ID: 1088279561

View in Genome Browser
Species Human (GRCh38)
Location 11:108122292-108122314
Sequence TTGTGTTTAGGGAACACAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 155}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088279557_1088279561 2 Left 1088279557 11:108122267-108122289 CCAAGGGCTGTCGCTCTTCTGAC 0: 1
1: 0
2: 0
3: 10
4: 135
Right 1088279561 11:108122292-108122314 TTGTGTTTAGGGAACACAGCAGG 0: 1
1: 0
2: 0
3: 15
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088279561 Original CRISPR TTGTGTTTAGGGAACACAGC AGG Intronic
900842020 1:5059167-5059189 TTGTGATTAGAGAACATACCTGG - Intergenic
904494962 1:30881394-30881416 GTGTGTTTAGGGAACATACGTGG - Intronic
910051505 1:82979274-82979296 TTGTTTCTAGGGAACACAGTAGG - Intergenic
910523128 1:88146255-88146277 TAGTGTTTAGGGAAGACAAAGGG - Intergenic
911061763 1:93754334-93754356 TTGTGTTCAGGGAACAATGGAGG - Intronic
911636965 1:100246838-100246860 GTGTGTTAAGGGAACCTAGCTGG + Intronic
913484787 1:119324245-119324267 GTGTGTTTAGAGTAGACAGCAGG + Intergenic
915755849 1:158258612-158258634 TTGTGTTTTGGAAAATCAGCAGG + Intergenic
916812277 1:168315955-168315977 GTGTGTTTAAGAATCACAGCAGG - Intergenic
916972751 1:170042002-170042024 TTGTGTGTGGGGAACCCAGAAGG + Intronic
920750207 1:208667300-208667322 TTGCATTTAGAGAAAACAGCTGG - Intergenic
920798656 1:209165510-209165532 TTGTGTTCAAGGAGCTCAGCTGG + Intergenic
921718522 1:218444661-218444683 TGGTGTTTAGACAACACAACAGG - Intergenic
922667210 1:227480802-227480824 TTGAGTTTGGGGAACACTGCCGG + Intergenic
923852721 1:237815026-237815048 TTGGCTTTAGGGAACACTGAGGG - Intronic
924698869 1:246429606-246429628 TTAAGTTCTGGGAACACAGCAGG - Intronic
1065544491 10:26805643-26805665 TTGCTTTTAGGGTAAACAGCTGG - Intronic
1066667217 10:37796187-37796209 TTGTGTTTGGAGAACACCACAGG - Intronic
1068300736 10:55135431-55135453 TTGTGTTTAGGGAGTGGAGCTGG - Intronic
1070830803 10:79417141-79417163 GGGTGTTTTGGGAACACAGAGGG + Intronic
1073159305 10:101375985-101376007 TTGTACTTGGGAAACACAGCAGG + Intronic
1086751555 11:90501184-90501206 ATGTGTTCAGGGAATATAGCTGG + Intergenic
1088279561 11:108122292-108122314 TTGTGTTTAGGGAACACAGCAGG + Intronic
1089762704 11:120740016-120740038 CTGTGTTTGGGAAACACAGATGG + Intronic
1091310425 11:134571475-134571497 TTGTGTTCAGGAAACAAAGGTGG - Intergenic
1096814620 12:54194073-54194095 TTGTCTTTTGGGAACATTGCAGG - Intergenic
1097495265 12:60323561-60323583 TTTTGTTTAGGTAGCACATCTGG + Intergenic
1098650329 12:72958618-72958640 TTGGCTTTAGGGAATACAGTGGG - Intergenic
1098674020 12:73266388-73266410 TTATGTTTATAGAACACAGATGG - Intergenic
1100411615 12:94324973-94324995 GTATGTTGAGGGAACACAGGAGG - Intronic
1100447277 12:94672786-94672808 TTCTGTTTAGGGAACAGTGTAGG - Intergenic
1106010847 13:25820574-25820596 CTGCGTTTAGTGTACACAGCTGG + Intronic
1108852926 13:54757504-54757526 TTGTGTTTTTGGAAGACAGAAGG - Intergenic
1109211636 13:59541857-59541879 TTGTGTTTAGATATTACAGCTGG - Intergenic
1109484553 13:63001840-63001862 TGCTGTTTTGGGAACACAGTGGG + Intergenic
1111561884 13:89962043-89962065 ATGTTTATTGGGAACACAGCAGG - Intergenic
