergenic
928487807 2:31750051-31750073 CTGGGAGAATGGAACCAAGTTGG + Intergenic
928795495 2:35013976-35013998 CGGGGAGAATGGAATCAAGTTGG + Intergenic
929084273 2:38152789-38152811 GTATGAGAATGGAAACAAGAGGG - Intergenic
929272329 2:39986071-39986093 CTGGGAGAATGGAACCAAGTTGG + Intergenic
929333364 2:40711520-40711542 CAGGGAGAATGGAATCAAGTTGG - Intergenic
929405678 2:41638406-41638428 CCAGGAGAATGGAACCAAGTTGG + Intergenic
930440050 2:51393034-51393056 CAAGGAGAATGGAACCAAGTTGG + Intergenic
931478978 2:62621003-62621025 CAAGGAGAATGGAAACAAGTTGG - Intergenic
931860677 2:66351479-66351501 CGAGGAGAATGGAATCAAGTTGG - Intergenic
931886555 2:66624585-66624607 CGAGGAGAATGGAACCAAGTTGG - Intergenic
931905575 2:66839190-66839212 CCAGGAGAATGTAATCCAGGAGG + Intergenic
931971382 2:67590451-67590473 CAAGGAGAATGGAACCAAGTTGG + Intergenic
932019204 2:68065292-68065314 CTGGGAGAATGGAACCAAGTTGG + Intronic
932384290 2:71316856-71316878 CTTTGAGAATGGAAGCATGTAGG - Intronic
932810908 2:74825393-74825415 CTATGGAAAAGTAAACAAGTAGG - Intergenic
933240487 2:79915796-79915818 CTATCAGAATTTATTTAAGTTGG + Intronic
933844140 2:86311687-86311709 CTTTGCAAATGTAATCAAGTTGG - Intronic
934192507 2:89812621-89812643 CGAATGGAATGTAATCAAGTGGG - Intergenic
934723175 2:96596250-96596272 CTCTGAGAATGTAGTAAAGGAGG + Intronic
935399594 2:102645846-102645868 CAGGGAGAATGTAATCAAGGTGG + Intronic
935631102 2:105212940-105212962 CTGGGAGAATGGAACCAAGTTGG - Intergenic
935861222 2:107332261-107332283 CTCTGTGAAGGTAATCATGTTGG + Intergenic
936900271 2:117474074-117474096 CGGGGAGAATGGAATCAAGTTGG + Intergenic
937741391 2:125358889-125358911 CGGGGAGAATGGAATCAAGTTGG + Intergenic
938046856 2:128129320-128129342 CTTTGTGTATGTAATAAAGTAGG + Intronic
938442199 2:131346098-131346120 CGGGGAGAATGTAACCAAGTTGG - Intronic
938618337 2:133022531-133022553 CTCTGGGAATCTTATCAAGTAGG + Intronic
941230932 2:162912148-162912170 CCATGAGAGTGGTATCAAGTTGG - Intergenic
941260213 2:163288053-163288075 CTATGAAAATGTAATCACCCAGG + Intergenic
941425993 2:165346304-165346326 CTGGGAGAATGGAACCAAGTTGG - Intronic
942989339 2:182180683-182180705 CTGGGAGAATGGAATCAAGTTGG - Intronic
943085642 2:183307610-183307632 CTCTGAGAATGGAATATAGTGGG + Intergenic
943130812 2:183850925-183850947 CAAGGAGAATGGAACCAAGTTGG + Intergenic
943608690 2:190006716-190006738 ATATGAGAATTTAAACAAGTAGG + Intronic
944033742 2:195268288-195268310 CAGGGAGAATGGAATCAAGTTGG - Intergenic
944037122 2:195308468-195308490 TTATGAGGATGTAATCCACTGGG + Intergenic
944077210 2:195745398-195745420 CGAGGAGAATGGAACCAAGTTGG + Intronic
944629972 2:201614102-201614124 CAGAGAGAATGGAATCAAGTTGG + Intronic
945460299 2:210100140-210100162 CTATGAGAATCTAATGCTGTGGG - Intronic
945849968 2:214993564-214993586 CTATTTGAATATAATTAAGTGGG + Intronic
945991211 2:216396804-216396826 TCATGAGATTGTAATCAAGATGG + Intergenic
946797076 2:223366306-223366328 TTTTGAGACTGTAATCAAGAGGG - Intergenic
946966090 2:225039973-225039995 CTATGAGTCTGTACTGAAGTCGG + Intronic
946979647 2:225195343-225195365 CTCTAATAATGTAATGAAGTAGG + Intergenic
948632025 2:239308384-239308406 CCATGAGGCTGTAATCAACTTGG + Intronic
948970628 2:241423006-241423028 CAGGGAGAATGGAATCAAGTTGG + Intronic
1170720294 20:18871997-18872019 CTGGGAGAATGAAACCAAGTTGG - Intergenic
1171281303 20:23901445-23901467 CTGGGAGAATGGAACCAAGTTGG - Intergenic
1171397756 20:24849273-24849295 CTGGGAGAATGGAACCAAGTTGG - Intergenic
1171776188 20:29370655-29370677 CGAGGAGAATGGAACCAAGTTGG - Intergenic
1171786521 20:29470754-29470776 CGAGGAGAATGGAACCAAGTTGG - Intergenic
1173764428 20:45594624-45594646 CTGGGAGAATGAAACCAAGTAGG - Intergenic
