ID: 1088270946

View in Genome Browser
Species Human (GRCh38)
Location 11:108033919-108033941
Sequence GCTAGCAAACAGAATTAGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 114}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088270946_1088270950 17 Left 1088270946 11:108033919-108033941 CCCCACTAATTCTGTTTGCTAGC 0: 1
1: 0
2: 1
3: 8
4: 114
Right 1088270950 11:108033959-108033981 GATGTCTTTCCATACCCAAATGG 0: 1
1: 0
2: 0
3: 11
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088270946 Original CRISPR GCTAGCAAACAGAATTAGTG GGG (reversed) Intronic
904285936 1:29453340-29453362 GCTATGAGACAGAATTAGAGGGG + Intergenic
906879195 1:49572080-49572102 GCTTGCAGAAAGAATTAGGGAGG + Intronic
907831883 1:58072062-58072084 GATAGCAAACATTATTGGTGGGG + Intronic
918590288 1:186233366-186233388 AGTAGAAAACAGAATTAATGTGG - Intergenic
924164362 1:241266374-241266396 GTTAGCTAACAGATTTAATGAGG - Intronic
924800226 1:247324108-247324130 GTTGGCAATCAGAATTACTGTGG + Intronic
1065265904 10:23975219-23975241 GCTAGCAAACAAAGTTTGAGGGG - Intronic
1072008229 10:91277541-91277563 GCTATCATACAGAACTAGAGAGG - Intronic
1073772674 10:106752529-106752551 TTTAGCATACAGAATTAGAGTGG + Intronic
1075910050 10:126116693-126116715 ACTAGCAAACAGAAGACGTGAGG + Intronic
1078240866 11:9529889-9529911 GCTAGCAAACAGAACCAGGTGGG + Intergenic
1085670879 11:78463862-78463884 ACTATCAAATAGAAATAGTGAGG - Intronic
1087927429 11:103935392-103935414 GCTGGCAAACAGAGTAAGTGAGG + Intronic
1088270946 11:108033919-108033941 GCTAGCAAACAGAATTAGTGGGG - Intronic
1088436943 11:109824393-109824415 TATAGAAAACAGAATTAGAGAGG - Intergenic
1089974481 11:122720577-122720599 GCTAGGAAACAGATTCAGAGAGG - Intronic
1090716681 11:129437471-129437493 GCCAGCAAACTGAGTCAGTGGGG - Intronic
1093244838 12:16723420-16723442 GATAGCACCCAGAATCAGTGTGG + Intergenic
1095156550 12:38863451-38863473 GCTTTCAAACAGAAGTAATGAGG + Intronic
1098373768 12:69789963-69789985 GCTAACAATCATAATCAGTGGGG + Intronic
1101114912 12:101522646-101522668 ACAAACAAACAAAATTAGTGAGG - Intergenic
1110292602 13:73824696-73824718 CATACCAAACAGAATTAATGTGG - Intronic
1111554854 13:89867310-89867332 GCTAGAAAACAAAATTAAAGTGG - Intergenic
1111669596 13:91312814-91312836 CATAGCAAACAGAATTATTTGGG - Intergenic
1112342817 13:98566453-98566475 GCTAGAAAACAGCATCACTGGGG - Intronic
1113448910 13:110391998-110392020 GGGAGCAAACAGAATGTGTGGGG - Intronic
1117346994 14:54842529-54842551 GCTAGGAAACAGAAGTAGAGAGG + Exonic
1119674520 14:76543990-76544012 GCAAGCAAACAGAAATCGAGGGG - Intergenic
1120486253 14:85117250-85117272 GCTAGCAAACAGAACAAGAAAGG + Intergenic
1125229761 15:37440105-37440127 GCTACCAATCAGATTTAGTCTGG - Intergenic
1126818851 15:52481344-52481366 GGAACCAAACAGAATTAGTTAGG - Intronic
1128590922 15:68896283-68896305 GCTAGTAAGAAGAATGAGTGAGG + Intronic
1128769327 15:70270051-70270073 ATTAGCAAACAGAAGTAATGAGG + Intergenic
1129735464 15:77959107-77959129 GCTAGGATACAGGATTAGAGTGG - Intergenic
1135199283 16:20422819-20422841 GCTTGCTGACAGAATCAGTGTGG + Intronic
1135797784 16:25461921-25461943 ACTAGCACACATAATTTGTGGGG + Intergenic