1111904812 13:94242633-94242655 CTGTGTTTAGGGATTACAGTGGG + Intronic
1114907635 14:27150915-27150937 TTGTGGTTAGGGACCATTGCTGG + Intergenic
1117166170 14:53036150-53036172 TTATGTTTAGGGAACAGCACAGG + Intergenic
1118657952 14:67973603-67973625 TTGAGTTAAGGGACCACACCAGG - Intronic
1119485187 14:74982251-74982273 CTGTGTTTAAGGCACACAGCTGG - Intergenic
1119630250 14:76225165-76225187 GAGTGTTTAAAGAACACAGCTGG + Intronic
1125404340 15:39337112-39337134 CTGTGTTTTGGACACACAGCAGG + Intergenic
1125544539 15:40492925-40492947 TTGGGTTTAAGAAACACACCAGG - Intergenic
1127765135 15:62178544-62178566 GTGTGTGCAAGGAACACAGCAGG + Intergenic
1127987274 15:64083596-64083618 TTTTGTTCAGTCAACACAGCTGG - Intronic
1128543985 15:68555256-68555278 TTGTGTGTGGAGAACACACCTGG - Intergenic
1132376441 15:101331390-101331412 TTGGGTTCAAGGAGCACAGCTGG - Intronic
1135649886 16:24196895-24196917 TATTGTTCAGGGCACACAGCAGG + Intronic
1136671399 16:31861870-31861892 ATGTGATTAGTGAACACAGTGGG - Intergenic
1140140119 16:72247856-72247878 TTTTGTTTGGGGAACACACAAGG + Intergenic
1140616793 16:76674915-76674937 TTGTGTGTTGAGAACACAGCAGG - Intergenic
1144262154 17:13532292-13532314 TTGTCATCAGGTAACACAGCGGG + Intronic
1144993158 17:19247861-19247883 TTGTGTTTAGGGAGTAAAGGGGG + Intronic
1146888866 17:36491810-36491832 ATATGTGTAAGGAACACAGCAGG - Intronic
1150989497 17:70239572-70239594 TTGTCTTTAGGGAAAGTAGCAGG - Intergenic
1152551651 17:81033368-81033390 GTGGGTGCAGGGAACACAGCAGG + Intergenic
1153411424 18:4798113-4798135 TTTTCTTTAGGGAACAAAGTGGG - Intergenic
1157228525 18:45891000-45891022 ATGTGTTTGGGGAAGACAGGAGG - Intronic
1158832388 18:61294365-61294387 TTGTGGTTAGGGAATGGAGCTGG - Intergenic
1164450666 19:28361258-28361280 TTGTGTTTAGACAATATAGCTGG - Intergenic
1164868187 19:31622333-31622355 GCGTGTTTAGGGGAAACAGCAGG - Intergenic
926164797 2:10514651-10514673 GTGTCTTTTGGGAACACAGTAGG + Intergenic
926619522 2:15034488-15034510 TTGTTTTTAAGCAACACAGCCGG + Intergenic
926660788 2:15463662-15463684 TTGTGTTCAGGGATCATAGCTGG - Intronic
928760859 2:34580535-34580557 TTGTGTTTAGTGAAATAAGCCGG + Intergenic
928992115 2:37243853-37243875 TTGTGTTTAGAAAACACCACAGG + Exonic
932184815 2:69685224-69685246 TTGTTTTTAGTGAACTCATCTGG - Intronic
932460452 2:71878850-71878872 CTGTGTGTGGGGAGCACAGCTGG - Intergenic
933152933 2:78936552-78936574 TTTTGTTTAGGGACGACTGCAGG - Intergenic
935035246 2:99365000-99365022 TAGTGTTTAGAGATCACAACTGG + Intronic
936694033 2:114926582-114926604 TTGTAGTATGGGAACACAGCAGG - Intronic
936947814 2:117946332-117946354 CTGGGTTTAGGGAACACACCTGG - Intronic
937018780 2:118631918-118631940 TTGTGTTCAGAGAAGACAGTAGG + Intergenic
940346057 2:152630282-152630304 TTGTGTTTAGAAAAGAAAGCAGG + Intronic
941082436 2:161077690-161077712 ATGAGTTCAGGGAAAACAGCTGG + Intergenic
941980606 2:171452029-171452051 TTGGGTTTAAGGAACACAGAAGG + Intronic
944214985 2:197245998-197246020 TTCTGGTTTGGGGACACAGCAGG - Intronic
1168770137 20:409168-409190 TTTTGTTTGGAGAACACAGAGGG - Intronic
1169059968 20:2654000-2654022 TTGTGTTTAGGCAAAACCTCAGG - Intronic
1169738168 20:8860081-8860103 TTATGGTTAAGCAACACAGCTGG - Intronic