1174365129 20:50052032-50052054 CTCTGAGAATCTAATGATGTGGG + Intergenic
1174377854 20:50138423-50138445 CTATGAGAAGTTAATAAAATGGG + Intronic
1175041106 20:56051405-56051427 CGAGGAGAATGGAACCAAGTTGG + Intergenic
1176768722 21:13048883-13048905 CTCTAAGAATGTAATAAATTTGG + Intergenic
1176930275 21:14801625-14801647 CAAGGAGAATGGAACCAAGTTGG + Intergenic
1177686973 21:24449585-24449607 CTATGAGAATTTAAACAGGTGGG - Intergenic
1177763923 21:25435000-25435022 CTGGGAGAATGGAACCAAGTTGG + Intergenic
1177779047 21:25603304-25603326 CTATGTGAATGTTAACAGGTAGG + Intronic
1178969703 21:37162208-37162230 CTATATAAATGTAATCAAGATGG - Intronic
1179902632 21:44401939-44401961 CTATGAGAATGCAGCCAAGTGGG - Intronic
1182162289 22:28134741-28134763 CGAGGAGAATGGAACCAAGTTGG + Intronic
1182167724 22:28192834-28192856 CTGAGAGAATGCAAACAAGTTGG + Intronic
1182203547 22:28599122-28599144 ATTTGAGAATATAATCAAGAAGG + Intronic
1182909553 22:33970679-33970701 TTATGAGAATGAACTCGAGTTGG - Intergenic
949425399 3:3910326-3910348 CGGTGAGAATGGAACCAAGTTGG + Intronic
949754679 3:7395314-7395336 CTATGATCATGTATTCAAGTTGG + Intronic
949881663 3:8666004-8666026 CTAAGACAACTTAATCAAGTGGG - Intronic
950792508 3:15484514-15484536 CGGGGAGAATGGAATCAAGTTGG - Intronic
951167414 3:19499333-19499355 CAAGGAGAATGGAACCAAGTTGG + Intronic
951175552 3:19594858-19594880 CAAGGAGAATGGAACCAAGTTGG - Intergenic
951183014 3:19681274-19681296 CTGGGAGAATGGAACCAAGTTGG - Intergenic
951949378 3:28182490-28182512 CTGGGAGAATGGAACCAAGTTGG - Intergenic
951964600 3:28368757-28368779 CAAGGAGAATGGAACCAAGTTGG - Intronic
952104325 3:30051656-30051678 CAAGGAGAATGGAACCAAGTGGG + Intergenic
952319627 3:32263993-32264015 CAAGGAGAATGCAACCAAGTTGG + Intronic
952517557 3:34121166-34121188 CAGGGAGAATGGAATCAAGTTGG - Intergenic
952587074 3:34905654-34905676 CTGGGAGAATGGAACCAAGTTGG + Intergenic
952602807 3:35105319-35105341 CAAGGAGAATGGAACCAAGTTGG + Intergenic
952668811 3:35940913-35940935 CTATGGGAATGGTATCCAGTAGG + Intergenic
954978525 3:54722008-54722030 CAAGGAGAATGGAACCAAGTTGG - Intronic
955048977 3:55390251-55390273 CAAGGAGAATGGAACCAAGTTGG + Intergenic
956157751 3:66316715-66316737 CAAGGAGAATGGAACCAAGTTGG - Intronic
956382900 3:68685026-68685048 CAAGGAGAATAGAATCAAGTTGG - Intergenic
956589338 3:70897410-70897432 CTGGGAGAATGGAACCAAGTTGG - Intergenic
956993434 3:74795754-74795776 CAGTGAGAATGGAACCAAGTTGG + Intergenic
957101688 3:75836357-75836379 CAAGGAGAATGGAACCAAGTTGG - Intergenic
957723391 3:84033027-84033049 CCATGAGAATGTCCCCAAGTTGG + Intergenic
957727652 3:84088165-84088187 CTGGGAGAATGGAACCAAGTTGG + Intergenic
957780670 3:84814368-84814390 CGGGGAGAATGGAATCAAGTTGG - Intergenic
957948686 3:87096843-87096865 CGAAGAGAATGGAATCAAGTTGG - Intergenic
957953883 3:87159396-87159418 CTATGAATAAGAAATCAAGTAGG + Intergenic
957972614 3:87402672-87402694 CGAGGAGAATGGAACCAAGTTGG - Intergenic
958618610 3:96528206-96528228 CGAGGAGAATGGAATCAAGTTGG + Intergenic
958622069 3:96574880-96574902 CGAGGAGAATGGAACCAAGTTGG - Intergenic
958650348 3:96929822-96929844 CAAGGAGAATGGAATCAACTTGG - Intronic
958793739 3:98683415-98683437 CGGGGAGAATGGAATCAAGTTGG + Intergenic
959354529 3:105308891-105308913 CTGGGAGAATGGAACCAAGTTGG - Intergenic
959506077 3:107157540-107157562 CTGGGAGAATGGAACCAAGTTGG + Intergenic
959508534 3:107182178-107182200 CTATGTGAATTTTATCAAGAAGG + Intergenic
959953857 3:112212749-112212771 CAGGGAGAATGGAATCAAGTTGG + Intronic
959955918 3:112238055-112238077 CGAGGAGAATGGAACCAAGTTGG - Intronic
960211781 3:114976775-114976797 CTTTGACAATGTAATCTAGTGGG - Intronic
960278328 3:115752419-115752441 CTGGGAGAATGGAATCAAGTTGG + Intergenic
