ID: 1088274592

View in Genome Browser
Species Human (GRCh38)
Location 11:108071762-108071784
Sequence GACTGGTCTTTTTAACTCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 4, 3: 17, 4: 194}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088274592 Original CRISPR GACTGGTCTTTTTAACTCCT GGG Intronic
902850965 1:19156170-19156192 AGCTGATTTTTTTAACTCCTGGG + Intronic
909462100 1:75928669-75928691 GACTGATCTTTATAGCTACTTGG + Intronic
910356774 1:86366341-86366363 TCCTGGGCTTTTGAACTCCTGGG - Intronic
911467165 1:98270347-98270369 GAATGGTCTCTTTCACTCCTAGG - Intergenic
911950259 1:104164592-104164614 GGGTGGTCTTTATACCTCCTTGG + Intergenic
912180683 1:107215843-107215865 TAGAGGTCTTTTTACCTCCTTGG + Intronic
912329993 1:108811217-108811239 CACTGGAATTTTGAACTCCTGGG + Intergenic
920113293 1:203602060-203602082 GGCTGGTCTCATGAACTCCTGGG + Intergenic
920147881 1:203878322-203878344 GACTGGTCCTGCAAACTCCTGGG + Intergenic
921494974 1:215828237-215828259 GGCTGGTCTTTCGAACTCCTGGG - Intronic
921873225 1:220164420-220164442 TACTGGCCATTTTAACTACTTGG - Intronic
923596436 1:235363832-235363854 CACTGGTATCTTTAACTCTTGGG - Intergenic
1063042490 10:2357733-2357755 GGCTGGTCTCTCTAACTTCTGGG + Intergenic
1063948033 10:11196449-11196471 GGCTGGTCTTGCCAACTCCTGGG - Intronic
1064051806 10:12066192-12066214 GACTTGTCTTTTTTATTCCTTGG - Intergenic
1068494503 10:57769717-57769739 GACATGTGTTTTTAACTCCTTGG - Intergenic
1070797719 10:79226505-79226527 CAATGGCTTTTTTAACTCCTTGG - Intronic
1072135572 10:92542500-92542522 GGCTGGTCTTTCAAACTCCTGGG + Intronic
1074850313 10:117434232-117434254 GAATGCTTTTGTTAACTCCTTGG + Intergenic
1076228373 10:128799439-128799461 TACTGGTCTATTTAAATCCGTGG + Intergenic
1077786558 11:5390352-5390374 TACTGGCCTTTTTAAGACCTAGG - Exonic
1078212785 11:9284360-9284382 GGCTGGTCTCTGTAACTCCCAGG + Intronic
1079199838 11:18367241-18367263 GTCTGGACTTTTGAACTTCTGGG - Intergenic
1080003028 11:27372491-27372513 GACAGATCTTTCTGACTCCTAGG - Intronic
1081452573 11:43186055-43186077 AACTGGTATTTTTAATTCCTGGG + Intergenic
1081510759 11:43770515-43770537 GGTTGGTCTTTTGAACTTCTGGG - Intronic
1085703727 11:78767907-78767929 CACTGGTCTTTATGTCTCCTTGG + Intronic
1088274592 11:108071762-108071784 GACTGGTCTTTTTAACTCCTGGG + Intronic
1090721747 11:129481689-129481711 AACTTGTCTTTTTAATTCATAGG - Intergenic
1091558238 12:1592499-1592521 GACTGGTCTTTTCAACCCTGGGG - Intronic
1092466362 12:8736274-8736296 GACTTTTCATTTTAACTGCTTGG - Intronic
1092705525 12:11280016-11280038 GACTGGACTTTTCCACTTCTTGG + Intergenic