1171318049 20:24212817-24212839 TTATTTATAGGGAAAACAGCAGG + Intergenic
1173020850 20:39267010-39267032 CTGTGTTTGGGGGACCCAGCAGG - Intergenic
1173438375 20:43053390-43053412 TTGTGTTTAGAGAAACCACCCGG - Intronic
1178540115 21:33442324-33442346 CTGTGGTGAGGGAAAACAGCTGG + Intronic
1179720845 21:43315378-43315400 GTGTGTGAGGGGAACACAGCAGG + Intergenic
1181363400 22:22355840-22355862 TTGTGTTTATATAACACATCAGG - Intergenic
1181369062 22:22402025-22402047 TTGTGTTTACATAACACACCAGG - Intergenic
1181662477 22:24362398-24362420 TTGTGTTTAGAGAACAAGGGAGG + Intronic
1182703577 22:32260464-32260486 TGGTGTTGGGGGAATACAGCTGG - Intergenic
1184573333 22:45341216-45341238 ATGTTTTTAGGGAGAACAGCTGG + Exonic
1184907826 22:47500899-47500921 TTGTGTCTAGGTCAAACAGCAGG - Intergenic
953924157 3:46972935-46972957 TTATGTGTAGGGAAAACAGCTGG - Intronic
955601963 3:60655204-60655226 TTGCATTTAGGGAGCTCAGCTGG + Intronic
955767232 3:62357654-62357676 TTGTTATTAGGCAACACAACTGG + Intergenic
958657381 3:97019491-97019513 TTGTGTTGAGAAAACATAGCTGG - Intronic
960738906 3:120811173-120811195 ATGTGTTTAGGAAACAAACCAGG + Intergenic
960791441 3:121435735-121435757 TTGGCTTAAGAGAACACAGCTGG - Intronic
961438912 3:126939183-126939205 GTGTGGCGAGGGAACACAGCTGG + Intronic
962307151 3:134299094-134299116 TTATCTTTGGGGAAGACAGCTGG + Intergenic
964326762 3:155555256-155555278 TTTTATCGAGGGAACACAGCTGG + Intronic
965687560 3:171320874-171320896 CTGTGTTTAGGCAAGCCAGCAGG - Intronic
966240931 3:177754647-177754669 TTCGGCTGAGGGAACACAGCAGG - Intergenic
966959178 3:184916347-184916369 TAGTGTTTAGCGAAAGCAGCAGG + Intronic
969084892 4:4648895-4648917 CTGTGTATAGAGAACACAGGAGG - Intergenic
969500644 4:7550548-7550570 GTGTGTCTGGGGAACCCAGCTGG + Intronic
970668574 4:18367519-18367541 TTATGTTTAGGGACCATTGCTGG - Intergenic
971903423 4:32694531-32694553 TTGTGTTTACAAAACATAGCTGG + Intergenic
972562113 4:40238151-40238173 AGGTATTTTGGGAACACAGCAGG + Intronic
975083249 4:70305763-70305785 TTTTGTTTAGGGAAAATGGCCGG - Intergenic
976312671 4:83627880-83627902 ATGTGTTTAGGCCACAAAGCTGG + Intergenic
976821627 4:89213527-89213549 TTTTGCTGAGGGAACACAGCAGG - Intergenic
978300768 4:107267488-107267510 TGGTGTTTCTGGAAAACAGCGGG - Intronic
980179808 4:129389747-129389769 TTGGGATTGGGGAACACAGAGGG + Intergenic
981130129 4:141149338-141149360 TTGGGTATAGGGTACACTGCTGG - Intronic
981198146 4:141944068-141944090 TTTTGGTTAGGGACCACTGCAGG - Intergenic
982042834 4:151412060-151412082 TTGTGTTTAGATTACACAGGAGG + Intronic
984741247 4:183165500-183165522 TAATTTTTAGAGAACACAGCAGG + Intronic
986240236 5:5954379-5954401 GAGAGGTTAGGGAACACAGCCGG + Intergenic
986766911 5:10936560-10936582 TTTTGTTTAGGCAACATAACTGG - Intergenic
987671620 5:21016852-21016874 TTGTGTTTAGGGAAATAATCGGG - Intergenic
989450499 5:41581633-41581655 TTATCTTTAGGGAACAGACCTGG - Intergenic
991153012 5:63394394-63394416 TAGTGATTTGGGAACACAACAGG + Intergenic
994279256 5:97882030-97882052 CTGTCTTTTGGGAACACTGCAGG - Intergenic
995066819 5:107871824-107871846 ATGTATTTATGGAACACATCTGG + Intronic
996749586 5:126875257-126875279 GTGTGCTTCTGGAACACAGCAGG + Intronic