960339438 3:116456722-116456744 CTGGGAGAATGGAACCAAGTTGG + Intronic
960568921 3:119166024-119166046 CTTGGAGAATGGAACCAAGTTGG + Intronic
960727968 3:120690444-120690466 TTAAGAGAAGGTAATCAGGTTGG - Exonic
961230528 3:125303495-125303517 CTATGAGAATTTAATGCTGTCGG - Intronic
962699355 3:137981372-137981394 CAAGGAGAATGGAACCAAGTTGG + Intergenic
963050587 3:141139932-141139954 CTGGGAGAATGGAACCAAGTTGG - Intronic
963998402 3:151738591-151738613 CAAGGAGAATGGAATCAAGCTGG - Intronic
964183498 3:153914784-153914806 CAAGGAGAATGGAACCAAGTTGG + Intergenic
964270165 3:154946699-154946721 CGGGGAGAATGGAATCAAGTAGG + Intergenic
964423244 3:156526825-156526847 CTATGAGAAAGGAATAAAATGGG + Intronic
964591902 3:158374070-158374092 CTATGTGCATATAATAAAGTTGG - Intronic
964950749 3:162289662-162289684 CTCTGGGAATGTAAACAAGGAGG - Intergenic
965621781 3:170649740-170649762 CAAGGAGAATGGAACCAAGTTGG - Intronic
966115152 3:176452764-176452786 CGAGGAGAATGGAACCAAGTTGG - Intergenic
966232123 3:177663954-177663976 CGAGGAGAATGGAACCAAGTTGG - Intergenic
966291341 3:178362657-178362679 CAGAGAGAATGGAATCAAGTTGG + Intergenic
966487336 3:180485921-180485943 CAAGGAGAATGGAACCAAGTTGG + Intergenic
966494263 3:180561480-180561502 CAAGGAGAATGGAACCAAGTTGG + Intergenic
969123231 4:4924916-4924938 CTGGGAGAATGGAACCAAGTTGG - Intergenic
969747225 4:9082073-9082095 CAGTGAGAATGGAACCAAGTTGG + Intergenic
970351764 4:15208568-15208590 CTATGAGAAAGCAATGAAGATGG - Intergenic
970667788 4:18358007-18358029 CTCTGGGATTGTAGTCAAGTGGG + Intergenic
970775574 4:19670092-19670114 CTGGGAGAATGGAATCAAGTTGG + Intergenic
972061033 4:34873737-34873759 CGGGGAGAATGGAATCAAGTTGG + Intergenic
972755726 4:42043612-42043634 CTGGGAGAATGGAACCAAGTTGG + Intronic
973347207 4:49069386-49069408 CAAGGAGAATGGAACCAAGTTGG + Intergenic
973562797 4:52153000-52153022 CAAGGAGAATGGAACCAAGTTGG + Intergenic
973693660 4:53467884-53467906 CGAGGAGAATGGAACCAAGTTGG + Intronic
974840992 4:67299578-67299600 CGGGGAGAATGGAATCAAGTTGG - Intergenic
974887473 4:67837553-67837575 CTAGCAGAATGTAACCAACTTGG + Intronic
975062301 4:70018247-70018269 CGAGGAGAATGGAACCAAGTTGG - Intergenic
975206814 4:71653525-71653547 CCATGAGAATTTAACCATGTCGG + Intergenic
975479491 4:74861359-74861381 CAGAGAGAATGGAATCAAGTCGG + Intergenic
976092872 4:81475181-81475203 CTAGGAGAATGGAATCAAGTTGG + Intronic
976156717 4:82153492-82153514 CGAGGAGAATGGAACCAAGTTGG + Intergenic
976167765 4:82273294-82273316 CGAGGAGAATGGAACCAAGTTGG + Intergenic
976363204 4:84204159-84204181 CAAGGAGAATGGAACCAAGTTGG + Intergenic
976451375 4:85195053-85195075 CTGGGAGAATGAAACCAAGTTGG - Intergenic
976532370 4:86169607-86169629 CTGGGAGAATGGAACCAAGTTGG + Intronic
976837391 4:89390737-89390759 CGAGGAGAATGGAACCAAGTTGG + Intergenic
977038097 4:91979618-91979640 CTGGGAGAATGGAACCAAGTTGG + Intergenic
977108539 4:92920946-92920968 CTGGGAGAATGGAACCAAGTTGG - Intronic
977164498 4:93678320-93678342 CTGGGAGAATGGAACCAAGTTGG + Intronic
977561178 4:98535630-98535652 CAAGGAGAATGGAACCAAGTTGG - Intronic
977897277 4:102379350-102379372 CTGGGAGAATGGAACCAAGTTGG - Intronic
978231584 4:106407044-106407066 CGGGGAGAATGGAATCAAGTGGG - Intergenic
978477103 4:109143503-109143525 CGGGGAGAATGGAATCAAGTTGG - Intronic
979017332 4:115451285-115451307 CAGGGAGAATGTAATCAAGTTGG - Intergenic
979236417 4:118405214-118405236 CAGGGAGAATGGAATCAAGTTGG + Intergenic
979516708 4:121617753-121617775 TGATGAGAATGGAACCAAGTTGG + Intergenic
980261828 4:130459107-130459129 CCAGGAGAATGAAACCAAGTTGG - Intergenic
980503838 4:133689785-133689807 TGAGGAGAATGGAATCAAGTTGG - Intergenic
980599606 4:135004206-135004228 CTATGATAATGTATTAAAGAGGG + Intergenic