1137750331 16:50856934-50856956 GCTGGCAAACAGAATTGGAGGGG - Intergenic
1139144875 16:64311231-64311253 TTTTGCAAACAGAATTACTGAGG + Intergenic
1139962290 16:70724944-70724966 TCTAGCAAACAGACTTAGGTTGG + Intronic
1142836240 17:2589676-2589698 GCTATCAATCAGAATTTGTAAGG - Intergenic
1146130675 17:30271965-30271987 GCTAAAAAAAAGAATTAATGAGG - Intronic
1146736654 17:35243921-35243943 CCTAACAAAAAGAAGTAGTGGGG + Intronic
1146900110 17:36579708-36579730 GCTATGAAACATAACTAGTGAGG + Intronic
1147451616 17:40509184-40509206 GCCAACAAACAGACTGAGTGAGG + Intergenic
1149312591 17:55409369-55409391 TCTAGAAAACAGAATTAGAAAGG - Intronic
1149980669 17:61308757-61308779 GATAGAAAACAGACTTAGTATGG - Intronic
1155373703 18:25133287-25133309 GGGAGCAAACAGAAGTAGTGAGG - Intronic
1155782256 18:29851187-29851209 GCTAGCAAACAGAAATAGCCAGG + Intergenic
1156703512 18:39852822-39852844 TCTAGCAAACAGAAATATTTGGG - Intergenic
1157177400 18:45464136-45464158 TCTACCCAACAGAAGTAGTGGGG + Intronic
1157636976 18:49168431-49168453 GCATGTAAACAGAATAAGTGTGG + Intronic
1162412167 19:10513068-10513090 GGCAGCAGACAGAATTACTGAGG - Exonic
1167024790 19:46907449-46907471 GCTAAGAAACAGAATGAATGGGG - Intergenic
927066330 2:19474717-19474739 CCTAGGAAATAAAATTAGTGTGG + Intergenic
928013442 2:27631866-27631888 GGTAGCAAAGAGATTGAGTGAGG - Exonic
928072390 2:28230417-28230439 GCTAGAAAACAGAACAAGTCCGG + Intronic
929019953 2:37542754-37542776 GCGAACAAACATAATTAGTAGGG - Intergenic
934803401 2:97191826-97191848 GCTAACAAACAGGAGTAATGAGG - Intronic
936364639 2:111841734-111841756 GTTATCAAACAGGATTACTGTGG + Intronic
939430009 2:142092052-142092074 GCAAGCAAACAGAATGATTGTGG + Intronic
940646862 2:156400722-156400744 GCTAGCAGACTGAATGAGTATGG + Intergenic
940655776 2:156486316-156486338 GCTGGCATACAAAATCAGTGAGG + Intronic
948184581 2:236010680-236010702 GTTAGCAAACTGAATTCATGAGG - Intronic
1169446291 20:5674061-5674083 ACTAGCAATCAGAGTTTGTGAGG + Intergenic
1177439611 21:21104560-21104582 GTCAGTAAACAGAATTAGAGGGG + Intronic
1178499335 21:33112767-33112789 GCTAGGAAACAGGATTCCTGGGG + Intergenic
1178970156 21:37167303-37167325 CCTAGAAAACATAATGAGTGGGG - Intronic
1179394688 21:41028058-41028080 GCTCTGAAACAGAATTAGAGAGG - Intergenic
949656093 3:6221705-6221727 GATAGGAAAAAGAATCAGTGAGG - Intergenic
949725766 3:7042488-7042510 ACAAGCAAACAGAATGAGTGAGG - Intronic
955456470 3:59126981-59127003 CCTAGCAAAGAAATTTAGTGAGG + Intergenic
956842008 3:73149030-73149052 GCTTGGAAACAGAAGAAGTGGGG - Intergenic
959727593 3:109561423-109561445 GGTAGCCAGCAGAATTAGGGAGG - Intergenic
960992116 3:123318692-123318714 GCAAGCAAACTGAATTAGCAAGG - Intronic
964059110 3:152500162-152500184 GTCAGCAAACTGAATTGGTGTGG - Intergenic
964144797 3:153446901-153446923 GCTAGAAATCAGAAGGAGTGTGG + Intergenic
967434043 3:189423862-189423884 ACTAGCAAATAAAATTAATGTGG - Intergenic
968125939 3:196160290-196160312 GCTGGCAAACAGAATTGAGGGGG - Intergenic
971162575 4:24148309-24148331 GGTGGAAAACAGAATTTGTGTGG - Intergenic
972683931 4:41333434-41333456 CCTAGGAAACAAAAATAGTGTGG - Intergenic
