ID: 1088256492

View in Genome Browser
Species Human (GRCh38)
Location 11:107908352-107908374
Sequence CGACCTCGTTTGCATCAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 19
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 17}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088256492_1088256498 20 Left 1088256492 11:107908352-107908374 CCTCCCTGATGCAAACGAGGTCG 0: 1
1: 0
2: 0
3: 1
4: 17
Right 1088256498 11:107908395-107908417 CGCCGCCGCCGCAGACGCCGCGG 0: 1
1: 1
2: 94
3: 211
4: 578

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088256492 Original CRISPR CGACCTCGTTTGCATCAGGG AGG (reversed) Intronic
1077098429 11:809973-809995 CGACCTCGGTGGCGACAGGGAGG - Exonic
1082118959 11:48357542-48357564 CAACTTCTTTTGCATCAGTGTGG - Intergenic
1085400856 11:76234699-76234721 TGACCCCGTTTTCACCAGGGGGG + Intergenic
1088256492 11:107908352-107908374 CGACCTCGTTTGCATCAGGGAGG - Intronic
1101409684 12:104457918-104457940 CGACCTCGGCAGCAGCAGGGAGG - Intronic
1115114884 14:29868357-29868379 AGACATCTTTTGCATCAGAGAGG - Intronic
1164547555 19:29181637-29181659 CAACCCCATTTGCACCAGGGAGG + Intergenic
944681856 2:202084415-202084437 AGACCTCATATGCATCAGGAAGG + Intronic
1169731227 20:8787283-8787305 CCACCCCATTTGCAGCAGGGAGG - Intronic
1171418195 20:24998074-24998096 CAACTTCTTTTGCAACAGGGTGG - Intergenic
1174954882 20:55086553-55086575 TGACTTCTTCTGCATCAGGGAGG + Intergenic
1175416145 20:58802917-58802939 CGACTTGATTTGCATGAGGGTGG - Intergenic
956858005 3:73294695-73294717 TGACCTCATTTGCATCTGGGAGG + Intergenic
962230099 3:133657469-133657491 CTAAATCGTTTGAATCAGGGAGG - Intronic
969093572 4:4715628-4715650 CCACCTCGTGAGCATCAGGATGG - Intergenic
991703299 5:69335036-69335058 CGTCCTCGTCTTCATCAGGTTGG - Intergenic
1016358967 6:143247858-143247880 GGACCTGGTTTGAATCTGGGTGG + Intronic
1046790798 8:118319662-118319684 CTTCCTCGTCTGCATCATGGAGG - Intronic
1056487916 9:87077390-87077412 TAAACTCTTTTGCATCAGGGAGG + Intergenic