1097863385 12:64539989-64540011 GAATGGTCTTTTTATCTCGATGG + Intergenic
1097863581 12:64541770-64541792 GAATGGTCTTTTTATCTCCATGG + Intergenic
1098314172 12:69176091-69176113 CATTGGTTTTTTTAACTCTTTGG - Intergenic
1099406625 12:82271806-82271828 GGCTGGTCTTGAGAACTCCTGGG + Intronic
1101525216 12:105522485-105522507 CCCTGGTCTTTTTGACTCCATGG + Intergenic
1102103383 12:110299182-110299204 GGCTGGTCTCTCAAACTCCTGGG + Intronic
1102893700 12:116581638-116581660 GGCTGGTCTTGAGAACTCCTGGG + Intergenic
1103819904 12:123689264-123689286 GGCTGGTCTTTTTAACTTCTGGG + Intronic
1105462944 13:20608609-20608631 GACTGGCCATTTTAATTCCCCGG + Intronic
1106296522 13:28418782-28418804 GACCGGTCTCTGCAACTCCTGGG + Intronic
1106728954 13:32519194-32519216 CACTGGGCTCTTGAACTCCTGGG - Intronic
1107553339 13:41496756-41496778 GACTTGTCTATTTAAATCCCAGG - Intergenic
1107966444 13:45602485-45602507 CACTGGCCTTTTTCAGTCCTGGG + Intronic
1111761206 13:92467692-92467714 GAGTCGTATTTTTAACTGCTGGG + Intronic
1112337753 13:98528487-98528509 GAATTGTCTTTGTAACTCTTGGG - Intronic
1113043522 13:106129171-106129193 GTCTGCTGTATTTAACTCCTGGG + Intergenic
1113235838 13:108272601-108272623 AATAGTTCTTTTTAACTCCTTGG + Intronic
1114498718 14:23152623-23152645 GGCTGGTCTCTAGAACTCCTGGG + Intronic
1115016996 14:28629434-28629456 AACTGGTCTGTTTTAATCCTGGG - Intergenic
1116423437 14:44760946-44760968 GAATGGTTTTTTGAACTCTTCGG - Intergenic
1118368199 14:65113593-65113615 CACTGGTCTCTTGAACTTCTGGG + Intergenic
1118585836 14:67352255-67352277 GGCTAGTCTTTTTGACTCCCGGG - Intronic
1118660694 14:68006786-68006808 TTCTGGTCTTATAAACTCCTGGG + Intronic
1122876027 14:104665828-104665850 GCCTGGGCTTTTTCACACCTTGG + Intergenic
1124187667 15:27544156-27544178 TACTGGTTTCTTTAACTCTTTGG - Intergenic
1124431536 15:29612818-29612840 CACTGGTTTCTTTAACTCTTTGG - Intergenic
1124499675 15:30216447-30216469 GCCTGGTGTTTTTCACTCCAAGG + Intergenic
1124743904 15:32322220-32322242 GCCTGGTGTTTTTCACTCCAAGG - Intergenic
1125270528 15:37933998-37934020 CACTGGTTTCTTTAACTCTTTGG + Intronic
1126406497 15:48328329-48328351 GGCGGGTCTCTTGAACTCCTGGG - Intergenic
1126911315 15:53419828-53419850 GGCTTGTCTTTATGACTCCTGGG - Intergenic
1127416121 15:58758893-58758915 GTCTGGTCTTTTGAATTACTGGG + Intergenic
1129201089 15:74000516-74000538 GACTGGTCTTGAGAACTCTTGGG + Intronic
1130548388 15:84872985-84873007 GTCTGGCCTTTTTCATTCCTGGG + Exonic
1130730147 15:86483406-86483428 GTCTGGTTTATTTAACCCCTAGG + Intronic
1130779609 15:87021713-87021735 GACATGTGTTTTCAACTCCTAGG + Intronic
1132196423 15:99917604-99917626 GTTTGGCCTTTCTAACTCCTTGG - Intergenic
