ID: 1088289544

View in Genome Browser
Species Human (GRCh38)
Location 11:108222046-108222068
Sequence TTATTAGAAGGGCGCCAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 90}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088289538_1088289544 2 Left 1088289538 11:108222021-108222043 CCAAATTCGTAGTTATAAGGGCG 0: 1
1: 0
2: 0
3: 2
4: 12
Right 1088289544 11:108222046-108222068 TTATTAGAAGGGCGCCAGGAAGG 0: 1
1: 0
2: 1
3: 8
4: 90
1088289533_1088289544 10 Left 1088289533 11:108222013-108222035 CCCTACTCCCAAATTCGTAGTTA 0: 1
1: 0
2: 1
3: 6
4: 76
Right 1088289544 11:108222046-108222068 TTATTAGAAGGGCGCCAGGAAGG 0: 1
1: 0
2: 1
3: 8
4: 90
1088289534_1088289544 9 Left 1088289534 11:108222014-108222036 CCTACTCCCAAATTCGTAGTTAT 0: 1
1: 0
2: 0
3: 5
4: 90
Right 1088289544 11:108222046-108222068 TTATTAGAAGGGCGCCAGGAAGG 0: 1
1: 0
2: 1
3: 8
4: 90
1088289537_1088289544 3 Left 1088289537 11:108222020-108222042 CCCAAATTCGTAGTTATAAGGGC 0: 1
1: 0
2: 0
3: 5
4: 35
Right 1088289544 11:108222046-108222068 TTATTAGAAGGGCGCCAGGAAGG 0: 1
1: 0
2: 1
3: 8
4: 90
1088289532_1088289544 11 Left 1088289532 11:108222012-108222034 CCCCTACTCCCAAATTCGTAGTT 0: 1
1: 0
2: 0
3: 5
4: 95
Right 1088289544 11:108222046-108222068 TTATTAGAAGGGCGCCAGGAAGG 0: 1
1: 0
2: 1
3: 8
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088289544 Original CRISPR TTATTAGAAGGGCGCCAGGA AGG Intronic
902557410 1:17255110-17255132 TTCTTAGAAGTGCTCCAGGTGGG - Intronic
906716396 1:47972870-47972892 TTACTAGGAGGGATCCAGGAGGG - Intronic
907322619 1:53615141-53615163 TTACTAGAGGTGGGCCAGGAGGG - Intronic
917225444 1:172776708-172776730 TTATTAGAAAGAAGCCAGTAAGG - Intergenic
920281672 1:204848083-204848105 GACTTAGAAGGGCCCCAGGAGGG + Intronic
921085638 1:211789583-211789605 TTATTATAAGGGTACCAGGCTGG + Intronic
1063136506 10:3221494-3221516 TTAGTAAATGGGCGGCAGGATGG + Intergenic
1064855575 10:19764084-19764106 TTATCAGAAGGGCTCAAAGAAGG - Intronic
1074065034 10:110006925-110006947 TCATTAGAATGGCGCTCGGAGGG + Intronic
1079396612 11:20069123-20069145 TTTTTAAAAGGGGGACAGGAAGG + Intronic
1086021209 11:82231999-82232021 TTATTAGAAAGGGGCAGGGAAGG - Intergenic
1087720665 11:101661928-101661950 TCATTAAAAGGGTGACAGGAAGG - Intronic
1088289544 11:108222046-108222068 TTATTAGAAGGGCGCCAGGAAGG + Intronic
1089789323 11:120931258-120931280 TTATTAGGAGGGCCCCTGCAGGG + Intronic
1090657941 11:128860073-128860095 ATTTCAGAAGGGCGCCCGGAAGG + Intronic
1091472442 12:740958-740980 TCATTAGAAGGACGCCTCGAGGG - Intergenic
1094272934 12:28637377-28637399 TGAGGAGAAGGGCGCCAGCAGGG - Intergenic
1098864508 12:75746679-75746701 TTCTTAAAAGGGCGACATGAGGG - Intergenic
1099750191 12:86763870-86763892 TTATTAGAGGGCAGCCAAGACGG + Intronic
1102397804 12:112602265-112602287 TTGTTAGAAAGGCACCATGAAGG - Intronic
