ID: 1088258422

View in Genome Browser
Species Human (GRCh38)
Location 11:107922783-107922805
Sequence GTCACCCAGGCACCCCAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 209}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088258422 Original CRISPR GTCACCCAGGCACCCCAGGT TGG (reversed) Intronic
900651013 1:3730131-3730153 CTCACCCACGGGCCCCAGGTTGG - Exonic
900825313 1:4921391-4921413 GTCACACAGGTGTCCCAGGTGGG + Intergenic
901188690 1:7390809-7390831 GTCACCCTGGCACACCTGGCGGG - Intronic
902386019 1:16076385-16076407 GTCAGCAAGGGACCCTAGGTGGG - Intergenic
902594747 1:17501654-17501676 GTCACCCAGGCTACCCAGGCTGG - Intergenic
902715747 1:18271619-18271641 CTCCCCTAGGCACCCCAGGGAGG + Intronic
904597066 1:31653594-31653616 GTCTTCCCGGCCCCCCAGGTAGG - Exonic
904625051 1:31797818-31797840 GTCTTCCTGGTACCCCAGGTTGG - Intronic
904856116 1:33499451-33499473 GTCACCCAAGCACAGCTGGTTGG - Intergenic
910633761 1:89384323-89384345 CTCACCCAGGTACCTCAGGAAGG + Intronic
912347553 1:108978447-108978469 GTCACCCAGGTTGCCCAGGCTGG - Intronic
912935585 1:114001612-114001634 GTGAGTCAGGCACCCCAGGCAGG + Intergenic
915735241 1:158080524-158080546 GTCACCCAGGCAGGCCAGCAAGG - Intronic
917966589 1:180182864-180182886 GTCAGCCAGGCCCCGCAGGCAGG + Intronic
920093659 1:203471940-203471962 GCAACCCAGGCCCCCCAGGCTGG + Intergenic
920214278 1:204351045-204351067 GTTACCCGGGCAACCCAGCTGGG + Intronic
921040808 1:211429952-211429974 GTCACCTAGGCTGCCCAGGATGG - Intergenic
921345414 1:214178884-214178906 GTAAGTCAGGCACCCCTGGTTGG - Intergenic
922280375 1:224117648-224117670 GTCACCCAGGCCCCCTTGGCAGG + Intronic
922969912 1:229727642-229727664 GTCCCACAGGCTCTCCAGGTTGG - Intergenic
1066167893 10:32808120-32808142 GCCACCCAGGCACACCACTTGGG + Intronic
1066348615 10:34615149-34615171 GCCACCCAGGCTGCCCAGGCTGG - Intronic
1066367734 10:34793120-34793142 GGCCCCCCGGCTCCCCAGGTGGG - Intronic
1066439510 10:35424880-35424902 GTCCTCCAGCCACACCAGGTTGG + Intronic
1070865809 10:79707611-79707633 GTCACAGAGGCACCGCAGGGTGG - Intronic
1070879602 10:79845742-79845764 GTCACAGAGGCACCGCAGGGTGG - Intronic
1071632708 10:87229832-87229854 GTCACAGAGGCACCGCAGGGTGG - Intronic
1071646157 10:87362050-87362072 GTCACAGAGGCACCGCAGGGTGG - Intronic
1071693243 10:87844532-87844554 TTCTCCCAGGAACCCCAGTTGGG + Intergenic
1072582407 10:96750694-96750716 GTGAGCCAGGCGCCCCAGATAGG - Intergenic
1073602912 10:104864345-104864367 TTCATCCAGTCACCCCAGGGAGG - Intronic
1075065234 10:119284918-119284940 GTCCTCCAGGCAGCCCAGGATGG - Intronic
1076997225 11:304040-304062 GTCAGCCAGGCAGCCCGGGAAGG + Intergenic
1077368898 11:2172493-2172515 GTCGCCCTGGCAACCCTGGTGGG - Intergenic
1078153313 11:8777235-8777257 CCCACCCAGGCACCCCACCTTGG + Intronic