977449417 4:97176078-97176100 GGTACCAAACATAATTACTGAGG + Intergenic
977633331 4:99267950-99267972 GCAAGCACACAGAACTAGTAAGG - Intergenic
979241766 4:118453396-118453418 GCTAGAAAACAGAATTCGTGGGG - Intergenic
982433290 4:155349173-155349195 GCTTGCAAACAGTAGTGGTGAGG + Intronic
984933129 4:184865936-184865958 GAAAGGAAATAGAATTAGTGAGG + Intergenic
985872434 5:2568215-2568237 GCAAGCACACAGAATAATTGAGG + Intergenic
990160020 5:52927552-52927574 GAAAGCAAACAGAATCAGAGTGG - Intronic
991434753 5:66586303-66586325 GCTAGCTAACAAAATTTGAGAGG + Intergenic
991589992 5:68240919-68240941 ACTAGAAAATAGAATGAGTGGGG - Intronic
992483054 5:77170023-77170045 GCAAGCAAAAAGGATTAATGTGG + Intergenic
994442407 5:99826379-99826401 CCTAGAAAACCTAATTAGTGGGG - Intergenic
999484472 5:151981775-151981797 GATAGCAAACAATAATAGTGGGG - Intergenic
1002985116 6:2182352-2182374 TCTAGCCAACATAATTAGTGAGG + Intronic
1004090051 6:12491910-12491932 AATAGCAAACATAATTAGGGAGG + Intergenic
1006795976 6:36732656-36732678 GCTTGCAAATAGAAATAGCGAGG - Exonic
1008592250 6:53005967-53005989 GCAAGCATACAGTATGAGTGAGG - Intronic
1009965856 6:70577217-70577239 GGTAGCAGACAGAATTAAGGTGG - Intronic
1012975454 6:105777035-105777057 TCTAGCAAATAAACTTAGTGAGG + Intergenic
1015423911 6:133042192-133042214 AGTAGAAAACAGATTTAGTGAGG - Intergenic
1016628736 6:146202839-146202861 GCTATCAGACAGAATCACTGAGG - Intronic
1021383731 7:20002192-20002214 GAAAGAAAACATAATTAGTGTGG + Intergenic
1028103524 7:86850151-86850173 GCAAGCAAACACCATTTGTGTGG - Intronic
1033400222 7:141015516-141015538 GCTTGAAAACAGATTTAGTATGG - Intergenic
1033782494 7:144688999-144689021 GCTTGATAACAAAATTAGTGAGG - Intronic
1039038786 8:33386986-33387008 GGTAGAAAACAGAATTTCTGAGG - Intronic
1041043425 8:53869247-53869269 GCTAGCAAATATAAAAAGTGGGG + Intronic
1041329839 8:56713110-56713132 CTTAGGAAACAGAATTGGTGTGG + Intergenic
1043537888 8:81226299-81226321 GGAAGCCAACAGAATTAGGGAGG - Intergenic
1046524378 8:115365569-115365591 GCTAACAAACACAAGTAATGGGG - Intergenic
1047517172 8:125565089-125565111 GCCAGCAAAGAGAAGTAGTCAGG + Intergenic
1048383161 8:133886193-133886215 ACTAACAAACAGGATGAGTGAGG + Intergenic
1050736488 9:8769033-8769055 GCTAACACACAGAATTAGGTGGG - Intronic
1050964130 9:11775922-11775944 GCTAGAAAACAGAAGAAATGGGG - Intergenic
1054319870 9:63647216-63647238 GCTGACGTACAGAATTAGTGAGG + Intergenic
1056205483 9:84315691-84315713 GATTTCCAACAGAATTAGTGGGG + Intronic
1058225131 9:102350892-102350914 GCTAGAAATCAGAATTGGTCTGG - Intergenic
1059659831 9:116389911-116389933 GCTAGAATGCAGAATTAATGAGG + Intronic
1060238169 9:121880954-121880976 GCTGGCAACCAGAAGTAGAGGGG - Intronic
1186613389 X:11160719-11160741 GCGAGCAATCATAATTACTGAGG + Intronic
1192306772 X:69968594-69968616 GCTAGCGGAGAGAAATAGTGAGG - Intronic
1196756401 X:119161046-119161068 GCTTGCAAAAAGATTTATTGAGG + Intergenic
1199561320 X:149166099-149166121 GCTAGCAAAAACAAGTAATGGGG + Intergenic
1202389476 Y:24355226-24355248 GCTAGAAAACAGAACTCATGGGG - Intergenic
1202481308 Y:25314888-25314910 GCTAGAAAACAGAACTCATGGGG + Intergenic