1132464274 16:70597-70619 CACTGGTCTGTCTAACCCCTGGG + Intronic
1132818092 16:1844672-1844694 GGCTGGTCTCATGAACTCCTGGG + Intronic
1133330659 16:4971244-4971266 GGCTGGTCTCTCAAACTCCTAGG - Intronic
1133482654 16:6186181-6186203 AAGTGCTTTTTTTAACTCCTGGG + Intronic
1136269369 16:29139380-29139402 CACTGGGCTTTTTTCCTCCTAGG - Intergenic
1136683998 16:31983597-31983619 GCCTGGTCTTTCTCACTCCAGGG + Intergenic
1136784624 16:32927149-32927171 GCCTGGTCTTTCTCACTCCAGGG + Intergenic
1136885159 16:33926657-33926679 GCCTGGTCTTTCTCACTCCAGGG - Intergenic
1137409595 16:48216652-48216674 TACTGGTTTCTTTAACTCTTTGG - Intronic
1137604391 16:49777728-49777750 GACTAGTCTCTTTAGCTCTTTGG + Intronic
1137807349 16:51319929-51319951 GACTGGTCTCTTGAACTTTTGGG - Intergenic
1141924254 16:87156955-87156977 GGCTGGTCTCTTGAACTCCTGGG - Intronic
1142072846 16:88100650-88100672 CACTGGGCTTTTTTCCTCCTAGG - Intronic
1203087283 16_KI270728v1_random:1191155-1191177 GCCTGGTCTTTCTCACTCCAGGG + Intergenic
1143818295 17:9538118-9538140 GACTGTACTTAGTAACTCCTTGG + Intronic
1144053900 17:11521725-11521747 CACTGCACTTTTGAACTCCTGGG - Intronic
1144790866 17:17858348-17858370 GACTGGTCTCAAAAACTCCTGGG + Intronic
1147144924 17:38479300-38479322 GCCTGGTCTTTCTCACTCCAGGG + Intronic
1148492698 17:48033508-48033530 AACTGGGCTTGTTGACTCCTTGG - Intronic
1148504456 17:48116426-48116448 GGCTGGTCTCTCAAACTCCTTGG + Intronic
1149359035 17:55873743-55873765 CACTGGTTTCTTTAACTCTTTGG + Intergenic
1149883918 17:60321138-60321160 AAGTTGTCTTTTGAACTCCTGGG + Intronic
1150473298 17:65455888-65455910 GACTGTTATTTTTAACTCCAGGG - Intergenic
1150482322 17:65520018-65520040 GAGTGGTCTTATTGACTCTTGGG - Intergenic
1150620789 17:66806522-66806544 GACTGGCCCTTTTGTCTCCTAGG - Exonic
1151646518 17:75436129-75436151 GAATGAACTTTATAACTCCTTGG - Intergenic
1153243392 18:3051155-3051177 TGCTGGTCTCTTGAACTCCTGGG + Intergenic
1156836170 18:41557893-41557915 GACAGGATTTTTTTACTCCTTGG + Intergenic
1156881832 18:42089146-42089168 CATTGGTCTGTTTAACTCTTCGG + Intergenic
1157820990 18:50768309-50768331 GGCTGGTCTCTTAAACTCCTGGG - Intergenic
1157880078 18:51313186-51313208 CATTGTTCTTTTTCACTCCTTGG + Intergenic
1158023952 18:52873621-52873643 GACTGATCTATTTACCCCCTTGG - Intronic
1165172163 19:33901402-33901424 GGCTGGTCCTCTCAACTCCTTGG + Intergenic
1167855213 19:52231891-52231913 TACTGGTTTATTTAACTCTTTGG + Intergenic
927278317 2:21280520-21280542 GATTTGTCTTTTTAATTCCCTGG + Intergenic
927287558 2:21372319-21372341 TCCTGGTCTTTTAATCTCCTGGG - Intergenic