980626339 4:135379460-135379482 CAAGGAGAATGAAACCAAGTTGG - Intergenic
980778800 4:137469902-137469924 CTATGAGAATATATTCAAAATGG - Intergenic
980813651 4:137915655-137915677 CAGGGAGAATGGAATCAAGTTGG + Intergenic
980855378 4:138432914-138432936 CCAGGAGAATGAAACCAAGTTGG + Intergenic
981109249 4:140916585-140916607 CGGGGAGAATGGAATCAAGTTGG + Intronic
981149717 4:141367298-141367320 CGGTGAGAATGGAACCAAGTTGG - Intergenic
981283862 4:142992421-142992443 CGAGGAGAATGGAACCAAGTTGG + Intergenic
981439833 4:144770083-144770105 CTGGGAGAATGGAACCAAGTTGG + Intergenic
981534002 4:145780642-145780664 CTATGATAATGTCATAAAATAGG + Intronic
981547458 4:145909235-145909257 CTATGAGCAGGGAATCAAGAAGG - Intronic
982372457 4:154648436-154648458 CAGGGAGAATGAAATCAAGTTGG + Intronic
982815247 4:159876488-159876510 CAAAGAGAATGAAACCAAGTTGG - Intergenic
982825885 4:160003203-160003225 CGAGGAGAATGAAACCAAGTTGG + Intergenic
983140474 4:164143215-164143237 CTGGGAGAATGGAACCAAGTTGG + Intronic
983182847 4:164668908-164668930 CTGGGAGAATGGAAACAAGTTGG + Intergenic
983292158 4:165820416-165820438 CGGGGAGAATGGAATCAAGTTGG + Intergenic
983478801 4:168247728-168247750 CTATGGGACAGTAATGAAGTGGG + Intronic
983493824 4:168420508-168420530 CAATGAAAATGAAATGAAGTAGG + Intronic
984032351 4:174619673-174619695 CGAGGAGAATGCAATCAAGTTGG + Intergenic
984723493 4:182998881-182998903 CAGGGAGAATGGAATCAAGTTGG + Intergenic
986581822 5:9273382-9273404 CAAGGAGAATGAAATCAAGTTGG + Intronic
987305821 5:16637213-16637235 CTGGGAGAATGGAACCAAGTTGG - Intergenic
988451747 5:31350882-31350904 GTATGAGAATGTATTTAAGAAGG + Intergenic
988719365 5:33860557-33860579 CGAGGAGAATGGAACCAAGTTGG + Intronic
988843487 5:35105769-35105791 CAAGGAGAATGGAACCAAGTTGG + Intronic
989349783 5:40473328-40473350 CGAGGAGAATGGAACCAAGTTGG - Intergenic
989657271 5:43758668-43758690 CAGGGAGAATGGAATCAAGTTGG - Intergenic
989845219 5:46132417-46132439 CTGGGAGAATGGAACCAAGTTGG + Intergenic
989940753 5:50146984-50147006 CCAGGAGAATGGAACCAAGTTGG + Intergenic
990163551 5:52970343-52970365 CGAGGAGAATGGAACCAAGTTGG - Intergenic
990204294 5:53412615-53412637 CTTTAAGAATGTAATCTATTTGG - Intergenic
990916928 5:60916972-60916994 GTATGAGAATGTATTGAAATAGG + Intronic
991320865 5:65371664-65371686 CGAGGAGAATGGAACCAAGTTGG + Intronic
991549391 5:67819341-67819363 CGAGGAGAATGGAACCAAGTTGG + Intergenic
992354700 5:75968718-75968740 ATAGGAGAATGGAACCAAGTTGG + Intergenic
993165917 5:84355081-84355103 CAGGGAGAATGGAATCAAGTTGG - Intronic
993366599 5:87041628-87041650 CAGGGAGAATGGAATCAAGTTGG - Intergenic
993838935 5:92852135-92852157 CTATGTAAAAGTAATAAAGTAGG + Intergenic
993851309 5:93013719-93013741 TCATGAAAATGTAATCATGTGGG - Intergenic
994334478 5:98548079-98548101 CGGGGAGAATGGAATCAAGTTGG + Intergenic
994528384 5:100934685-100934707 CGGGGAGAATGTAACCAAGTTGG - Intergenic
994551253 5:101238147-101238169 CAGGGAGAATGGAATCAAGTTGG - Intergenic
994777087 5:104048919-104048941 ACATGAGAACGTAATCAATTTGG + Intergenic
995264007 5:110137668-110137690 CACGGAGAATGGAATCAAGTTGG - Intergenic
995276440 5:110283243-110283265 CGGGGAGAATGGAATCAAGTTGG - Intergenic
995564086 5:113415365-113415387 CGAGGAGAATGGAACCAAGTTGG - Intronic
995768185 5:115641043-115641065 CTATGAGGCTGCAGTCAAGTTGG - Intergenic
996377462 5:122827952-122827974 CTATGAGAATTTACTCAAACAGG - Intronic
996420556 5:123257727-123257749 CAAGGAGAATGGAACCAAGTTGG - Intergenic
996654700 5:125923011-125923033 CGGGGAGAATGGAATCAAGTTGG - Intergenic
997097127 5:130925342-130925364 CGAGGAGAATGGAACCAAGTTGG + Intergenic
997345190 5:133185320-133185342 CGAGGAGAATGGAACCAAGTTGG - Intergenic