1078436826 11:11332343-11332365 GACCCTCAGGCACCCCAGCTGGG + Intronic
1079603913 11:22342584-22342606 GTCACCCAGGCTGCTCAGGGCGG + Intronic
1080802193 11:35618951-35618973 GTCAGCCAGGCAGCCCCGGCCGG + Exonic
1083266990 11:61551331-61551353 GCCACACAAGCAGCCCAGGTGGG - Intronic
1084499497 11:69526336-69526358 GTGTCCCAGGCCCCCCAGGAGGG + Intergenic
1088258422 11:107922783-107922805 GTCACCCAGGCACCCCAGGTTGG - Intronic
1090605920 11:128422877-128422899 GTCACCCAGGCGCCCTGTGTAGG + Intergenic
1091758460 12:3071714-3071736 GTGAGCCAGGCGCCCCAGATAGG + Intergenic
1092569560 12:9708021-9708043 CACACCCAGGCACCCGAAGTGGG - Intergenic
1092879362 12:12875905-12875927 GTGAGCCAGGCGCCCCAGATAGG - Intergenic
1094473903 12:30826784-30826806 GGGACCCAGGAGCCCCAGGTTGG - Intergenic
1094528751 12:31252172-31252194 GTGAGCCAGGCGCCCCAGATAGG + Intergenic
1096979299 12:55719206-55719228 TTCAACCAGGCACTCAAGGTGGG + Exonic
1097240272 12:57570181-57570203 GGCACTGAGGCACGCCAGGTGGG + Intronic
1097256009 12:57675048-57675070 GTGAGCCAGGTACCCCAGGTAGG - Intergenic
1098139149 12:67433837-67433859 GTTACCTAGGCACTCAAGGTAGG - Intergenic
1098470498 12:70837837-70837859 GTCACCCAGGAAACCAAGGCAGG - Intronic
1099524772 12:83705779-83705801 GTCCCACAGCCACCACAGGTAGG - Intergenic
1101777183 12:107805974-107805996 GTGACCAAGGCAGCCCTGGTGGG - Intergenic
1102047874 12:109841040-109841062 CCCACCCAGGGACCCCAGCTTGG - Intergenic
1104799302 12:131542723-131542745 GTCACCAAAGCAGCCCTGGTAGG - Intergenic
1104987291 12:132604120-132604142 AGCACCCAGGCACCCCTGCTGGG - Intronic
1108040004 13:46331137-46331159 GCAACCCAGGCACCACAGATTGG - Intergenic
1111292298 13:86185784-86185806 CCCACCCAGGCACCCAAGCTAGG - Intergenic
1113711338 13:112467284-112467306 CTCCCCCAGGAGCCCCAGGTGGG + Intergenic
1114513037 14:23278163-23278185 GTCACCCAGGCCACCCAGGCTGG + Intronic
1116620774 14:47200758-47200780 GTGAGCCAGGCGCCCCAGTTAGG + Intronic
1117846734 14:59919940-59919962 GTTTCCCAGGAGCCCCAGGTGGG + Intronic
1118387168 14:65265478-65265500 GACATCATGGCACCCCAGGTGGG + Intergenic
1118769688 14:68933945-68933967 CTCACTCTGTCACCCCAGGTTGG - Intronic
1121180945 14:91928194-91928216 GTCACCTAGGCAATCCAGGTGGG + Intronic
1122690713 14:103530996-103531018 CCCACCCAGACACCCCAGGGAGG - Intronic
1123447410 15:20341052-20341074 GTCAGCCAGCCACCCAAGCTAGG + Intergenic
1124339373 15:28880022-28880044 GTCATCCTGGCCCCCCAGGAAGG + Intergenic
1124636202 15:31366433-31366455 GTCACTCCAGCTCCCCAGGTGGG - Intronic
1129826508 15:78638226-78638248 GCCACCCGGGCACATCAGGTGGG - Intronic
1130822048 15:87506203-87506225 GAGACCCAGGCAGGCCAGGTTGG - Intergenic
1131615996 15:94018016-94018038 GTTACCCAGCCAGCCCAGATTGG + Intergenic
1133026129 16:2989704-2989726 GTCCCCCAGGCACCCTGGCTGGG + Intergenic