930619128 2:53626035-53626057 GACAGGGGTTTTGAACTCCTGGG + Intronic
931609730 2:64085915-64085937 TACTTTTATTTTTAACTCCTTGG - Intergenic
934877170 2:97934116-97934138 GACTTTTCTTTTTGAGTCCTTGG - Intronic
935453271 2:103235586-103235608 GCCAGGTCTTTTTACCTCTTAGG + Intergenic
936604177 2:113932109-113932131 CACTGGTTTTTGTAACTCCACGG + Intronic
937015327 2:118600172-118600194 GGCTGGTCTCTCAAACTCCTGGG + Intergenic
937159782 2:119749278-119749300 GACTCTTTTTTTTAAGTCCTGGG + Intergenic
937184361 2:120026012-120026034 GACTATTCTTTTTAACATCTTGG - Intronic
937998988 2:127717042-127717064 GACTGGTCATTTGAACCTCTGGG - Intronic
939607724 2:144273504-144273526 GATTGGGCTTTTTGAGTCCTGGG - Intronic
940221769 2:151360083-151360105 GGCTGGTCTTTTTAATTCCTGGG - Intronic
942458679 2:176154740-176154762 GACTGCTCTTTGTTTCTCCTTGG + Intronic
942652677 2:178184748-178184770 CACAGGTATTTTTACCTCCTTGG - Intergenic
943497268 2:188637231-188637253 TTCTGATCTTTGTAACTCCTGGG - Intergenic
945395413 2:209309602-209309624 AACTGGTCATGTTACCTCCTAGG + Intergenic
946243220 2:218369461-218369483 ATCTGGTCTTTATAACTCCAGGG + Intergenic
947222398 2:227806012-227806034 TACTTTTTTTTTTAACTCCTAGG + Intergenic
947547614 2:231021770-231021792 AACTGGTCTTTTTAGTTCATAGG - Intronic
947586295 2:231358945-231358967 GGCTGGGCATTTTAACTCCCAGG - Intronic
948609592 2:239158348-239158370 TACTGATCTTTTTAACTCGTGGG - Intronic
948829737 2:240592596-240592618 GGCGGGTCTCTTGAACTCCTGGG - Intronic
948841022 2:240649017-240649039 CACCGGTCTTTTTAACCCTTCGG + Intergenic
1168923463 20:1560099-1560121 GACTGGTTTCTTTAACTCTTTGG + Intronic
1169984543 20:11429284-11429306 GACTTGTCATTTTTGCTCCTTGG + Intergenic
1172156365 20:32828012-32828034 GACTTGTCTTGTTATTTCCTTGG + Intronic
1172260784 20:33563416-33563438 GACTAGTCTCTTAAACTTCTAGG + Intronic
1172385314 20:34530063-34530085 GACTGGACATTTTGACTCCAAGG + Intronic
1172711677 20:36929428-36929450 GACTGTTCCTTTTAAATCATGGG - Intronic
1174049329 20:47756943-47756965 GCCTGTTCTCTTTAACTCTTTGG + Intronic
1174269781 20:49359459-49359481 GGCTGGTCTTGGCAACTCCTGGG + Intergenic
1174313087 20:49674632-49674654 GTCTGGTCTCTGTAACTACTGGG - Intronic
1175196047 20:57244066-57244088 GCCTGGTCTACTTTACTCCTGGG - Intronic
1176198582 20:63849190-63849212 CTCTGGTAATTTTAACTCCTAGG - Intergenic
1179206349 21:39283698-39283720 AACAGGTATTTTTAACTTCTGGG + Intronic
1181744318 22:24945272-24945294 GAGTGGTCTTTTGAAAACCTAGG - Intronic
1182245952 22:28957742-28957764 GACTGTTCTTTTTGAGACCTTGG + Intronic
1184057715 22:42063474-42063496 TACTTTTTTTTTTAACTCCTAGG - Intronic