997738867 5:136236230-136236252 CTATGAGACTGTAAGCAGGGAGG + Intronic
998685241 5:144517143-144517165 CGGGGAGAATGGAATCAAGTTGG - Intergenic
999621121 5:153474914-153474936 CGAGGAGAATGGAACCAAGTTGG - Intergenic
999944481 5:156580497-156580519 CTGGGAGAATGGAACCAAGTTGG - Intronic
1000327419 5:160182896-160182918 CTATGAGAATAAAATGAAATAGG - Intergenic
1000354984 5:160385728-160385750 CTATGAGGATGAATTCCAGTGGG + Intergenic
1000412190 5:160945680-160945702 CGAGGAGAATGGAACCAAGTTGG - Intergenic
1000680557 5:164178537-164178559 ATATGTGAATATAATCATGTGGG - Intergenic
1000749188 5:165073604-165073626 CAGGGAGAATGAAATCAAGTTGG - Intergenic
1001375878 5:171257766-171257788 ATCCGAGAATGAAATCAAGTAGG + Intronic
1002942413 6:1729885-1729907 CTATGAAAATCTACTCAACTCGG + Intronic
1003296516 6:4834672-4834694 CAGGGAGAATGGAATCAAGTTGG - Intronic
1004807739 6:19222370-19222392 CGGTGAGAATGGAACCAAGTTGG + Intergenic
1005723200 6:28622766-28622788 CTGGGAGAATGGAACCAAGTTGG + Intergenic
1005785695 6:29243564-29243586 CTAGAAGAATGGAACCAAGTTGG - Intergenic
1006198190 6:32261677-32261699 CGGGGAGAATGGAATCAAGTTGG - Intergenic
1008176054 6:48269593-48269615 CGAGGAGAATGGAATCAAGTTGG - Intergenic
1008281399 6:49600081-49600103 CGAGGAGAATGGAACCAAGTTGG + Intergenic
1008406417 6:51122968-51122990 CAGGGAGAATGGAATCAAGTTGG + Intergenic
1008491883 6:52095547-52095569 CGGGGAGAATGGAATCAAGTTGG - Intergenic
1008969586 6:57351494-57351516 CTGTGAGAATGGAAAGAAGTGGG + Intronic
1009158558 6:60253331-60253353 CTGTGAGAATGGAAAGAAGTGGG + Intergenic
1009193932 6:60662546-60662568 CCAGGAGAATGGAACCAAGTTGG - Intergenic
1009503751 6:64449399-64449421 CGAGGAGAATGGAACCAAGTTGG + Intronic
1009655758 6:66542449-66542471 CTGGGAGAATGGAACCAAGTTGG + Intergenic
1009727707 6:67556953-67556975 CTGGGAGAATGGAAGCAAGTTGG - Intergenic
1009892292 6:69700842-69700864 TTATAAGAATATAATCAAGAGGG + Exonic
1010006392 6:70999534-70999556 TGATGAGAATGGAACCAAGTTGG + Intergenic
1010482650 6:76374028-76374050 CGGGGAGAATGGAATCAAGTTGG - Intergenic
1010515271 6:76765538-76765560 CTATGAGGATGGAAGAAAGTCGG + Intergenic
1010565733 6:77410559-77410581 CTATAAGAATGTAATAAATATGG - Intergenic
1010594741 6:77749662-77749684 CTGGGAGAATGGAACCAAGTTGG + Intronic
1011199697 6:84822164-84822186 CGAGGAGAATGGAATCAAGTTGG - Intergenic
1011318545 6:86064391-86064413 CGGGGAGAATGGAATCAAGTTGG - Intergenic
1012251403 6:96985470-96985492 CGAAGAGAATGGAACCAAGTTGG - Intronic
1012481763 6:99675402-99675424 CGAGGAGAATGAAACCAAGTTGG - Intergenic
1012799186 6:103803393-103803415 CGGTGAGAATGGAACCAAGTTGG + Intergenic
1012878178 6:104754297-104754319 CGAGGAGAATGGAACCAAGTTGG + Intronic
1013390408 6:109680498-109680520 TGAGGAGAATGGAATCAAGTTGG + Intronic
1013926519 6:115479656-115479678 CGGGGAGAATGGAATCAAGTTGG - Intergenic
1014128329 6:117803291-117803313 CTGGGAGAATGGAACCAAGTTGG - Intergenic
1014132939 6:117855342-117855364 CTGGGAGAATGGAACCAAGTTGG + Intergenic
1014145841 6:117997317-117997339 CTGGGAGAATGGAACCAAGTTGG + Intronic
1014417200 6:121196944-121196966 CCAAGAGAATGTAATCTTGTGGG - Intronic
1014430950 6:121369772-121369794 CGAGGAGAATGGAACCAAGTTGG + Intergenic
1014602657 6:123433917-123433939 ATATTATAATCTAATCAAGTAGG + Intronic
1014864175 6:126507104-126507126 CTAGGAGAATGAAACCAAATTGG + Intergenic
1015047053 6:128788575-128788597 CGGTGAGAATGGAACCAAGTTGG + Intergenic
1015191529 6:130477045-130477067 CGGGGAGAATGGAATCAAGTTGG + Intergenic
1015802230 6:137071678-137071700 CGAGGAGAATGGAACCAAGTTGG + Intergenic
1016847808 6:148586498-148586520 CAAGGAGAATGGAACCAAGTTGG - Intergenic
1017066473 6:150533696-150533718 TGATGAGAATGTAATCACCTGGG + Intergenic