999892914 5:155998800-155998822 CTGTCTTTAGGGAACCCAGCAGG - Intronic
1000040245 5:157479919-157479941 TTGTGTTTTGTGACCTCAGCAGG - Exonic
1001271958 5:170319560-170319582 TTGTGATTGTGGAGCACAGCAGG - Intergenic
1003350518 6:5313437-5313459 ATGTAATTAGGGAATACAGCCGG - Intronic
1005190258 6:23213626-23213648 TTGTGTTTTGGGTACACATGAGG + Intergenic
1008211816 6:48733726-48733748 TTCTGATTAGGGAACATAGGAGG - Intergenic
1010407527 6:75521674-75521696 TTGTGTTTAGGCAAAGCAGATGG - Intergenic
1011206597 6:84905874-84905896 TTGTGTTTAGGAAAAAGGGCTGG + Intergenic
1011977699 6:93326042-93326064 TAATGTTTGGTGAACACAGCAGG - Intronic
1015752809 6:136577629-136577651 TTAGGTTTAGGGAGAACAGCAGG - Intronic
1017961335 6:159223854-159223876 TCGTGTGTAGTGCACACAGCAGG + Intronic
1019777220 7:2918978-2919000 TAGTGTGTCGGGCACACAGCAGG - Intronic
1021121223 7:16797950-16797972 CTGTGTTTGGGGAAGACATCTGG + Intronic
1021246644 7:18271343-18271365 GTGTGCTTAGGCAAGACAGCTGG - Intronic
1021248303 7:18291923-18291945 TTGGGTTTAGGCAACACTGTTGG + Intronic
1022980205 7:35597782-35597804 TTGTGTTTGGGGAAAAAAGCAGG + Intergenic
1027535114 7:79390089-79390111 GTGTGTTCAGAGAAGACAGCAGG + Intronic
1030923730 7:115424809-115424831 CTGTGAACAGGGAACACAGCAGG - Intergenic
1032585981 7:133146790-133146812 GTGTGTCAAGGGAACACAGGAGG - Intergenic
1032618504 7:133501437-133501459 TTGTCATCAGAGAACACAGCTGG - Intronic
1034551111 7:151821279-151821301 GTGTGTCTAGGGAACAAAGGAGG - Intronic
1039760778 8:40572539-40572561 TTGAGCTTAGGGAACACTCCAGG - Intronic
1040939355 8:52817008-52817030 CTGAGTTTTGGGAGCACAGCAGG + Intergenic
1041447542 8:57969327-57969349 TTGTGCTTACAGAACTCAGCTGG - Intergenic
1041457708 8:58078190-58078212 TTGTTTTTAGAGAACACACTGGG + Intronic
1048364844 8:133729772-133729794 TTGTGTTTAGAGAATACTGTGGG + Intergenic
1049659154 8:143811950-143811972 TTGTCTGTAGGGAAGACAGATGG - Intronic
1049985614 9:948147-948169 TTGTGCTTTGGGAACACAGTGGG + Intronic
1050618921 9:7432770-7432792 TTTTGTTTAGGGACCACTGCTGG + Intergenic
1055599512 9:77901194-77901216 TTGTGTTTTTGGAATACAGGTGG - Intronic
1059890874 9:118802423-118802445 TTTTGGTTAGGGAACATTGCTGG - Intergenic
1186062193 X:5721105-5721127 TAGTTTTTAGTGAATACAGCAGG - Intergenic
1187252883 X:17614910-17614932 GTGAGATTAGGGAACACAGGAGG - Intronic
1188363919 X:29291134-29291156 TTGTATTCAGGGAACTAAGCAGG - Intronic
1197005396 X:121490277-121490299 TGGAGTTTAGGAAAGACAGCCGG - Intergenic
1197656106 X:129117543-129117565 TTATAGTTATGGAACACAGCAGG - Intergenic
1197967017 X:132075668-132075690 TTGTGTTTCAGTTACACAGCAGG - Intergenic
1198994337 X:142556992-142557014 TTGTGTCCATGGAACACAGCAGG + Intergenic
1199456374 X:148033885-148033907 TTGTGGTGATGGAATACAGCAGG + Intergenic
1199616553 X:149660304-149660326 TTAGGTTTAAGGGACACAGCTGG + Intergenic
1199626088 X:149742944-149742966 TTAGGTTTAAGGGACACAGCTGG - Intergenic
1201528676 Y:14966019-14966041 ATGTGTTTAGAGAAAACAGGAGG + Intergenic
1202240467 Y:22761987-22762009 ATGTATTTAGGAAACATAGCTGG + Intergenic
1202393453 Y:24395740-24395762 ATGTATTTAGGAAACATAGCTGG + Intergenic
1202477332 Y:25274360-25274382 ATGTATTTAGGAAACATAGCTGG - Intergenic