1184795056 22:46727504-46727526 GGTTGGTCTCTCTAACTCCTGGG + Intronic
1184997026 22:48214768-48214790 GATTGGTGTATTTGACTCCTAGG - Intergenic
949487507 3:4553951-4553973 GGCTGGTCTTGAAAACTCCTGGG + Intronic
949860695 3:8501965-8501987 CACTCACCTTTTTAACTCCTGGG - Exonic
952522440 3:34174855-34174877 GACTGGTCTTTCTGGCTGCTTGG - Intergenic
953373776 3:42411759-42411781 CATTGGTTTTTTTAACTCTTTGG + Intergenic
954269747 3:49498351-49498373 AACAGGCCTTTTTGACTCCTTGG - Intronic
956387971 3:68741317-68741339 TACTGATTTTTTTACCTCCTTGG + Intronic
959173761 3:102877590-102877612 CACTGTTGTCTTTAACTCCTGGG + Intergenic
960248405 3:115425197-115425219 GCCTGCTCTTCTTAACACCTGGG + Intergenic
961241682 3:125416891-125416913 AGCTGGTCTTTTAAACTTCTGGG + Intergenic
962927985 3:140012605-140012627 GACTTCTCTTTCTAACTCATGGG + Intronic
963127136 3:141826762-141826784 GGCTGGTCTCTGAAACTCCTGGG - Intergenic
966437161 3:179901024-179901046 GACTTGTCTATTTATCTCGTGGG + Intronic
967048238 3:185757076-185757098 AAGTGGTCTTTTCTACTCCTGGG + Intronic
970198351 4:13575592-13575614 GGCTGGTCTCATAAACTCCTGGG + Intronic
972561692 4:40234467-40234489 GACTGGTCTCTTCCACTCCCAGG - Intronic
973877093 4:55230677-55230699 GACTTGTCATTTGAACACCTAGG - Intergenic
975053437 4:69895897-69895919 AACTGCTCGTTTGAACTCCTGGG + Intergenic
975088522 4:70372752-70372774 TACTGGTTTCTTTAACTCTTTGG - Intronic
975761032 4:77620036-77620058 TACTGGTATTTTTAATTTCTAGG - Intergenic
979494344 4:121367729-121367751 GCCTGGTCCTTTTGACACCTGGG + Intronic
981189969 4:141851231-141851253 GACTGGTGTTTTCATTTCCTGGG + Intergenic
982264696 4:153527485-153527507 GGCTGGTCTTTTGAACTCCTGGG + Intronic
982970870 4:161984596-161984618 GGCTAGTCTCTCTAACTCCTGGG + Intronic
987004981 5:13701307-13701329 GACGGGTTTTTTTAACCCCCAGG - Exonic
987176011 5:15310256-15310278 TACTGTTTTTTTCAACTCCTTGG - Intergenic
987294244 5:16536119-16536141 GACCAGTCCTTTTATCTCCTTGG + Intronic
987647340 5:20690896-20690918 TACTGGTCCTCTTAAGTCCTTGG - Intergenic
990146729 5:52769438-52769460 TACTGATCTTTGTAATTCCTGGG + Intergenic
991517657 5:67456803-67456825 CACTGGTTTCTTTAACTCTTCGG + Intergenic
992165392 5:74045238-74045260 GGCTGGTCTCTTGAACTCCTGGG + Intergenic
992414530 5:76539700-76539722 GACTGGTCCTCTGACCTCCTGGG + Intronic
993936716 5:94013528-94013550 TACTGGTTTCTTTAACTCTTTGG + Intronic
998324601 5:141268699-141268721 TACTGGTTTCTTTAACTCTTTGG + Intergenic
1001050073 5:168407000-168407022 GGCTGGTCTTGATAACTCCTGGG + Intronic
1003887115 6:10531847-10531869 GATTGGCCTTTTTACCTCCCTGG - Intronic