1017261793 6:152396046-152396068 ACATGAGAATGTAATCTTGTTGG - Intronic
1017509243 6:155098455-155098477 ATATGAAAATGAAATCAAGTAGG - Intronic
1018114102 6:160566074-160566096 CGAGGAGAATGGAACCAAGTTGG + Intronic
1020326228 7:6976485-6976507 CAAGGAGAATGGAACCAAGTTGG - Intergenic
1020367082 7:7392572-7392594 CATTGAGAATGGAACCAAGTTGG - Intronic
1020774006 7:12430930-12430952 CCAGGAGAATGGAACCAAGTTGG - Intergenic
1021302475 7:18989652-18989674 CAGGGAGAATGGAATCAAGTTGG - Intronic
1021373737 7:19882242-19882264 CGAGGAGAATGGAACCAAGTTGG - Intergenic
1021502143 7:21343879-21343901 CGAGGAGAATGGAACCAAGTTGG - Intergenic
1021753337 7:23827195-23827217 CGAAGAGAATGGAACCAAGTTGG - Intronic
1022135877 7:27448144-27448166 CAGGGAGAATGGAATCAAGTTGG - Intergenic
1023561761 7:41481379-41481401 CTATGAGAATAAATGCAAGTAGG + Intergenic
1024495601 7:50042217-50042239 CGAGGAGAATGGAATCAAGTTGG + Intronic
1024795175 7:53011598-53011620 TGGTGAGAATGGAATCAAGTTGG - Intergenic
1026059997 7:67017438-67017460 AAATGAAAATGTAATCAATTTGG - Intronic
1027482397 7:78715091-78715113 CTAAGAGAGTTTAATCAAATGGG + Intronic
1027496097 7:78889272-78889294 CGAGGAGAATGGAAACAAGTTGG + Intronic
1027637247 7:80690547-80690569 CAGGGAGAATGGAATCAAGTTGG + Intergenic
1028421522 7:90638729-90638751 CGAGGAGAATATAACCAAGTTGG - Intronic
1028436302 7:90808008-90808030 CGAGGAGAATGGAACCAAGTTGG + Intronic
1028652695 7:93169040-93169062 CGATGAGAATGGAACCAAGTTGG - Intergenic
1029731570 7:102441812-102441834 CTATGCTAATCTAATCAAGCAGG - Intronic
1029818287 7:103119827-103119849 CTGTGAGAATGTGATTGAGTTGG - Exonic
1030146333 7:106360060-106360082 CAGGGAGAATGGAATCAAGTTGG + Intergenic
1030179302 7:106688975-106688997 CGGGGAGAATGTAACCAAGTTGG - Intergenic
1030342063 7:108392172-108392194 CGAGGAGAATGGAACCAAGTTGG - Intronic
1030467685 7:109923683-109923705 CGAGGAGAATGGAACCAAGTTGG - Intergenic
1031599120 7:123683539-123683561 CCATAAAAATGTAATCTAGTTGG - Exonic
1031796187 7:126176904-126176926 CTATGAAAATTACATCAAGTGGG + Intergenic
1032659586 7:133968938-133968960 CAAGGAGAATGGAACCAAGTTGG - Intronic
1032686636 7:134240596-134240618 CTGGGAGAATGGAACCAAGTTGG + Intronic
1033679431 7:143579496-143579518 CCAGGAGAATGGAACCAAGTTGG - Intergenic
1033692405 7:143749947-143749969 CCAGGAGAATGGAACCAAGTTGG + Intergenic
1033844654 7:145417557-145417579 CAAGGAGAATGGAACCAAGTTGG - Intergenic
1033917889 7:146350067-146350089 CACGGAGAATGGAATCAAGTTGG - Intronic
1033977031 7:147115415-147115437 CCGGGAGAATGGAATCAAGTTGG - Intronic
1034779965 7:153870249-153870271 CAGGGAGAATGGAATCAAGTTGG - Intergenic
1035008658 7:155691066-155691088 CTGGGAGAATGGAACCAAGTTGG - Intronic
1035533134 8:371168-371190 CAAGGAGAATGGAATCAAGCTGG - Intergenic
1035616313 8:1004661-1004683 CTAAGAAAATGAAATTAAGTTGG - Intergenic
1035955187 8:4069669-4069691 ACATGAGAATGCAATCCAGTCGG - Intronic
1037938185 8:22929099-22929121 TTATGAGAATGAAATCAACCAGG + Intronic
1038079218 8:24114156-24114178 CTTTGAGTATGGAATAAAGTGGG + Intergenic
1038438309 8:27554000-27554022 CGAGGAGAATGGAACCAAGTTGG - Intergenic
1039020280 8:33197438-33197460 CTAGGAGAAAGTTATCATGTTGG - Intergenic
1040421216 8:47242155-47242177 CTATGAGAAAGCAATTAAGAAGG + Intergenic
1041256660 8:55984608-55984630 CTTTGAGTGTGTATTCAAGTTGG - Intronic
1041474696 8:58250262-58250284 CAGGGAGAATGGAATCAAGTTGG + Intergenic
1042423314 8:68617883-68617905 CGGGGAGAATGGAATCAAGTTGG - Intronic
1042434248 8:68744777-68744799 CGGGGAGAATGGAATCAAGTTGG + Intronic
1042812749 8:72844536-72844558 CAAGGAGAATGGAACCAAGTTGG - Intronic
1042873183 8:73416512-73416534 CAATGGGAATGAAATCAAGAGGG + Intergenic