1136247949 16:28985908-28985930 CTCTCCCTGGCACCCAAGGTAGG - Intronic
1136267117 16:29128306-29128328 GTCTCCCAGCCACGCCAGGCAGG + Intergenic
1137808305 16:51328852-51328874 GGCTCCCAGGCACGCCAGCTTGG - Intergenic
1137984617 16:53097440-53097462 GTCACCCAGGCACTCCAGCCTGG - Intronic
1138543620 16:57703529-57703551 AGCACCCAGGGACCCCAGGGTGG + Intronic
1141781331 16:86163640-86163662 GTCGCCCAGGCCCCCCAGGCTGG + Intergenic
1142070408 16:88088629-88088651 GTCTCCCAGCCACACCAGGCTGG + Intronic
1142249869 16:88986326-88986348 GACACCCAGAAACCCCAGGAAGG + Intergenic
1142903860 17:3029576-3029598 GTGCCCCAGGAAGCCCAGGTAGG - Intronic
1144308608 17:13992136-13992158 ATCTCCCAAGCACCCCAGGCTGG - Intergenic
1145207173 17:20990727-20990749 GTCAGCCAGGGCCCCCATGTGGG + Intergenic
1146699350 17:34941995-34942017 GCCACCCAAGCACTCCAGCTTGG + Intronic
1147557093 17:41486461-41486483 TGCACCCCGGCTCCCCAGGTTGG - Exonic
1149536573 17:57438162-57438184 CCCAGCCAGGCACCCCAGCTCGG - Intronic
1151563310 17:74882624-74882646 GTCCCCCAGGCCCACCACGTTGG + Exonic
1151786293 17:76276641-76276663 GGCCCCCAGGCACCTCACGTGGG - Intronic
1151979054 17:77498354-77498376 GTCCCCCAGGCCCACCATGTTGG - Intronic
1152205418 17:78972078-78972100 GTCACAAAGGCACTCCAGGTGGG + Exonic
1152743477 17:82028778-82028800 GCCACCCAGTGACCCAAGGTTGG - Intronic
1153615592 18:6930109-6930131 CACAGCCAGGCACCCCAGCTCGG + Intergenic
1154212967 18:12395687-12395709 ATCACTCAGGCACCCCAGGCTGG - Intergenic
1154435256 18:14337330-14337352 GTAACGTAGGCACCACAGGTAGG + Intergenic
1154946440 18:21166331-21166353 CTCACTCAGTCACCCCAGGCTGG - Intergenic
1155952772 18:31931433-31931455 GTCACCCAGCCACCTCAGCCTGG - Exonic
1156467084 18:37354423-37354445 TTCTCCCAGGCACCCCAGATTGG - Intronic
1161021626 19:2014053-2014075 GTCACCCCTGCATCCCAGGATGG - Intronic
1162312063 19:9913694-9913716 GACACCCAGGCGCCCCGGGGGGG + Intronic
1162701778 19:12521186-12521208 CTCACTCTGTCACCCCAGGTTGG + Intronic
1162951521 19:14074243-14074265 GGCACCCAGGAACCCGAGGGAGG - Intronic
1163125621 19:15242915-15242937 TTCACCCCGGCACCACAAGTCGG - Exonic
1163404157 19:17112266-17112288 GCCACCGAGGGACACCAGGTGGG + Intronic
1163552676 19:17974303-17974325 CTCCCCCAGGCACTCCAGGGAGG + Intronic
1165105990 19:33469957-33469979 GGCACCCAGGACCCACAGGTGGG - Intronic
1166300636 19:41910293-41910315 GTCATCCAGGGACCCTGGGTTGG + Intronic
1167291505 19:48627637-48627659 GTGACCCAGGCCCCCCACCTTGG - Intronic
1167438090 19:49491429-49491451 GTGAGCCAGGCGCCCCAGATAGG - Exonic
1168261539 19:55197811-55197833 TTCCCACAGGAACCCCAGGTAGG + Intronic
927492080 2:23527319-23527341 GCCCCCCAGCCACCCCAGGGTGG + Intronic
927574580 2:24190653-24190675 GTCAGACAGGCACCCAAGGGCGG + Exonic
927839704 2:26432021-26432043 GCCACCCAGGCACCCTAGTGAGG - Intronic