1107542637 13:41406374-41406396 TGATTAGAAGGTCCACAGGAAGG + Intergenic
1107726643 13:43306029-43306051 TGGTTAGAAGGGCTCCAGGAGGG + Intronic
1111663490 13:91239483-91239505 TTCTTCGCAGGGCGGCAGGAAGG - Intergenic
1111985689 13:95064674-95064696 TTATTAGTAGATGGCCAGGATGG + Intronic
1118896695 14:69951191-69951213 TTATTACAAGAGGCCCAGGAAGG + Intronic
1119328924 14:73779484-73779506 ATATTAGGAGGGCACCAGGTAGG - Intronic
1125984448 15:44036368-44036390 TAATTAGAAGGGACCCAGGAGGG - Intronic
1130380843 15:83371317-83371339 GGATTAGAAGGGAGTCAGGATGG + Intergenic
1133811674 16:9165640-9165662 GGATTAGAAGGGCTCCAAGATGG - Intergenic
1134672599 16:16066952-16066974 TTAGAAGATGGGAGCCAGGATGG + Intronic
1135872324 16:26162362-26162384 TTCTTAAAAGGACGCCAGGCCGG + Intergenic
1136988124 16:35131540-35131562 TTATTAGAAAGGAGCCAACAAGG + Intergenic
1141980077 16:87544756-87544778 TTTTTATAAGTGCCCCAGGATGG + Intergenic
1142385006 16:89758479-89758501 TAATTAGATGGGCACCAGCATGG + Intronic
1145977784 17:28994158-28994180 TTATTAGAAGGCCTCGAGCATGG + Intronic
1148322485 17:46765910-46765932 TTATCAGAAGGGCACCATGTTGG + Intronic
1150184749 17:63168759-63168781 TTTTTAGAAGGTGGCAAGGAAGG + Intronic
1152626388 17:81389628-81389650 TTATTAGAGGGGATCAAGGAAGG - Intergenic
1161092978 19:2372050-2372072 TTAGTAGATGGGGGCCAGGCTGG + Intergenic
1164040836 19:21491324-21491346 TTATAAGAAGGGAGCTAGCAGGG - Intergenic
1164789557 19:30964547-30964569 TGTTTACAAGGGAGCCAGGAAGG + Intergenic
1164960531 19:32424943-32424965 TTTTCAGCAGGGCACCAGGAAGG + Intronic
1166348821 19:42184341-42184363 TTCTGGGAAGGGCGGCAGGAAGG - Intronic
925902772 2:8520328-8520350 TTAATAGAAAGGCCCAAGGAAGG - Intergenic
928343672 2:30469788-30469810 TTTTTAGTAGAGAGCCAGGATGG + Intronic
929357135 2:41039330-41039352 TTATTAACAGAGCGCTAGGATGG - Intergenic
931865040 2:66400209-66400231 TTATAAGAAGGGGACAAGGAAGG + Intergenic
933917886 2:87014763-87014785 TTATTTTAAGGGCACTAGGAAGG + Intronic
934005109 2:87755151-87755173 TTATTTTAAGGGCACTAGGAAGG - Intronic
935768066 2:106389243-106389265 TTATTTTAAGGGCACTAGGAAGG - Intergenic
936072658 2:109381654-109381676 TTGTCAGAAGGCCCCCAGGATGG + Intronic
940101725 2:150047807-150047829 TTATTTGAAGGGAACTAGGAGGG + Intergenic
941649168 2:168074721-168074743 TTATAAGAAAGTCGCCATGAGGG - Intronic
947777522 2:232725733-232725755 TTATTAGACTGGCGCCTTGAGGG + Intronic
948007376 2:234621509-234621531 TTATTAGAAGGCACCCAGCAAGG - Intergenic
948255598 2:236566271-236566293 TTATTGGAAAGGGGTCAGGAAGG - Intergenic
948571672 2:238921726-238921748 GTATTAGAGGGGCCCCTGGAAGG + Intergenic
1172037821 20:32022384-32022406 ATCTTAGAAGGGCATCAGGAAGG + Intronic
1172470759 20:35193125-35193147 TGATTAGAAGGGAGACATGAGGG + Intergenic
1172479706 20:35263866-35263888 CTGGTAGAAGGGCGCCATGATGG - Exonic