1043123591 8:76361523-76361545 CGAGGAGAATGGAACCAAGTTGG + Intergenic
1043583569 8:81740406-81740428 CTATGAGAATGTAATGCTGCTGG + Intronic
1043819094 8:84840510-84840532 CTGGGAGAATGGAACCAAGTTGG + Intronic
1043911787 8:85872873-85872895 CGAAGAGAATGGAACCAAGTTGG - Intergenic
1045633088 8:104150380-104150402 CTATTAGACTGTAAGCAACTTGG - Intronic
1046081438 8:109375099-109375121 CTGGGAGAATGGAACCAAGTTGG - Intronic
1046277960 8:111987122-111987144 CAAGGAGAATGGAACCAAGTTGG + Intergenic
1046752738 8:117942320-117942342 TTATGAGACTGTAATAATGTAGG + Intronic
1047154109 8:122297668-122297690 CAGGGAGAATGGAATCAAGTTGG - Intergenic
1047369414 8:124244156-124244178 CGGGGAGAATGGAATCAAGTTGG - Intergenic
1048668539 8:136691208-136691230 ATATGAGAATGGACTGAAGTTGG + Intergenic
1048796519 8:138154838-138154860 CGAGGAGAATGGAACCAAGTTGG + Intronic
1050668914 9:7974156-7974178 CTATGAGATTGAAATCAAATCGG - Intergenic
1051945923 9:22570003-22570025 CGGTGAGAATGGAACCAAGTTGG + Intergenic
1052506457 9:29359937-29359959 CTGGGAGAATGGAACCAAGTTGG + Intergenic
1054338041 9:63826406-63826428 CTATGAGCATCTAGTGAAGTAGG - Intergenic
1054946561 9:70802569-70802591 CAATGAGAAACTAACCAAGTTGG + Intronic
1055210461 9:73784546-73784568 CAAGGAGAATGGAACCAAGTTGG + Intergenic
1055239393 9:74165171-74165193 CAGGGAGAATGGAATCAAGTTGG + Intergenic
1055344961 9:75326276-75326298 CTAGGAGAATGGAACCAAGTTGG - Intergenic
1055835249 9:80432285-80432307 CTCTGAGAATGACATCCAGTTGG - Intergenic
1056001130 9:82217455-82217477 CAGGGAGAATGGAATCAAGTTGG + Intergenic
1056003366 9:82241598-82241620 CTGAGAGAATGAAACCAAGTTGG - Intergenic
1056416491 9:86382070-86382092 CGAGGAGAATGGAACCAAGTTGG - Intergenic
1057460470 9:95256085-95256107 CAAGGAGAATGGAACCAAGTTGG + Intronic
1058514257 9:105753210-105753232 CGAGGAGAATGGAACCAAGTTGG + Intronic
1058595086 9:106606513-106606535 CTGGGAGAATGGAACCAAGTTGG + Intergenic
1058614454 9:106810709-106810731 CGAGGAGAATGGAACCAAGTCGG + Intergenic
1058909830 9:109510678-109510700 CGAGGAGATTGTAATCACGTGGG + Intergenic
1203354070 Un_KI270442v1:115000-115022 CGGGGAGAATGGAATCAAGTTGG + Intergenic
1186143822 X:6604728-6604750 CCATAAGAATGCAGTCAAGTGGG - Intergenic
1186308280 X:8289114-8289136 CTATAAAAATGTCATCACGTTGG + Intergenic
1187374376 X:18738724-18738746 CTGGGAGAATGGAACCAAGTTGG - Intronic
1187605350 X:20876142-20876164 CAGGGAGAATGGAATCAAGTTGG + Intergenic
1187661017 X:21546472-21546494 CTGGGAGAATGGAACCAAGTTGG + Intronic
1188241515 X:27798556-27798578 CTATGAAAAAGTAATCAATGAGG - Intergenic
1188629178 X:32330045-32330067 ATTTGAGAATGCAATCAATTCGG + Intronic
1188776314 X:34223835-34223857 ATATGAGAAAGTAATAAAGAAGG + Intergenic
1188954437 X:36417456-36417478 CAAGGAGAATGGAACCAAGTTGG - Intergenic
1189026363 X:37399024-37399046 CGAGGAGAATGGAACCAAGTTGG + Intronic
1189721704 X:43926392-43926414 CAGAGAGAATGGAATCAAGTTGG - Intergenic
1189901313 X:45709811-45709833 CTATGAGAATGTAAGCTACATGG + Intergenic
1189934838 X:46056954-46056976 CTGGGAGAATGGAACCAAGTTGG - Intergenic
1189937928 X:46088668-46088690 CTGGGAGAATGGAACCAAGTTGG + Intergenic
1190945977 X:55094504-55094526 CGAGGAGAATGGAATCAAGTTGG - Intronic
1190976659 X:55410317-55410339 TTATGAGAATGCAAAAAAGTAGG - Intergenic
1191121529 X:56911419-56911441 CAAGGAGAATGGAACCAAGTGGG - Intergenic
1191147948 X:57188983-57189005 CTGGGAGAATGGAATCAAGTTGG - Intergenic
1191170575 X:57443209-57443231 CGGTGAGAATGGAATCAAGTTGG - Intronic
1191232837 X:58109632-58109654 CGGGGAGAATGGAATCAAGTTGG + Intergenic
1191565137 X:62518499-62518521 ATGGGAGAATGGAATCAAGTTGG + Intergenic
1191608990 X:63091189-63091211 CGGGGAGAATGGAATCAAGTTGG + Intergenic