928951387 2:36816425-36816447 GTCACCCAGGTCACCCAGGCTGG - Intergenic
929167561 2:38898447-38898469 GTCTTCCAGGCACTCCAGATGGG + Intronic
930031817 2:47062846-47062868 ATCAGCAAGGCACCCCAGGAAGG - Intronic
930262692 2:49165895-49165917 GTCACCAAGGCAACCGAGGGAGG - Intergenic
931354966 2:61528620-61528642 CTCACGCAGTCAACCCAGGTTGG - Intronic
932288127 2:70553807-70553829 GCCACTCGGGCACCGCAGGTAGG - Exonic
932592576 2:73076021-73076043 GTGACCCAGGCCCCCCAGGCTGG - Exonic
933564401 2:83932146-83932168 GTTACTCAGGAACCCGAGGTGGG + Intergenic
935006751 2:99086400-99086422 TTTACCCAGGCATGCCAGGTTGG + Intronic
937059629 2:118971517-118971539 GTGAACAAGGCGCCCCAGGTAGG + Exonic
937302611 2:120852418-120852440 GTCCCCCTGGCACCCCTGGTGGG - Intronic
937485719 2:122312885-122312907 GTCACCCAGGTCACCCAGGCTGG - Intergenic
938822614 2:134975108-134975130 GTCACCCAGGGGCCCAAGGATGG - Intronic
938903151 2:135815727-135815749 GTCACCCAGGCTGCCCAGGCTGG + Intronic
944614744 2:201449435-201449457 ATCTGCCAGGCACCCCAGGTGGG - Intronic
944844808 2:203657853-203657875 GTCATCCTGACACCCCAGGCTGG + Intergenic
948675983 2:239596977-239596999 CTCACCCCGGGACCCCAGGCCGG - Intergenic
1169801007 20:9511651-9511673 GTAAGACAGGCATCCCAGGTGGG - Intergenic
1169801632 20:9517062-9517084 ATCACCCAGGCACCTGAGTTGGG + Intronic
1172412570 20:34736360-34736382 GTGACCCTGGCACCCATGGTTGG - Intronic
1172512706 20:35511725-35511747 GGCACCCAGGAGCCCCAGGTCGG + Exonic
1172639250 20:36431183-36431205 GTCATCCCGGAACCCCAGGATGG - Intronic
1172976227 20:38907977-38907999 TGCACCCAGGCACCACAGGCAGG - Intronic
1174858651 20:54069778-54069800 GGCACCCAGCCAGCCCAGGGTGG + Intronic
1176260449 20:64176755-64176777 CTCTCCCAGGCACCCCGGGAGGG + Intronic
1177757237 21:25362226-25362248 GTGAGCCAGGCGCCCCAGATAGG - Intergenic
1178958567 21:37044207-37044229 GTCAGCCAGGCTTCCAAGGTTGG - Intergenic
1180014265 21:45072609-45072631 GTCACCCACCCACCGCAGGCTGG - Intergenic
1180244649 21:46539000-46539022 GACACCCAGGCAAACCAGGAGGG - Intronic
1181045740 22:20213486-20213508 GTCCCCCAGGCGCACCAGGCTGG - Intergenic
1183964608 22:41434319-41434341 GGCACCCACCCACACCAGGTCGG - Exonic
1184211046 22:43035737-43035759 GTCTCCATGGCAGCCCAGGTGGG + Intergenic
1184661527 22:45967664-45967686 GTCACCCTGGCAGGGCAGGTGGG - Intronic
1184726754 22:46351666-46351688 GCCACCCAGGCTCCCCAGCTAGG + Intronic
1184834827 22:47014919-47014941 GTCACCCAGGCAGCTCAGAAGGG - Intronic
1184862162 22:47178556-47178578 GTCACGCAGCCAGCCCTGGTGGG - Intergenic
1184877308 22:47283876-47283898 GTGACCCAGGTACCCCAGCCAGG + Intergenic
950429557 3:12943129-12943151 GTCATCCTGGCACCCCCTGTAGG - Intronic
950665430 3:14492266-14492288 GGCCTCCAGGGACCCCAGGTTGG + Exonic
950778245 3:15368950-15368972 GTTTCCCAGGCACACTAGGTGGG + Intergenic