1005235249 6:23754146-23754168 TATTGGTTTTTTAAACTCCTTGG + Intergenic
1005424658 6:25689750-25689772 GACTTTTTTTTTTGACTCCTTGG + Intronic
1005465699 6:26110249-26110271 GGCTGGCCTTGTGAACTCCTGGG - Intergenic
1006553071 6:34841043-34841065 GGCTGGTCTCTTTAACTCCTGGG + Intronic
1006990034 6:38207409-38207431 GGCTGATCTCTTGAACTCCTGGG - Intronic
1007691149 6:43702407-43702429 AACTGTTCTGTTTAACTCCGGGG - Intergenic
1009575123 6:65445098-65445120 AAAAGGTCTTTTAAACTCCTTGG + Intronic
1013165739 6:107590339-107590361 GACTGGTCTTTTGAAAACCTGGG - Intronic
1013515236 6:110879125-110879147 GACTGGGCTCTCAAACTCCTTGG - Intronic
1013939049 6:115638609-115638631 GACTTGTGTCTTTTACTCCTGGG - Intergenic
1015867497 6:137741840-137741862 GCCTGGTCATCTTAACTCCAAGG + Intergenic
1021890506 7:25181450-25181472 GACTGTTTTCTTTAACTCTTTGG - Intergenic
1024447367 7:49497149-49497171 CACAGGTCTCTTTAACTCATGGG + Intergenic
1026238982 7:68555356-68555378 GGCTGGTCTCATAAACTCCTGGG - Intergenic
1026504804 7:70973365-70973387 CACTGGTTTCTTTAACTCTTTGG - Intergenic
1026917059 7:74126911-74126933 CACTGGTTTCTTTAACTCTTTGG + Intergenic
1031090110 7:117344379-117344401 CAGAGGTCTTTTTACCTCCTTGG + Intergenic
1032921542 7:136554374-136554396 AAAAGGTCTTTTCAACTCCTGGG + Intergenic
1033500978 7:141949317-141949339 GCATGGTCTTCTTAACTCTTTGG - Intronic
1042511269 8:69614302-69614324 GAATGGTGTTTTTTACTCATCGG - Intronic
1043610878 8:82061585-82061607 GACTGGACTTTCTCACTCTTTGG + Intergenic
1044245727 8:89942891-89942913 GACTGGCCTTTTTAAATCTGGGG - Intronic
1048530165 8:135240747-135240769 TACTGGTTTCTTTAACTCTTTGG + Intergenic
1053235273 9:36448145-36448167 AACTGGTCTTCTTAAGGCCTGGG + Intronic
1055166177 9:73197295-73197317 TACTGCTCTTTCTAACTTCTAGG - Intergenic
1058427720 9:104889905-104889927 CAATGATCTTTTTAACTCATCGG - Intronic
1058995960 9:110298983-110299005 GACTGGAATTTGTAAATCCTAGG + Intergenic
1059762633 9:117353562-117353584 GACTGATCTTTTTAGCACCAAGG - Intronic
1059765157 9:117377133-117377155 GAGAGGTCTTTTGAACTCCTCGG + Intronic
1186062659 X:5726780-5726802 GACTGTCCTTGTTGACTCCTGGG - Intergenic
1186343046 X:8663444-8663466 CATTGGTTTCTTTAACTCCTCGG - Intronic
1186437461 X:9555287-9555309 GGCTGGTCTTTTGAATTCCTGGG + Intronic
1190816367 X:53933576-53933598 CACTGGTCTTCTCAACTCCCAGG + Intergenic
1192059881 X:67812885-67812907 AATTGGTCTTTTTTACTTCTTGG + Intergenic
1192067039 X:67896301-67896323 AAGTGGTCTTTTTTCCTCCTAGG - Intergenic
1197949720 X:131881212-131881234 GGCTGGTCTCTCAAACTCCTGGG + Intergenic
1200285640 X:154819791-154819813 GGCTGGGCTTTTTTCCTCCTAGG - Intronic