ID: 1088283254

View in Genome Browser
Species Human (GRCh38)
Location 11:108159493-108159515
Sequence GCTTATTGGTCCTGTGATCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 2, 1: 0, 2: 0, 3: 6, 4: 112}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088283254_1088283258 11 Left 1088283254 11:108159493-108159515 CCATGATCACAGGACCAATAAGC 0: 2
1: 0
2: 0
3: 6
4: 112
Right 1088283258 11:108159527-108159549 GATTCAAACCCAGACTTGTAGGG 0: 1
1: 1
2: 4
3: 27
4: 213
1088283254_1088283257 10 Left 1088283254 11:108159493-108159515 CCATGATCACAGGACCAATAAGC 0: 2
1: 0
2: 0
3: 6
4: 112
Right 1088283257 11:108159526-108159548 GGATTCAAACCCAGACTTGTAGG 0: 1
1: 1
2: 11
3: 61
4: 359

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088283254 Original CRISPR GCTTATTGGTCCTGTGATCA TGG (reversed) Intronic