952946492 3:38481213-38481235 TTCACCTCTGCACCCCAGGTAGG + Intronic
954089988 3:48276634-48276656 GGTACCAAGGCACCCCAAGTTGG + Intronic
961393683 3:126571349-126571371 GCCCCACAGCCACCCCAGGTGGG - Intergenic
961858423 3:129894623-129894645 GTCACCCAGGTCACCCAGGCTGG + Intergenic
962805375 3:138923319-138923341 GTGACCCAGGCACACCAGCATGG - Intergenic
965176594 3:165343139-165343161 TTCAGCCAGGCAGCCCATGTAGG - Intergenic
967878200 3:194281002-194281024 TCCACACAGGCACCCCAGGGAGG - Intergenic
969034363 4:4241045-4241067 GTTGCCCAGGCACTCCAGGCTGG - Intronic
969248765 4:5953706-5953728 GTCCCCCAGGCCCCCCAGCAGGG - Intronic
969626126 4:8306619-8306641 GTCCTCCAGGGACCCCAGGCTGG - Exonic
973841461 4:54865238-54865260 GTCATTCAGGTTCCCCAGGTTGG - Intergenic
975182010 4:71357113-71357135 GTCAGCCAGGGACCGAAGGTTGG - Exonic
977075842 4:92448202-92448224 GTCACCCAGGCTGCCTAGGCTGG + Intronic
981403606 4:144341770-144341792 GGCTCCCAGGGACCCCCGGTGGG - Intergenic
982803663 4:159735795-159735817 GTCATCCAAGGACCCCAAGTGGG + Intergenic
985675985 5:1231546-1231568 TTCCCCCAGGGACCCCAGGGCGG - Intronic
986801856 5:11268563-11268585 ATCACCCAGGCTACCCAGGCTGG - Intronic
988365895 5:30298576-30298598 GTTACTCAGGAAGCCCAGGTAGG + Intergenic
997413888 5:133710435-133710457 GTCACTCAAGCATCCCAGTTTGG + Intergenic
997691313 5:135829320-135829342 GTGGACCAGGCAGCCCAGGTTGG - Intergenic
1001149840 5:169217562-169217584 GGCCCCCAGGAACCCCAGGCTGG - Intronic
1001977815 5:176014570-176014592 GTGACCCTGGCACCACGGGTGGG + Intronic
1002239605 5:177829192-177829214 GTGACCCTGGCACCACAGGTGGG - Intergenic
1002373507 5:178772738-178772760 AGAACACAGGCACCCCAGGTAGG - Intergenic
1002396712 5:178962322-178962344 TTCACCTAGGCACCTCAGCTAGG - Intronic
1003828490 6:9978438-9978460 GTCACCCAGGGACCACAGTTTGG + Intronic
1003921315 6:10835903-10835925 GTCACCCTCCCACCCCAGGGCGG - Intronic
1005788300 6:29270098-29270120 ATCACCCAGGCACTCCAGCCTGG - Intergenic
1005966569 6:30730860-30730882 GCCACCTAGGCACCCCAAGATGG - Intronic
1007745888 6:44042738-44042760 GCCATCCATTCACCCCAGGTGGG - Intergenic
1008569606 6:52803642-52803664 GTCACCCAAGCACACCAAGACGG + Intronic
1009715359 6:67386064-67386086 CTCTCCCATACACCCCAGGTAGG - Intergenic
1014265206 6:119269305-119269327 GTGAACCAGGCACCCCAGATAGG + Intronic
1014430758 6:121367429-121367451 GTCACCCATGCACTCCAGCCTGG + Intergenic
1014690852 6:124561667-124561689 GTCTCCCATCCACCCCAGCTTGG - Intronic
1014797660 6:125745780-125745802 GTCACACAGTGACCCTAGGTTGG + Intergenic
1019371892 7:666402-666424 CTGCCCCGGGCACCCCAGGTAGG + Intronic
1019974975 7:4573885-4573907 GGTCCTCAGGCACCCCAGGTGGG + Intergenic
1021622242 7:22560328-22560350 TTTAGCCTGGCACCCCAGGTGGG + Intronic
1023278454 7:38545511-38545533 GTCACTCAGTGGCCCCAGGTAGG - Intronic