1178547460 21:33504485-33504507 TTAAAAGAAGGGAGCAAGGATGG + Exonic
949929651 3:9068792-9068814 TTACTAGAAGGGCTCCTGGAAGG - Intronic
953872965 3:46643579-46643601 TTATTAGATGGTCCCCAGGGAGG + Intergenic
959148551 3:102579917-102579939 TTATTAGAAGGTGGCTAGGAAGG - Intergenic
959860779 3:111212513-111212535 ATATTAGAAGAGGTCCAGGAGGG - Intronic
959959944 3:112286898-112286920 TTATTAGAAGGCCACCAAGAAGG - Intronic
960356805 3:116663770-116663792 TTATTACAAGGGGCCCAGGAGGG + Intronic
965063827 3:163817723-163817745 TTTTTAAAAGGGCAGCAGGAGGG - Intergenic
967570463 3:191022283-191022305 TTAATATAAGGGAGCAAGGAAGG + Intergenic
973347013 4:49067837-49067859 ACATTAGAAGGGAGCCAAGATGG + Intergenic
977294888 4:95199216-95199238 ACATTAGCAGGGCGCCAAGAAGG + Intronic
985401191 4:189595873-189595895 TGACTGGAAGGGCACCAGGAAGG - Intergenic
990919292 5:60945130-60945152 TTACTAGAAGGGCTCCAGGATGG + Exonic
993886996 5:93426357-93426379 TCATTTGAAGGGCACCAGGCAGG + Intergenic
996039800 5:118797048-118797070 TTACTAGAAGGGCACCAATATGG - Intergenic
999420490 5:151437992-151438014 TTAATAGGAGGGAGGCAGGAGGG - Intronic
1003109957 6:3245191-3245213 TTATTAAAAAGGCCCCAGGCTGG - Intronic
1005133895 6:22544351-22544373 TTATTTGAAAGGAGCTAGGAAGG + Intergenic
1007943809 6:45807175-45807197 TTAGTAGATGGGAGACAGGAGGG + Intergenic
1009847132 6:69148216-69148238 TTATTAAAAGGAAGACAGGAAGG - Intronic
1013908765 6:115249043-115249065 TCATTAGAAGGGAGACAGGAAGG + Intergenic
1018128913 6:160709423-160709445 TTATTTTAAGGGCACTAGGAAGG - Intronic
1020926222 7:14329246-14329268 TTCTAAGAAGGGTGCTAGGAGGG - Intronic
1035620212 8:1030907-1030929 TTCTGAGAAGGGCGCAAGGTCGG + Intergenic
1036581883 8:10082446-10082468 TTCTTAGGAGGGCGAAAGGAAGG - Intronic
1037540003 8:19862013-19862035 TAATTAGAAGGGCAGCAGCATGG + Intergenic
1038549324 8:28452313-28452335 TTATCAGAAGATCGCCAGGGTGG + Exonic
1039486810 8:37916511-37916533 TAATTGGAAGGGCGGGAGGAGGG - Intergenic
1045664246 8:104468365-104468387 TTTTAAGAAGGGCAACAGGATGG + Intergenic
1047362227 8:124179481-124179503 TAATTAGAGGGGAGCAAGGATGG + Intergenic
1053241661 9:36500561-36500583 TTAGTAGAGGGGAGCCATGAAGG + Intergenic
1055650927 9:78406315-78406337 TTATTTAAAGGGTGCCAGAAAGG - Intergenic
1055688353 9:78802669-78802691 TTATTAAAATGACACCAGGATGG + Intergenic
1059355757 9:113698181-113698203 TTATTAGCAAGGCTGCAGGAGGG - Intergenic
1185655910 X:1685389-1685411 TTATTACAGTGGCCCCAGGAAGG + Intergenic
1186078698 X:5907651-5907673 TTAATAGCAGGGCCCCAGGGAGG + Intronic
1196595100 X:117536751-117536773 TTCTTCAAAGGGCGGCAGGAAGG - Intergenic
1199362437 X:146938049-146938071 TTATTTCAAGGGTGCAAGGATGG - Intergenic
1199718874 X:150527473-150527495 CTATTGGAAAGGTGCCAGGAAGG - Intergenic
1201516702 Y:14825747-14825769 TTATTAGCAGGGCCCCAGGGAGG - Intronic