ID: 1088283257

View in Genome Browser
Species Human (GRCh38)
Location 11:108159526-108159548
Sequence GGATTCAAACCCAGACTTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 433
Summary {0: 1, 1: 1, 2: 11, 3: 61, 4: 359}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088283254_1088283257 10 Left 1088283254 11:108159493-108159515 CCATGATCACAGGACCAATAAGC 0: 2
1: 0
2: 0
3: 6
4: 112
Right 1088283257 11:108159526-108159548 GGATTCAAACCCAGACTTGTAGG 0: 1
1: 1
2: 11
3: 61
4: 359
1088283256_1088283257 -4 Left 1088283256 11:108159507-108159529 CCAATAAGCAGTAGATGCAGGAT 0: 2
1: 0
2: 1
3: 13
4: 154
Right 1088283257 11:108159526-108159548 GGATTCAAACCCAGACTTGTAGG 0: 1
1: 1
2: 11
3: 61
4: 359

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088283257 Original CRISPR GGATTCAAACCCAGACTTGT AGG Intronic