1023851510 7:44152788-44152810 CTCACCCTGTCACCCCAGGCTGG + Intronic
1023929644 7:44697529-44697551 GTCACCCACCCACCCCCGCTGGG + Intronic
1024473760 7:49789850-49789872 GTCACCCATGCTTCCCAGGTGGG + Intronic
1024965864 7:55021238-55021260 GTCTCCCGGGCACCCCAGGCAGG - Intronic
1024989833 7:55224434-55224456 GCCACCTCTGCACCCCAGGTGGG + Intronic
1027453395 7:78358671-78358693 GTGAGCCAGGCACCCCAAGGAGG - Intronic
1028988850 7:97028125-97028147 GCCTTCCAGTCACCCCAGGTGGG - Intergenic
1030086474 7:105819896-105819918 GTGAGCCAGGCGCCCCACGTAGG - Intronic
1032470150 7:132172385-132172407 GTCACCCAGCCCCCTCAAGTGGG - Intronic
1034335846 7:150323195-150323217 CGCACTCAGGCACCGCAGGTAGG + Intronic
1034535134 7:151721435-151721457 GGCCCTCAGGCACCCCAGCTGGG - Intronic
1035363362 7:158328805-158328827 GCCACCCAGGGATCCCAGGGAGG + Intronic
1036767359 8:11557395-11557417 GTCACCAAGGGGCCCCCGGTCGG + Intronic
1037865090 8:22436983-22437005 GTCGCCCAGGCTGCCCAGGCTGG - Intergenic
1040007529 8:42632829-42632851 TTCCCCCAGGCTCCCCAGGACGG + Intergenic
1040318313 8:46276504-46276526 GAGACACAGGCACCCCAGGCTGG + Intergenic
1048972538 8:139653384-139653406 ATCAGGCAGGCACTCCAGGTAGG - Intronic
1049196717 8:141319921-141319943 ATCTCCCAGGCAGCCCAGTTGGG + Intergenic
1049642042 8:143720187-143720209 GTGACCCAGGCAGGCCTGGTCGG - Intronic
1053478231 9:38397123-38397145 TTCACCCAGGCACTCCAGGCCGG + Exonic
1056326153 9:85480492-85480514 GCGAGCCAGGCAGCCCAGGTGGG - Intergenic
1057405908 9:94770588-94770610 GTCACTCAGGCAGCCTAGGGAGG - Intronic
1058826896 9:108783203-108783225 CTCACCCAGGAAGCCCAGGCAGG + Intergenic
1060060251 9:120453494-120453516 GCCACCCAGGCACCCCGTGCAGG + Exonic
1060218205 9:121751028-121751050 GTGACCCACTCACTCCAGGTGGG - Intronic
1060796364 9:126515089-126515111 GGGACCCAGGCCCCCCAGTTTGG + Intergenic
1060984527 9:127812358-127812380 GTCACTCAGGCTGCCCAGGCTGG + Intronic
1061534899 9:131241526-131241548 GTGAGCCAGGCGCCCCAGGTGGG - Intergenic
1061966534 9:134017490-134017512 GTGACCCATGGACCACAGGTTGG - Intergenic
1062218987 9:135404244-135404266 TTCACACAGGTACCCAAGGTTGG - Intergenic
1062368034 9:136221222-136221244 GGCACACAGGCACCCCACGCAGG + Intronic
1062700735 9:137900362-137900384 CTCACTCTGGCACCCAAGGTCGG - Intronic
1189773677 X:44451139-44451161 GTCACACTGGCTCCCCAGGAAGG + Intergenic
1190276213 X:48901294-48901316 CTCACCCAGGCTCACCAGGAAGG - Exonic
1190717017 X:53113607-53113629 GTCACCCACCCACTCCAGGCTGG + Intergenic
1192455656 X:71273413-71273435 GTCACCCAGGCTGCCCAGGCTGG - Intergenic
1200053092 X:153445023-153445045 GGCACCCAGGCGCCGCAGCTCGG + Exonic
1200068861 X:153518065-153518087 GTCACCCCGGGGCCCCAGGCCGG + Intronic
1200247681 X:154534679-154534701 GCCACCCTGGCACCCAGGGTGGG - Intronic