1191832229 X:65428358-65428380 CAGGGAGAATGTAACCAAGTTGG - Intronic
1191984571 X:66965697-66965719 CTGGGAGAATGGAACCAAGTTGG - Intergenic
1192015514 X:67325911-67325933 CAGGGAGAATGGAATCAAGTTGG - Intergenic
1192020720 X:67387791-67387813 CGGTGAGAATGGAAACAAGTTGG + Intergenic
1192718474 X:73667958-73667980 CTGGGAGAATGGAACCAAGTTGG - Intronic
1192871339 X:75187621-75187643 CGGGGAGAATGGAATCAAGTTGG - Intergenic
1192910667 X:75601096-75601118 CGGTGAGAATGGAAACAAGTTGG - Intergenic
1192922588 X:75723190-75723212 CAAAGAGAATGGAACCAAGTTGG - Intergenic
1192930113 X:75798072-75798094 TGAAGAGAATGTAACCAAGTTGG - Intergenic
1193123293 X:77846031-77846053 CAAAGAGAATGGAACCAAGTTGG - Intronic
1193161207 X:78231673-78231695 CGAGGAGAATGGAACCAAGTTGG - Intergenic
1193267008 X:79483623-79483645 CAGGGAGAATGGAATCAAGTTGG + Intergenic
1193267942 X:79495336-79495358 CAAGGAGAATGGAACCAAGTTGG + Intergenic
1193355826 X:80519789-80519811 CGGGGAGAATGGAATCAAGTTGG - Intergenic
1193376545 X:80768123-80768145 CAGGGAGAATGGAATCAAGTTGG + Intronic
1193571822 X:83153212-83153234 CAAGGAGAATGGAACCAAGTTGG + Intergenic
1193615855 X:83687516-83687538 CAGGGAGAATGGAATCAAGTTGG - Intergenic
1194519876 X:94905968-94905990 TTATGAGAATTGAACCAAGTTGG - Intergenic
1194954258 X:100161182-100161204 CAAGGAGAATGGAACCAAGTTGG - Intergenic
1195457289 X:105083346-105083368 CTGGGAGAATGGAACCAAGTTGG + Intronic
1196482036 X:116160733-116160755 CGAGGAGAATGGAACCAAGTTGG + Intergenic
1196559053 X:117124218-117124240 CAGGGAGAATGGAATCAAGTTGG + Intergenic
1196946435 X:120831655-120831677 CTGAGAGAATGGAACCAAGTTGG - Intergenic
1197008778 X:121535806-121535828 CTGGGAGAATGGAACCAAGTTGG - Intergenic
1197184900 X:123575020-123575042 TGATGAGAATGGAACCAAGTTGG + Intergenic
1197191248 X:123649849-123649871 CGAAGAGAATGGAACCAAGTTGG + Intronic
1197319264 X:125007427-125007449 CTGGGAGAATGGAACCAAGTTGG + Intergenic
1197438429 X:126460664-126460686 CTGGGAGAATGGAACCAAGTTGG + Intergenic
1197959761 X:131991031-131991053 CGGGGAGAATGAAATCAAGTTGG + Intergenic
1198295239 X:135281086-135281108 CAAGGAGAATGGAACCAAGTTGG - Intronic
1198471093 X:136947826-136947848 CTATGTGCAACTAATCAAGTAGG + Intergenic
1198645338 X:138800672-138800694 CGGGGAGAATGGAATCAAGTTGG - Intronic
1198731280 X:139732391-139732413 AAATGAGAATGCAAGCAAGTTGG + Intronic
1199796347 X:151201363-151201385 CAGGGAGAATGGAATCAAGTTGG + Intergenic
1199879740 X:151964462-151964484 CTCTGAGACTGTGATCTAGTTGG - Intronic
1200771930 Y:7134386-7134408 TGATGAGAATGGAACCAAGTTGG - Intergenic
1200879250 Y:8194995-8195017 CCAGGAGAATGGAACCAAGTTGG + Intergenic
1201413400 Y:13723480-13723502 CGGGGAGAATGGAATCAAGTTGG + Intergenic
1201415494 Y:13745316-13745338 CGGGGAGAATGGAATCAAGTTGG - Intergenic
1201422136 Y:13811327-13811349 CAAGGAGTATGGAATCAAGTTGG - Intergenic
1201464564 Y:14266291-14266313 CTCTGAGAATGAAGTCATGTAGG + Intergenic
1201533111 Y:15014202-15014224 CGAGGAGAATGGAACCAAGTTGG + Intergenic
1201544624 Y:15148062-15148084 CAAGGAGAATGGAACCAAGTTGG - Intergenic
1201590807 Y:15612412-15612434 TGAGGAGAATGGAATCAAGTTGG + Intergenic
1201606417 Y:15790803-15790825 CAGGGAGAATGGAATCAAGTTGG - Intergenic
1201635565 Y:16119305-16119327 CAAGGAGAATGGAACCAAGTTGG - Intergenic
1201732006 Y:17214280-17214302 CTAGGAGAATGGAACCAAGTTGG + Intergenic
1201892513 Y:18958157-18958179 CGAGGAGAATGGAACCAAGTTGG + Intergenic
1201971585 Y:19803113-19803135 CGAGGAGAATGGAACCAAGTTGG + Intergenic
1202057181 Y:20847286-20847308 CAAGGAGAATGGAATCAAGTTGG - Intergenic
1202333492 Y:23780152-23780174 CGAGGAGAATGGAACCAAGTTGG - Intergenic
1202537277 Y:25889911-25889933 CGAGGAGAATGGAACCAAGTTGG + Intergenic